ID: 985583957

View in Genome Browser
Species Human (GRCh38)
Location 5:717564-717586
Sequence AGGGAGACTATAGCATGTGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 178
Summary {0: 2, 1: 0, 2: 0, 3: 15, 4: 161}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985583957_985583961 10 Left 985583957 5:717564-717586 CCATCACATGCTATAGTCTCCCT 0: 2
1: 0
2: 0
3: 15
4: 161
Right 985583961 5:717597-717619 AATCCTTAAAAATTATAATCAGG No data
985583957_985583963 20 Left 985583957 5:717564-717586 CCATCACATGCTATAGTCTCCCT 0: 2
1: 0
2: 0
3: 15
4: 161
Right 985583963 5:717607-717629 AATTATAATCAGGATATAAACGG 0: 1
1: 0
2: 3
3: 43
4: 722

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985583957 Original CRISPR AGGGAGACTATAGCATGTGA TGG (reversed) Intronic
900935184 1:5760584-5760606 AGAGAGAAGAGAGCATGTGAAGG - Intergenic
902257516 1:15199625-15199647 TGGGAGACTATGGCAGCTGAAGG - Intronic
902774564 1:18666480-18666502 AGGAAGACTATGGCATTTGCAGG - Intronic
904638108 1:31900279-31900301 AGGTAGACTCTTGGATGTGAGGG - Intergenic
905921723 1:41723992-41724014 AGGCAGATTATAGCATTTGAAGG - Intronic
906187302 1:43871604-43871626 AGGGAGAAGATGGGATGTGAGGG + Intronic
906187311 1:43871642-43871664 AGGGAGAAGATGGGATGTGAGGG + Intronic
907395163 1:54184613-54184635 AGGGAGACAATAGGGAGTGATGG + Intronic
911344807 1:96683364-96683386 AGTGGAACTATAGCATGTGAAGG + Intergenic
913354313 1:117901520-117901542 AGGGAGACAATAACAAGTGTTGG - Intronic
914230819 1:145763931-145763953 AGGGAGACCATGGCAAGAGAGGG - Intronic
916434974 1:164769471-164769493 AGTGAGACTTCATCATGTGAAGG - Intronic
916677495 1:167076092-167076114 AGGGAGACTGTAGCAGCTAAAGG + Intronic
918489825 1:185069540-185069562 AGTGAGACCCTAGCATGTGCTGG - Intronic
918716555 1:187795496-187795518 ATGCAGTCTATAGCTTGTGATGG + Intergenic
1063566755 10:7177917-7177939 ACAGAGACTAGACCATGTGAGGG + Intronic
1064937452 10:20693940-20693962 AGGCAAACTATAGACTGTGATGG - Intergenic
1069403701 10:68075856-68075878 AGGGAGAGTGTAGAAAGTGATGG - Intergenic
1074430784 10:113392575-113392597 AAGGAGACTATGCCAGGTGAAGG + Intergenic
1074529344 10:114286414-114286436 AGGCAGCCCAAAGCATGTGATGG + Exonic
1074758124 10:116642799-116642821 TTGGAGACTATAGCATTAGAGGG + Intronic
1078179735 11:9001491-9001513 AGGGAGAGGATAGCATCAGAGGG - Intronic
1079114719 11:17633996-17634018 AGGGAGAGTCTAGCCTGGGAAGG + Intronic
1079493632 11:21016593-21016615 TGGGAGACTATAGCAGGGAAAGG - Intronic
1080261777 11:30357228-30357250 AGAAAGAGTATAGCAAGTGAAGG - Intergenic
1081674437 11:44960380-44960402 AGGGAGACGACAGCAGGTGGTGG - Intergenic
1084937111 11:72592720-72592742 TGGCAGACTTTAGCATCTGAGGG + Intronic
1085970651 11:81586422-81586444 AAGCATACTATGGCATGTGAGGG - Intergenic
1088009722 11:104985679-104985701 AGGGAGAGTACAGCATCTGAGGG + Intergenic
1089726011 11:120480949-120480971 AGGGAGACAATGGCAGGAGATGG + Intronic
1091158302 11:133394565-133394587 ATGGTTACTATAGCATGGGAAGG - Intronic
1091827205 12:3521763-3521785 AGGGAGACTAAAGTATCTGCTGG + Intronic
1094716238 12:33017713-33017735 AGGGAGGCTGTACCCTGTGAAGG + Intergenic
1096534368 12:52261727-52261749 AGGGAGGCCAGAGGATGTGAAGG + Intronic
1097026462 12:56059597-56059619 AGAGAGAGTATAGTATGTAATGG - Intergenic
1097799856 12:63901728-63901750 AGCTAGACTCTAGCATTTGATGG + Intronic
1098572805 12:72008080-72008102 AGGGACTTTATAGCTTGTGAAGG + Intronic
1101157480 12:101941334-101941356 ATGGAGAAAATAGCATGTAAGGG + Intronic
1103351530 12:120287061-120287083 AGGGACACTGAAGCATGAGAGGG + Intergenic
1104030152 12:125059086-125059108 AGGGAGAGTACAGAATGTGGGGG - Intergenic
1104422880 12:128651689-128651711 AGGGAGACCATAGCAGGGAATGG + Intronic
1105319886 13:19308953-19308975 CAGGAGACTTTAGCAGGTGATGG + Intergenic
1106178707 13:27352705-27352727 AGGGAAACCATAGCATGTCTTGG + Intergenic
1106353290 13:28955656-28955678 AGGGAGACAATGGCATCTGAAGG - Intronic
1107416270 13:40203703-40203725 AGGGAGACTATATTATATTAAGG + Intergenic
1108699699 13:52933346-52933368 AGGGAGACTGATGCAAGTGAGGG - Intergenic
1109106503 13:58258779-58258801 AGAGAAACTATAGTATGTGAAGG + Intergenic
1113079696 13:106505478-106505500 AGTGAGACAAGAGTATGTGAAGG + Intronic
1114276550 14:21151158-21151180 AGATTGACTATAGCAAGTGATGG - Intergenic
1117782398 14:59247155-59247177 AGGGAGACTAGACCATTTAATGG - Intronic
1119638909 14:76299094-76299116 AGGGAGACAGTACCATGTGCCGG + Intergenic
1120591543 14:86380024-86380046 AGAAAGTGTATAGCATGTGATGG + Intergenic
1124095481 15:26644848-26644870 AGGGACACATCAGCATGTGATGG + Intronic
1125303505 15:38283199-38283221 AGGGAGACAAGAGCGTGTTAAGG + Intronic
1125429703 15:39581993-39582015 AGGGAGAGGACAGCACGTGAGGG - Intronic
1127384670 15:58457597-58457619 ATGGAGAAGATAGCATCTGAAGG - Intronic
1129203946 15:74024211-74024233 AGGGAGGCTATGGAATCTGAAGG + Intronic
1131981700 15:98000608-98000630 AGGGAGGCTGGAGCATGAGACGG - Intergenic
1132425061 15:101709215-101709237 AGCAAAACTAAAGCATGTGAAGG - Intronic
1136184196 16:28576000-28576022 AGAGAGACAATAGCATGTGTTGG + Intronic
1137442947 16:48511504-48511526 AGGGAGCCTACGTCATGTGATGG - Intergenic
1140152585 16:72385460-72385482 AGGGAGACTATTGCCTGAAAAGG - Intergenic
1143241214 17:5444723-5444745 AGGGAAACTACCGCCTGTGAAGG + Intronic
1143368284 17:6422545-6422567 AGGAAGCCCATAGCATGTGGTGG - Intronic
1143875324 17:9986705-9986727 ACGGAGACTCTAGCTTGTGGGGG - Intronic
1144337638 17:14286038-14286060 AAGGAGACTATTTCTTGTGAAGG + Intergenic
1144480115 17:15622033-15622055 AGGAAGGCTATAGGATGCGAAGG + Intronic
1144918189 17:18741705-18741727 AGGAAGGCTATAGGATGCGAAGG - Intergenic
1151139501 17:71977942-71977964 AGGGAGATGGTAGCATGAGAAGG + Intergenic
1152760650 17:82105575-82105597 TAGGAGACTTTAGCAGGTGAGGG - Intronic
1152830562 17:82494711-82494733 AGGGAGTCTATAGCAGAGGATGG + Intergenic
1155976074 18:32133004-32133026 AGGAAGAAAATAGGATGTGAGGG + Intronic
1158587911 18:58757047-58757069 ACGGAGACTAAACCATGTGTTGG + Intergenic
1159334029 18:67039971-67039993 AGGCAGAATATAGCATATAAAGG - Intergenic
1159436973 18:68430850-68430872 AGGGAGACAATTGCATGGGTAGG + Intergenic
1161565419 19:4999391-4999413 AGGGAGACTACAGGATGAGCTGG - Intronic
1164909622 19:31995275-31995297 AGAGAGCCTCTAGCATGTGCAGG + Intergenic
1165365967 19:35365114-35365136 AGGCAGACAATAACAAGTGATGG - Intergenic
1168126757 19:54288203-54288225 AGGGAGATTCTAGCATGAGAGGG - Intergenic
1168173639 19:54607725-54607747 TGGGAGATTCTAGCATGAGAGGG + Intronic
1168572460 19:57482596-57482618 AGGGAGACCATGGCAAGAGAGGG - Intergenic
926574351 2:14563733-14563755 AGTTAGACTATTGCAGGTGATGG + Intergenic
926734121 2:16059527-16059549 ATGGAGCCTGTACCATGTGAGGG + Intergenic
929650088 2:43670408-43670430 AGGGAGATTGTAGTATGTGATGG + Intronic
931378564 2:61730914-61730936 AGAGAGAGTATAGCGTGTAATGG + Intergenic
932122166 2:69112029-69112051 AGGGATTTTATATCATGTGAAGG + Intronic
932215748 2:69964899-69964921 AGGGAGACTAAAGCAGGCAAAGG - Intergenic
932562592 2:72886739-72886761 AGGGAGACTGTAGCATGAGCAGG + Intergenic
937358343 2:121212328-121212350 AGGGGGACTAGAGAATGTTAGGG - Intergenic
937765075 2:125651794-125651816 AGGGAGAATATTGCATCTGGTGG - Intergenic
937801193 2:126082014-126082036 AGTGAGCATATAGCATGAGAGGG + Intergenic
941840212 2:170074502-170074524 AGGGAGGCTATACGATGAGATGG - Intronic
942456018 2:176139000-176139022 AGGGAGCCGATAGCATGTCCGGG + Intergenic
943301745 2:186211363-186211385 ATGGAGATTATAAGATGTGATGG - Intergenic
943954108 2:194163710-194163732 AGGGAAACTAGAGCATTCGAAGG + Intergenic
946884052 2:224205392-224205414 AGGGTGACTATAGCTGGAGATGG + Intergenic
1170184398 20:13571940-13571962 AGGGATATTTGAGCATGTGAAGG - Intronic
1174890224 20:54383860-54383882 AGGGAGCATACAGCATTTGAAGG - Intergenic
1177787637 21:25689309-25689331 AGTGAGAATATAGCATGTTGTGG + Intronic
1178919823 21:36731359-36731381 AGGGAGACTCTAGCAGGTGTAGG + Intronic
1179890079 21:44330925-44330947 AGGGAGACAAAGGCGTGTGAGGG + Intronic
1182359540 22:29738452-29738474 AGGGAGACAAAGGCAAGTGAGGG + Intronic
950076763 3:10192903-10192925 AGCGAGACTATAGCAAATGATGG + Intronic
952155405 3:30638414-30638436 AGGGAGACTATGGCGTGTGCAGG - Intronic
954941148 3:54374399-54374421 AGGGAGTCAAGAGCATGTGGTGG + Intronic
955031415 3:55224145-55224167 AGGGAGACTAAAGTAGGTAAGGG + Intergenic
955083173 3:55676681-55676703 GGGGAGAAAAGAGCATGTGAAGG - Intronic
958017580 3:87959150-87959172 AGGAAGACAATAGCATATAATGG + Intergenic
959474347 3:106790862-106790884 GGTGAGACTCTAACATGTGATGG + Intergenic
961480742 3:127178228-127178250 AGGGCAACTGTAGCATTTGATGG - Intergenic
962069637 3:132020132-132020154 TGGGAGACAAGAGCTTGTGAAGG + Intronic
962528746 3:136258979-136259001 AAGGAGACAATAGCATAGGAAGG - Intronic
962679092 3:137780398-137780420 GGGGACACTACAGCAGGTGAAGG - Intergenic
963285266 3:143428997-143429019 AGGGTGACTACAGCATGTAAAGG + Intronic
967004243 3:185368560-185368582 AGGGAGAGTATAGCCTGTCTAGG - Intronic
968077005 3:195821538-195821560 AGGGAGAGTCTGGCATGTGTAGG - Intergenic
968139291 3:196243551-196243573 AGGGAGACCATAGAAAGAGAGGG - Intronic
969155130 4:5203489-5203511 AGGGAGACAGGAGCATGTGCTGG - Intronic
969661779 4:8534282-8534304 AGGGAGAGTGGAGCATGTGCTGG + Intergenic
971721896 4:30255752-30255774 AGGGAGAGTATACCATATCAAGG - Intergenic
973862621 4:55080119-55080141 AGGGAGTCTGTGGCATCTGAAGG - Exonic
975871308 4:78781637-78781659 AGGGAGAGTGTAGAATGAGAAGG + Intronic
975885618 4:78961120-78961142 AGAGAGACTGTAGAATGTGCTGG + Intergenic
978095284 4:104768845-104768867 AATGACAGTATAGCATGTGATGG - Intergenic
979050421 4:115923180-115923202 AGGGTGACTATAGCAAATAATGG - Intergenic
980759819 4:137216445-137216467 AGGGAGAATAGATCATGTGGTGG + Intergenic
982883218 4:160746317-160746339 AGGGAGACGATTGAAGGTGAAGG + Intergenic
983310080 4:166048263-166048285 AGGGAGCTTCTACCATGTGAGGG + Intronic
985583957 5:717564-717586 AGGGAGACTATAGCATGTGATGG - Intronic
985597464 5:801864-801886 AGGGAGACTATAGCATGTGATGG - Intronic
991185316 5:63799955-63799977 AGGGAAATGATAGCATGAGAAGG - Intergenic
994435637 5:99728076-99728098 AAGGAGACTATATAATGTAAGGG + Intergenic
994958868 5:106571933-106571955 AGGGAGAATATAAAATGGGATGG + Intergenic
998037374 5:138928365-138928387 GGGGAGAATATGGCAGGTGAGGG - Intronic
998533680 5:142909131-142909153 AGGGAGACAATAGAATGGGAAGG - Intronic
999531745 5:152470628-152470650 AGAGAGACTGCAGCATGGGAGGG + Intergenic
1001399827 5:171439776-171439798 AGGGAGACTCTAGCATCGGGGGG + Intronic
1002847400 6:959948-959970 AGGTACAATATAGCAAGTGATGG - Intergenic
1012618000 6:101301822-101301844 AGGAAGAATGTAGCATTTGAAGG - Intergenic
1013420865 6:109965589-109965611 ATTGAGACTACAGCCTGTGACGG - Intergenic
1014026497 6:116653202-116653224 ATGAAGACAGTAGCATGTGAAGG - Intronic
1016191568 6:141274272-141274294 AGGGAGCCTTTACCAAGTGACGG + Intergenic
1018115476 6:160579516-160579538 AGGTAGACTATGGGATCTGAAGG + Intronic
1020589752 7:10119905-10119927 AGAGTGACTCCAGCATGTGACGG - Intergenic
1021572984 7:22083749-22083771 AGTGAAAATATATCATGTGAGGG - Intergenic
1021939513 7:25665802-25665824 AGGGAGGGTGTAGAATGTGAAGG + Intergenic
1022556020 7:31297182-31297204 AGGGAAAATATAGCATGGGGAGG - Intergenic
1024554989 7:50595799-50595821 AGGGAAACTATAGGATGAAAAGG + Intronic
1030808146 7:113941892-113941914 AGGGAGGCTTTAAAATGTGAAGG - Intronic
1033998086 7:147377344-147377366 AAGTAGACTATAGCATGATAGGG - Intronic
1034000363 7:147405517-147405539 AGGGAGCATATAGCAAATGAAGG - Intronic
1034315208 7:150124570-150124592 GGGGAGAGTGTAGAATGTGAGGG - Intergenic
1034791683 7:153976229-153976251 GGGGAGAGTGTAGAATGTGAGGG + Intronic
1041178485 8:55222451-55222473 AAGGAGACTGTGGCATGTCATGG - Intronic
1042436543 8:68772940-68772962 AGGCAGACAGGAGCATGTGAAGG - Intronic
1043389497 8:79778365-79778387 ACTGAGACAATAACATGTGATGG - Intergenic
1044945644 8:97386371-97386393 AGGTAGACTATAGAAATTGAAGG - Intergenic
1048051244 8:130818800-130818822 AGGGAGGCAGTGGCATGTGAAGG + Intronic
1049057240 8:140247071-140247093 AGGGAGAAGATAGTATGTCATGG - Intronic
1049183664 8:141237348-141237370 GGGGAGACTGTGGCATGTTATGG - Intronic
1050014182 9:1216326-1216348 AGGGAAACCAAGGCATGTGATGG - Intergenic
1051408434 9:16763938-16763960 CGGAAGACTATAGCAAGTGGGGG + Intronic
1051850061 9:21495872-21495894 TGGAAGACTAGAGCACGTGATGG + Intergenic
1052353496 9:27481430-27481452 AGGGAGACAATAGAGTGTGGTGG + Intronic
1055179211 9:73362719-73362741 GGGGAGGCTATTGAATGTGATGG + Intergenic
1055361109 9:75491380-75491402 AGGGTAGCTATAGGATGTGATGG + Intergenic
1056090481 9:83200577-83200599 AGGGAGACAATAGCATTGGAAGG - Intergenic
1056373221 9:85980098-85980120 GTGGAGGCTATAGGATGTGAAGG + Intronic
1188279776 X:28251584-28251606 AGGTAGACTATTGGATTTGAGGG - Intergenic
1188297516 X:28468216-28468238 ATTGAGACTACAGGATGTGAAGG - Intergenic
1188426367 X:30051969-30051991 AGGGAGATTATAGACTGTCAAGG + Intergenic
1193288791 X:79746227-79746249 AGTGAGATTATCTCATGTGAGGG - Intergenic
1194153750 X:90361400-90361422 AGGGAAACTATAGTCAGTGATGG - Intergenic
1195774146 X:108384532-108384554 TTGGAGACTATTGCATGAGAGGG + Intronic
1196270183 X:113700451-113700473 AGGGAGAGTGTAGCATCTGGGGG - Intergenic
1196551541 X:117032581-117032603 AGGGTGATTATAGCATTTGCTGG - Intergenic
1199138997 X:144287957-144287979 AGGGAGAGCACAGCAAGTGAGGG - Intergenic
1200500100 Y:3938280-3938302 AGGGAAACTATAGTCAGTGATGG - Intergenic