ID: 985580746

View in Genome Browser
Species Human (GRCh38)
Location 5:694034-694056
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985580741_985580746 4 Left 985580741 5:694007-694029 CCGCCCTTCACGCAGGAGTGGAG No data
Right 985580746 5:694034-694056 GGAGCGCGCACCCCTGACCCCGG No data
985580744_985580746 0 Left 985580744 5:694011-694033 CCTTCACGCAGGAGTGGAGGAGC No data
Right 985580746 5:694034-694056 GGAGCGCGCACCCCTGACCCCGG No data
985580736_985580746 28 Left 985580736 5:693983-694005 CCAGCGCAGCTGCTCGGGAGTGG No data
Right 985580746 5:694034-694056 GGAGCGCGCACCCCTGACCCCGG No data
985580735_985580746 29 Left 985580735 5:693982-694004 CCCAGCGCAGCTGCTCGGGAGTG No data
Right 985580746 5:694034-694056 GGAGCGCGCACCCCTGACCCCGG No data
985580743_985580746 1 Left 985580743 5:694010-694032 CCCTTCACGCAGGAGTGGAGGAG 0: 2
1: 0
2: 0
3: 6
4: 160
Right 985580746 5:694034-694056 GGAGCGCGCACCCCTGACCCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type