ID: 985580754

View in Genome Browser
Species Human (GRCh38)
Location 5:694059-694081
Sequence TCAGCTTCCGTTCTCCCTGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985580744_985580754 25 Left 985580744 5:694011-694033 CCTTCACGCAGGAGTGGAGGAGC No data
Right 985580754 5:694059-694081 TCAGCTTCCGTTCTCCCTGCAGG No data
985580741_985580754 29 Left 985580741 5:694007-694029 CCGCCCTTCACGCAGGAGTGGAG No data
Right 985580754 5:694059-694081 TCAGCTTCCGTTCTCCCTGCAGG No data
985580743_985580754 26 Left 985580743 5:694010-694032 CCCTTCACGCAGGAGTGGAGGAG No data
Right 985580754 5:694059-694081 TCAGCTTCCGTTCTCCCTGCAGG No data
985580749_985580754 -10 Left 985580749 5:694046-694068 CCTGACCCCGGCCTCAGCTTCCG No data
Right 985580754 5:694059-694081 TCAGCTTCCGTTCTCCCTGCAGG No data
985580747_985580754 -8 Left 985580747 5:694044-694066 CCCCTGACCCCGGCCTCAGCTTC No data
Right 985580754 5:694059-694081 TCAGCTTCCGTTCTCCCTGCAGG No data
985580748_985580754 -9 Left 985580748 5:694045-694067 CCCTGACCCCGGCCTCAGCTTCC No data
Right 985580754 5:694059-694081 TCAGCTTCCGTTCTCCCTGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985580754 Original CRISPR TCAGCTTCCGTTCTCCCTGC AGG Intergenic