ID: 985584806

View in Genome Browser
Species Human (GRCh38)
Location 5:725174-725196
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 202
Summary {0: 2, 1: 1, 2: 2, 3: 20, 4: 177}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985584806_985584818 30 Left 985584806 5:725174-725196 CCTGCCTTGTGAGGACAAGCAGA 0: 2
1: 1
2: 2
3: 20
4: 177
Right 985584818 5:725227-725249 TCATCAGACACCGGATCTGCCGG 0: 2
1: 14
2: 167
3: 781
4: 1432
985584806_985584813 3 Left 985584806 5:725174-725196 CCTGCCTTGTGAGGACAAGCAGA 0: 2
1: 1
2: 2
3: 20
4: 177
Right 985584813 5:725200-725222 GGCCATCGGAGAACCAGGAAGGG 0: 1
1: 1
2: 3
3: 15
4: 236
985584806_985584812 2 Left 985584806 5:725174-725196 CCTGCCTTGTGAGGACAAGCAGA 0: 2
1: 1
2: 2
3: 20
4: 177
Right 985584812 5:725199-725221 AGGCCATCGGAGAACCAGGAAGG 0: 1
1: 1
2: 2
3: 11
4: 140
985584806_985584811 -2 Left 985584806 5:725174-725196 CCTGCCTTGTGAGGACAAGCAGA 0: 2
1: 1
2: 2
3: 20
4: 177
Right 985584811 5:725195-725217 GAGGAGGCCATCGGAGAACCAGG No data
985584806_985584814 4 Left 985584806 5:725174-725196 CCTGCCTTGTGAGGACAAGCAGA 0: 2
1: 1
2: 2
3: 20
4: 177
Right 985584814 5:725201-725223 GCCATCGGAGAACCAGGAAGGGG 0: 1
1: 2
2: 15
3: 145
4: 519
985584806_985584817 21 Left 985584806 5:725174-725196 CCTGCCTTGTGAGGACAAGCAGA 0: 2
1: 1
2: 2
3: 20
4: 177
Right 985584817 5:725218-725240 AAGGGGCTCTCATCAGACACCGG 0: 4
1: 0
2: 3
3: 22
4: 233

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985584806 Original CRISPR TCTGCTTGTCCTCACAAGGC AGG (reversed) Intronic
900069034 1:754954-754976 TTTCCTTGTCCTGATAAGGCTGG - Intergenic
900078631 1:837925-837947 TGTGCTTGTCCTCAGAGGGTGGG + Intergenic
901740067 1:11335831-11335853 TCTTCATGGCCTCACAAGGTGGG + Intergenic
902514971 1:16985187-16985209 TCTCCTTGTCCTCCAAAGGAGGG + Intergenic
903278362 1:22236060-22236082 TCTTCTTCTCCCCACAAGGAAGG + Intergenic
904924098 1:34032461-34032483 TGCGCCTGTCCTGACAAGGCTGG - Intronic
907419223 1:54335695-54335717 TCTGCCTGTCCTCAGGAGCCAGG + Intronic
907526947 1:55059343-55059365 GCTCCTTGTCCCCAGAAGGCTGG + Intronic
908023069 1:59918074-59918096 TCTGCTTTTCCTAGCAAGACAGG - Intronic
909433247 1:75614581-75614603 TTTGCTTTTCCTCCCAAGTCTGG - Intergenic
909691179 1:78409537-78409559 CCTGCTTCTCCTCATTAGGCGGG + Intronic
910870820 1:91831079-91831101 TCTGCTAGACCTCACAAGCTGGG + Intronic
911902218 1:103521179-103521201 TCTCCTTGACCTCCAAAGGCTGG - Intergenic
912473060 1:109918913-109918935 TCTGCTTGCCCTCCAAATGCTGG - Intronic
920719748 1:208375941-208375963 TGTGGTTCTCTTCACAAGGCTGG - Intergenic
923499608 1:234553918-234553940 TCTGCTTGTCCATACAACGGGGG - Intergenic
1066582820 10:36899473-36899495 TGTGCTTGTCAAAACAAGGCTGG - Intergenic
1066650828 10:37653543-37653565 TCTGCTTTTACACAGAAGGCTGG - Intergenic
1067034383 10:42902045-42902067 TCTGCTTTTACACAGAAGGCTGG - Intergenic
1071722103 10:88157489-88157511 GCTGCTTTTCCTGACAATGCTGG + Intergenic
1072964242 10:99957081-99957103 TCTGCCTCTCCTCACAGAGCCGG - Exonic
1074202048 10:111246188-111246210 TCTGCGTGCCCGCAAAAGGCAGG + Intergenic
1074487600 10:113901727-113901749 AATGCCTATCCTCACAAGGCAGG + Exonic
1077242821 11:1519644-1519666 TCTAGTTGTCATCACAAGGGGGG + Intergenic
1080436832 11:32252690-32252712 TCAGCTTGACCTCAGAAGGCTGG + Intergenic
1081099314 11:38982546-38982568 ACAGCTTGGCCTCACAGGGCAGG - Intergenic
1082746516 11:56968732-56968754 TCTGTCTGTCCTCACTGGGCGGG - Intergenic
1086063990 11:82728153-82728175 ACAGCTTGTCCTCATGAGGCAGG + Intergenic
1087095713 11:94315440-94315462 TCTGCTTGTTCTCATATGGGTGG + Intergenic
1088494766 11:110421791-110421813 TTTCCTTGTCCTAACAAGCCTGG + Intergenic
1088967252 11:114736258-114736280 TTTCCTTGTCCTAACAAGCCTGG + Intergenic
1090703761 11:129318092-129318114 TCTGCTGGTCCTCATACGGTGGG - Intergenic
1090712334 11:129398899-129398921 TTTGCTTGACCTCAAAAGCCTGG + Intronic
1092148627 12:6232100-6232122 TCTGCCTGTTCCCAGAAGGCGGG - Intronic
1092441556 12:8509183-8509205 CCTGCTACTCCTCACTAGGCAGG - Intergenic
1092765164 12:11846493-11846515 GCTACTTGTTCTCAGAAGGCTGG - Intronic
1095698347 12:45165374-45165396 CCTGCTTCTCCTCACTGGGCAGG - Intergenic
1097460938 12:59860829-59860851 CCTCCTTGGCCTCCCAAGGCAGG + Intergenic
1103096392 12:118136194-118136216 TCTGCTTGGCCTCGCCATGCCGG + Exonic
1104349937 12:128036163-128036185 TCTTCTTGTTCTCTCCAGGCAGG + Intergenic
1105805792 13:23951003-23951025 TCTGCTTGGCCACCCCAGGCTGG + Intergenic
1106923460 13:34588920-34588942 TCTCCTCCTCCTCCCAAGGCAGG + Intergenic
1107423867 13:40274378-40274400 TCAGTCTGTCCTCACTAGGCAGG - Intergenic
1110514171 13:76389499-76389521 AGTGCTTGTTCTCACAAGCCAGG - Intergenic
1111310285 13:86475374-86475396 TCTGGTTGTCCTCAGTAGGTTGG + Intergenic
1111866317 13:93773052-93773074 ACTGCTTATCCTCACAAGGAAGG + Intronic
1112270060 13:97960191-97960213 TATGTATGTCCTCACAATGCAGG + Intronic
1112398049 13:99051311-99051333 TCTGCTTGAGCCCACAATGCAGG + Intronic
1113310442 13:109127069-109127091 TGTGCTTTTCATCACAAAGCCGG + Intronic
1114233182 14:20802014-20802036 TCTGCTTGTCCTGATACTGCTGG - Exonic
1116570005 14:46504080-46504102 TCTGCTAGTCTTCACATAGCTGG - Intergenic
1117048031 14:51832673-51832695 TCCCTGTGTCCTCACAAGGCAGG + Intronic
1119542931 14:75452481-75452503 TGGGCTTGTCCTCAGAAGCCTGG - Intronic
1120135660 14:80865723-80865745 TCTGCTTGTTCTAATAAAGCAGG + Intronic
1124579325 15:30938817-30938839 TCTGCTTGCCCTCTAAAGCCAGG - Intronic
1125616047 15:41014351-41014373 TTTCCTTGTCCTCAAGAGGCAGG - Intronic
1127454317 15:59143538-59143560 TCTGCTAGCCCTCACAAGAAGGG - Intronic
1128399158 15:67259559-67259581 TATCATTGTCCACACAAGGCAGG + Intronic
1132352784 15:101150251-101150273 TCTGCCTGTCCTCAAGAGGCTGG + Intergenic
1133262182 16:4558095-4558117 TTTGCTGCTCCTCACAGGGCTGG - Intronic
1133621536 16:7531379-7531401 TCTGATTGTCCACAGAAAGCTGG - Intronic
1133662014 16:7927538-7927560 TCTGCTTTTCCTCACCACCCAGG + Intergenic
1133858662 16:9573715-9573737 TCAACGTGTCCTCACAAGGCTGG - Intergenic
1134297202 16:12957467-12957489 TCTCTGTGTCCTCACATGGCAGG + Intronic
1137430206 16:48412415-48412437 TCATCGTGTCCTCACAAGGTGGG - Intronic
1139152980 16:64406864-64406886 TTTTCATGTCCTCAAAAGGCTGG + Intergenic
1140489172 16:75319702-75319724 TCCACTTCTCCTCACAAAGCTGG + Intronic
1140535371 16:75704839-75704861 TCTCCTTGTTCTCACCTGGCTGG + Intronic
1141822628 16:86457554-86457576 TCTGCGTTTCCTCCCAAGCCCGG + Intergenic
1141956697 16:87376777-87376799 TCTGCTCCTCCTCACAAGGCTGG + Intronic
1142460400 17:87518-87540 TTTCCTTGTCCTGATAAGGCTGG - Intergenic
1144009839 17:11136495-11136517 TCTATGTGTCCTCACATGGCAGG + Intergenic
1144752574 17:17659626-17659648 TCGCTTTGTCCTCACAAGGTGGG - Intergenic
1144812540 17:18009884-18009906 TCTGCTTTTCCTCTCAAAGCTGG - Intronic
1148348440 17:46920551-46920573 TCTACTATTCCTCCCAAGGCAGG - Intergenic
1148498083 17:48066672-48066694 TCTGCTTGCCCCCACAAAGGAGG + Intergenic
1148686116 17:49502158-49502180 TCTGGTTGGCTCCACAAGGCTGG - Exonic
1152476647 17:80522815-80522837 TCTGCTTTTCCCTCCAAGGCTGG - Intergenic
1158395582 18:57076565-57076587 TCTCCTTGTCCTCAGAGGCCCGG - Intergenic
1158447525 18:57534044-57534066 TCTGATTGTCCTCAAAGGACAGG - Intergenic
1158690412 18:59655129-59655151 ATTGCTTGTAGTCACAAGGCTGG - Intronic
1159931728 18:74319185-74319207 TCTGCTTGTCCTCAAATTGAAGG + Intronic
1160670375 19:359731-359753 TCTCAGTGTCCTCACATGGCAGG + Intergenic
1161682014 19:5684838-5684860 GGTGCTTCTCCTCACAGGGCTGG + Exonic
1162337186 19:10069170-10069192 TCTGCATGTCCTCATATGACAGG + Intergenic
1166769064 19:45269639-45269661 TCTGTTTGTAGTCAGAAGGCTGG + Intronic
1168663636 19:58185909-58185931 TCTGCTTGGGCTCACACTGCAGG + Intronic
925183571 2:1832225-1832247 TCACTGTGTCCTCACAAGGCAGG - Intronic
925189865 2:1874319-1874341 TTAGCTTGTCTTCACAAAGCAGG - Intronic
926746544 2:16163207-16163229 TCTGCTTTTCTTCCCAATGCTGG + Intergenic
927505981 2:23615181-23615203 TCGGCTTATCCTCACAAGCCCGG + Intronic
928647020 2:33365403-33365425 TCTGCTTGCCCACAAGAGGCCGG - Exonic
929757830 2:44782410-44782432 TCAGCTTGTCCTCTGAAGCCAGG - Intergenic
930354038 2:50294700-50294722 TCAGCCTGTCCCAACAAGGCAGG - Intronic
934068737 2:88364351-88364373 TCTGTTTGTAATCACAGGGCAGG - Intergenic
934188356 2:89764867-89764889 TCTGCTTCTCGTCACCCGGCAGG + Intergenic
940834948 2:158510830-158510852 TCTGCTTGTCCCCAAATGGGGGG - Intronic
941427296 2:165364461-165364483 TCTGCCTGTACTAACAGGGCAGG + Intronic
942087359 2:172455970-172455992 TCTGCTTTTCTTCACCAGGTGGG + Intronic
942567579 2:177281912-177281934 TCTGCTTGTCTGGACAAGTCAGG - Intronic
946159589 2:217828090-217828112 ACTGCTGGTCCTGGCAAGGCAGG - Intronic
946181620 2:217952529-217952551 TGTCCATGTCCTCACCAGGCTGG - Intronic
946825861 2:223677268-223677290 TCTGCTTGTCCCCAGTAGGCCGG + Intergenic
947705999 2:232276131-232276153 TCTGCTTGTCAGCATGAGGCTGG + Intronic
949066064 2:241990967-241990989 TCCGTGTGTCCTCACATGGCAGG + Intergenic
1173629448 20:44500307-44500329 TCCACTTGTCCTCACCAGTCGGG - Exonic
1174340539 20:49892463-49892485 TCAGCTTCTCCTCACGATGCTGG + Intergenic
1175970517 20:62684548-62684570 ACTGCTTGTCAGCACAGGGCCGG + Intronic
1177893350 21:26833379-26833401 GCTGCTTGTACTCACAAGTGGGG + Intergenic
1178734493 21:35136733-35136755 TTTGCCTGTGCTCACCAGGCTGG - Intronic
1181082048 22:20422674-20422696 TCTGCTTGTAACCACCAGGCTGG + Intergenic
1181867836 22:25873407-25873429 TCTGCCCCTCCTTACAAGGCTGG + Intronic
1185094016 22:48796156-48796178 TCAGCTTCTGCTCACAAAGCAGG - Intronic
952548569 3:34450039-34450061 TCTGTTTCTCCTCACTTGGCAGG - Intergenic
953331554 3:42057693-42057715 TCTGCTTGGCCACACACAGCAGG - Intronic
953770658 3:45776744-45776766 TCTGCTTGTTCTCACTTGGGTGG - Intronic
954294134 3:49664846-49664868 GCTGCTTGTACTCACCATGCTGG - Exonic
954296480 3:49677162-49677184 TCTGCCTGTCCTCTCAAGGAGGG + Intronic
957541889 3:81582067-81582089 TCTGTTTGTCCTATAAAGGCTGG + Intronic
958838298 3:99172057-99172079 ACTGCTTTTCCTCACTGGGCAGG + Intergenic
960341996 3:116486020-116486042 CCTGCTTCTCCTCACTAGGTAGG + Intronic
960959378 3:123058499-123058521 TCTGCCTGTCCTCTCCAGCCTGG - Intergenic
962084199 3:132173525-132173547 TCTGCTGCTCCTCACCAGGCAGG + Intronic
964652799 3:159030051-159030073 TCTGCTTGACCTCTCAATGCTGG - Intronic
966535886 3:181033198-181033220 TGTGCTTGTTCTTACTAGGCAGG + Intergenic
969442617 4:7226366-7226388 TCTGCGTGTCCTTCCAGGGCAGG + Intronic
969557802 4:7925127-7925149 TCTGCCTGTCCTCATAGGGTCGG + Intronic
970372813 4:15425116-15425138 TCTGCTTGTCCTTACAAACCGGG - Intronic
970975029 4:22033786-22033808 TCTGCAAGTCCTCCCAAGCCAGG + Intergenic
971354666 4:25884591-25884613 TCTGCTTGTGCTCACACCACTGG + Intronic
971932976 4:33108860-33108882 TCTGCTTGTCCTCTGGATGCAGG + Intergenic
978683801 4:111415188-111415210 TCCACTCCTCCTCACAAGGCAGG - Intergenic
982601747 4:157459966-157459988 TCTGCTAATCCTGACAGGGCAGG - Intergenic
983433339 4:167679328-167679350 TCTGTCTGTACCCACAAGGCTGG - Intergenic
985026225 4:185741976-185741998 GCTGCTGGTCCTGCCAAGGCTGG + Intronic
985584806 5:725174-725196 TCTGCTTGTCCTCACAAGGCAGG - Intronic
985584827 5:725270-725292 TCTGGTTGTCCTCACACAGCAGG - Intronic
985598309 5:809488-809510 TCTGCTTGTCCTCACAAGGCAGG - Intronic
985598331 5:809584-809606 TCTGGTTGTCCTCACACAGCAGG - Intronic
986052005 5:4098850-4098872 TTTGCCTGTCCTCACAGTGCCGG - Intergenic
987324543 5:16800685-16800707 TCTGCTTGGCCTCACTACACTGG + Intronic
992097020 5:73372354-73372376 TCTGCTTGTCCTCAGCTGGGTGG + Intergenic
992616858 5:78553409-78553431 TCTGCTTGTCCTCTCATGGCTGG + Intronic
993246567 5:85459606-85459628 TCTGCTACTCCTCACTGGGCAGG - Intergenic
993413848 5:87601834-87601856 GCTGCTCCTCCTCACAAGGCGGG + Intergenic
996513786 5:124347309-124347331 CCTGCTTGTCCAGACAAGGTAGG - Intergenic
996551331 5:124733530-124733552 TGTGCTTTTCCTCCCAAGGTAGG + Intronic
996678948 5:126209063-126209085 TCTCTGTGTTCTCACAAGGCGGG + Intergenic
997043038 5:130279937-130279959 TAAGCTTGTCCTGACAAGGGTGG - Intergenic
999323880 5:150631215-150631237 TCTGCCTGTCCCCGCAGGGCAGG - Intronic
1002186661 5:177457881-177457903 TCTGCTTTTGTTCCCAAGGCAGG - Intronic
1002494998 5:179605757-179605779 TCTGGGTCTCCTCACAAGTCCGG + Intronic
1002726952 5:181305340-181305362 TTTCCTTGTCCTGATAAGGCTGG + Intergenic
1003537166 6:6985459-6985481 TCTGCTTGCCCTCACCATACTGG - Intergenic
1006129600 6:31861315-31861337 TCCCTTTGTGCTCACAAGGCCGG - Exonic
1006730838 6:36235065-36235087 TGTGCTTAGCATCACAAGGCAGG + Intergenic
1007277059 6:40682224-40682246 TCTACCTGTCCTCACATGGTTGG + Intergenic
1009946581 6:70347696-70347718 CCTGCTTCTCCTCACTGGGCAGG - Intergenic
1010049057 6:71482052-71482074 TCTCCCTGTCTTCACATGGCTGG + Intergenic
1010238242 6:73592623-73592645 GCTGCTTTTTCTCCCAAGGCAGG - Intergenic
1014094832 6:117448319-117448341 TCTGGTTGGCCTTCCAAGGCAGG - Intronic
1018632793 6:165835145-165835167 ACTGCAGGTCATCACAAGGCTGG + Intronic
1018870662 6:167779888-167779910 TCTCCACGTCCTCACATGGCAGG + Intergenic
1019029716 6:168999914-168999936 TCTGCTTATCCTCCCAAGCCAGG - Intergenic
1024210472 7:47199005-47199027 TCTCTGTGTCCTCACATGGCAGG + Intergenic
1026522240 7:71127554-71127576 TTTGCTTGTCCTCACTTGGGTGG + Intergenic
1031170476 7:118286482-118286504 TCTGCTTGTCCTCACTAGGCTGG + Intergenic
1033682833 7:143612835-143612857 GCTGCTTGTCCCCTGAAGGCTGG + Intergenic
1033701778 7:143844807-143844829 GCTGCTTGTCCCCTGAAGGCTGG - Intergenic
1035205545 7:157291854-157291876 TCTGCTTGTCCTGCCACGGCGGG - Intergenic
1035527013 8:321820-321842 TGTGCTTGTCCTCAGAGGGTGGG - Intergenic
1036202934 8:6784449-6784471 CCTGCTTAACCCCACAAGGCTGG + Intergenic
1038501065 8:28044314-28044336 TCTGCTTGTCCTCATTTGGTTGG - Intronic
1038805550 8:30787814-30787836 TCAGCTTGGCCTCCCAAAGCTGG + Intronic
1039887321 8:41662362-41662384 TCTTCTTGGCCTCTCAAGGAGGG - Intronic
1042018435 8:64343199-64343221 CCTGCTTCTGCTCACAAAGCAGG + Intergenic
1042406529 8:68412024-68412046 TCTATGTGTCCTCACATGGCAGG - Intronic
1042426710 8:68657402-68657424 TCTGTATGTCCTCACATGGAAGG - Intronic
1042776700 8:72440158-72440180 TCAGCTTGTACTCACCAGGTAGG + Intergenic
1047336805 8:123943772-123943794 TCTGCTTGTCCTTAGAAACCTGG + Intronic
1048764642 8:137830854-137830876 TCTGTGTGTCCTCACATGGCAGG + Intergenic
1049697812 8:143992162-143992184 TCTCCTTGTGCTCATGAGGCAGG + Intronic
1050361740 9:4836965-4836987 TCTCCTGGTACACACAAGGCTGG - Intronic
1050746429 9:8881697-8881719 TCTGTTTGTCCTTAAAATGCAGG - Intronic
1052707731 9:32013633-32013655 TTTCCTTGGCCTCACAAGTCTGG + Intergenic
1053261150 9:36666057-36666079 ACTGCCTGTCCTCAGCAGGCAGG + Intronic
1055218616 9:73899196-73899218 TATGCTTTTCCTCACTAGACTGG - Intergenic
1056128888 9:83564776-83564798 TCTGCTTCTCTTGCCAAGGCAGG + Intergenic
1056244301 9:84679042-84679064 TATGTGTGTCCTCACATGGCAGG - Intronic
1058458130 9:105157412-105157434 TCTGCTTCTGCTCACAACTCTGG + Intergenic
1185652910 X:1661648-1661670 TCTGCTTGACATCACCTGGCTGG - Intergenic
1186532985 X:10316182-10316204 TCTGCTTGTCTTCCCCAGCCAGG - Intergenic
1186647821 X:11525909-11525931 CCTGCTTATCCTCAAAAGGCTGG + Intronic
1188184828 X:27100802-27100824 TCTGCTTAGTCTCCCAAGGCTGG - Intergenic
1190116332 X:47628111-47628133 ACTGCTGGTCCTCACAGGCCTGG + Exonic
1192760223 X:74088622-74088644 CCTGCTTCTCCTCACTGGGCAGG + Intergenic
1192760273 X:74088893-74088915 CCTGCTTCTCCTTACTAGGCAGG + Intergenic
1194467420 X:94251037-94251059 TCTGCTTCTCCTCCCAAAGTAGG + Intergenic
1194629344 X:96264510-96264532 TCACCATGTCTTCACAAGGCAGG + Intergenic
1196684842 X:118502152-118502174 ACCGCTTGTCCACTCAAGGCAGG + Intronic
1199182832 X:144878699-144878721 TCTGCTTCTCCTCACTATGCAGG + Intergenic
1200124634 X:153807473-153807495 TCTGCTTGTGCTCTCAAGGGTGG + Intronic