ID: 985587980

View in Genome Browser
Species Human (GRCh38)
Location 5:750787-750809
Sequence CTGTGGGGCCATGTAGCTGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 201
Summary {0: 1, 1: 1, 2: 1, 3: 10, 4: 188}

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985587980_985587994 20 Left 985587980 5:750787-750809 CCCACAGCTACATGGCCCCACAG 0: 1
1: 1
2: 1
3: 10
4: 188
Right 985587994 5:750830-750852 AGGGCTGACTGCGGAGGGCAGGG 0: 1
1: 2
2: 4
3: 44
4: 303
985587980_985587995 21 Left 985587980 5:750787-750809 CCCACAGCTACATGGCCCCACAG 0: 1
1: 1
2: 1
3: 10
4: 188
Right 985587995 5:750831-750853 GGGCTGACTGCGGAGGGCAGGGG No data
985587980_985587984 -9 Left 985587980 5:750787-750809 CCCACAGCTACATGGCCCCACAG 0: 1
1: 1
2: 1
3: 10
4: 188
Right 985587984 5:750801-750823 GCCCCACAGGATGGTGTGACAGG 0: 2
1: 0
2: 0
3: 18
4: 162
985587980_985587991 14 Left 985587980 5:750787-750809 CCCACAGCTACATGGCCCCACAG 0: 1
1: 1
2: 1
3: 10
4: 188
Right 985587991 5:750824-750846 TGCTACAGGGCTGACTGCGGAGG 0: 1
1: 2
2: 0
3: 17
4: 168
985587980_985587992 15 Left 985587980 5:750787-750809 CCCACAGCTACATGGCCCCACAG 0: 1
1: 1
2: 1
3: 10
4: 188
Right 985587992 5:750825-750847 GCTACAGGGCTGACTGCGGAGGG 0: 1
1: 1
2: 0
3: 20
4: 162
985587980_985587990 11 Left 985587980 5:750787-750809 CCCACAGCTACATGGCCCCACAG 0: 1
1: 1
2: 1
3: 10
4: 188
Right 985587990 5:750821-750843 AGGTGCTACAGGGCTGACTGCGG 0: 1
1: 1
2: 7
3: 40
4: 256
985587980_985587997 30 Left 985587980 5:750787-750809 CCCACAGCTACATGGCCCCACAG 0: 1
1: 1
2: 1
3: 10
4: 188
Right 985587997 5:750840-750862 GCGGAGGGCAGGGGCAGAGGTGG No data
985587980_985587996 27 Left 985587980 5:750787-750809 CCCACAGCTACATGGCCCCACAG 0: 1
1: 1
2: 1
3: 10
4: 188
Right 985587996 5:750837-750859 ACTGCGGAGGGCAGGGGCAGAGG 0: 2
1: 0
2: 4
3: 79
4: 869
985587980_985587993 19 Left 985587980 5:750787-750809 CCCACAGCTACATGGCCCCACAG 0: 1
1: 1
2: 1
3: 10
4: 188
Right 985587993 5:750829-750851 CAGGGCTGACTGCGGAGGGCAGG No data
985587980_985587988 0 Left 985587980 5:750787-750809 CCCACAGCTACATGGCCCCACAG 0: 1
1: 1
2: 1
3: 10
4: 188
Right 985587988 5:750810-750832 GATGGTGTGACAGGTGCTACAGG 0: 2
1: 0
2: 3
3: 17
4: 169
985587980_985587989 1 Left 985587980 5:750787-750809 CCCACAGCTACATGGCCCCACAG 0: 1
1: 1
2: 1
3: 10
4: 188
Right 985587989 5:750811-750833 ATGGTGTGACAGGTGCTACAGGG 0: 2
1: 0
2: 1
3: 10
4: 142

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985587980 Original CRISPR CTGTGGGGCCATGTAGCTGT GGG (reversed) Intronic
900599997 1:3498858-3498880 CTGTGGGGCCAGCTGGCTGGGGG - Intronic
901961325 1:12828618-12828640 CTGTGAGGCCCTGAAGCTGATGG - Exonic
901967916 1:12883223-12883245 CTGTGAGGCCCTGAAGCTGATGG - Exonic
901975721 1:12942353-12942375 CTGTGAGGCCCTGAAGCTGATGG - Exonic
901983315 1:13053488-13053510 CTGTGAGGCCCTGAAGCTGATGG - Intronic
901985695 1:13073843-13073865 CTGTGAGGCCCTGAAGCTGATGG + Exonic
901996114 1:13152924-13152946 CTGTGAGGCCCTGAAGCTGATGG - Intergenic
901998773 1:13175430-13175452 CTGTGAGGCCCTGAAGCTGATGG + Intergenic
902007774 1:13246006-13246028 CTGTGAGGCCCTGAAGCTGATGG + Intergenic
902009453 1:13259412-13259434 CTGTGAGGCCCTGAAGCTGATGG + Exonic
902017259 1:13318557-13318579 CTGTGAGGCCCTGAAGCTGATGG + Exonic
902030171 1:13416498-13416520 CTGTGAGGCCCTGAAGCTGATGG + Exonic
902703555 1:18189573-18189595 CAGTGGGGCCATCTAGTTGCAGG - Intronic
904369639 1:30040291-30040313 CTGTGGGGCCAGGTAGGAGGAGG + Intergenic
904824680 1:33266568-33266590 CTGTGGGGCTATGTTGGGGTAGG + Intronic
906290848 1:44618368-44618390 CTGTGCACCCATGTACCTGTGGG - Intronic
906295583 1:44647093-44647115 CAGTGGGGCCTTGTAGCTCTTGG + Intronic
908395086 1:63718073-63718095 CTGTGAGGCCAGGTCACTGTAGG + Intergenic
909442440 1:75712921-75712943 CTGAGAGGCCATGTTGCTGGAGG - Intergenic
913347765 1:117825408-117825430 CTCTGGGGCCAGGTAGCTCAAGG + Intergenic
915364184 1:155304960-155304982 CTGTGGGGCCAGGAGGCTGACGG + Intergenic
915446265 1:155976589-155976611 CTGTGGGGGCAGGTAGCTACTGG - Intronic
917015965 1:170531810-170531832 CTTTGGGGTCCTGTACCTGTGGG - Intergenic
917631513 1:176895426-176895448 CTGTGGGACCTTGAAGCTCTTGG - Intronic
920245278 1:204583104-204583126 CTGTGGGCACCTGGAGCTGTTGG + Intergenic
920939814 1:210471176-210471198 ATGTGGTGACATGTGGCTGTAGG + Intronic
922755894 1:228096824-228096846 CTTTCTGGCCATGCAGCTGTGGG + Intronic
1063358601 10:5428126-5428148 CTGTGGGGCCAGGAAGTTGACGG + Intronic
1064316190 10:14259854-14259876 AGCTGGAGCCATGTAGCTGTGGG - Intronic
1065171615 10:23035814-23035836 ATGTGGGGCCCAGTAGCTGAAGG - Intronic
1065814621 10:29472827-29472849 CTGGGGGATCATGTAGCTTTAGG + Intronic
1075397859 10:122140963-122140985 CTGTGGGGCCTTGGATCTGAGGG + Intronic
1077156123 11:1092497-1092519 CTGTGGGGCCTTGGATCGGTGGG + Intergenic
1077822999 11:5769514-5769536 ATGTGTGGCCATGTATATGTGGG - Intronic
1083332474 11:61905377-61905399 CTTTGGAGCCATTTACCTGTCGG + Intronic
1086925888 11:92640245-92640267 CTTTTGGGCCAAGCAGCTGTGGG + Intronic
1088111828 11:106270534-106270556 GTGTGGGCCCATGTAGCTTACGG + Intergenic
1088830605 11:113533158-113533180 CTGTGGGGCCACGTGGGGGTGGG - Intergenic
1089057354 11:115596847-115596869 CTGTGGGGGAGTTTAGCTGTTGG - Intergenic
1089492754 11:118894051-118894073 CTGTGGGACCATCTGGCTGGTGG + Exonic
1089843751 11:121441774-121441796 CTGTAGCTCCATGCAGCTGTCGG - Intergenic
1091713489 12:2759802-2759824 CTGTGGAGAGATGTATCTGTGGG - Intergenic
1093089123 12:14901923-14901945 CAGTGGGGCTGGGTAGCTGTAGG + Intronic
1094599452 12:31895752-31895774 CTGTAGGGCCATTTATTTGTTGG - Intergenic
1096707208 12:53429838-53429860 CTCTGGTGCCATGTACCTCTGGG - Exonic
1097172311 12:57123461-57123483 CTGTGGTGGCATGCATCTGTAGG - Intronic
1097290384 12:57909405-57909427 CTGTGGTGCCAAGGAGGTGTTGG + Intergenic
1105541408 13:21320198-21320220 CTCTGGAGCCATGTAGCTCACGG - Intergenic
1106083581 13:26520885-26520907 CTGTGGGCTCATGTAGTGGTGGG + Intergenic
1108516971 13:51212690-51212712 ATGTGGGGTCAGTTAGCTGTGGG - Intergenic
1111789716 13:92838623-92838645 CTGTGGGTCCATTTAGATCTTGG - Intronic
1113373698 13:109744841-109744863 CCGTGGCGCCATGCAGCAGTGGG + Intergenic
1113586501 13:111469612-111469634 CTGACTGGCCATGCAGCTGTGGG - Intergenic
1114051317 14:18921283-18921305 CTGTGGGGCCAGGGCACTGTAGG + Intergenic
1114111245 14:19480642-19480664 CTGTGGGGCCAGGGCACTGTAGG - Intergenic
1114446766 14:22794564-22794586 GTGTGGGGCCCTGAAGTTGTGGG - Intronic
1114773414 14:25454541-25454563 CTTTGGGGCAATGTAGTTTTTGG + Intergenic
1118896250 14:69948151-69948173 CTTTGGGGCCCTGGAGCTTTGGG + Intronic
1119879673 14:78090441-78090463 CTGCAGGGCCCTGCAGCTGTGGG - Intergenic
1121327186 14:93028015-93028037 CTGTGGGTCCATGCACCTGCTGG + Intronic
1122282090 14:100629473-100629495 CTGTGGGACCGTGGGGCTGTGGG - Intergenic
1122371950 14:101233905-101233927 CTGTGGGGCCATGGGGCTGTGGG - Intergenic
1122829959 14:104391051-104391073 CTGGGGCTCCATGTAGCTCTCGG + Intergenic
1125514638 15:40311184-40311206 CTGTGGTGGCATGAAGCTGGTGG - Intergenic
1125679625 15:41522754-41522776 CTGTGTGGCCAGGTAAGTGTGGG - Exonic
1127570293 15:60234976-60234998 CTGGAGGGCCATGTAGCTTATGG - Intergenic
1128130927 15:65226531-65226553 TTGTGGGGTCATGTAGGGGTGGG + Intergenic
1128566850 15:68706359-68706381 CTGTGGGGGCACAGAGCTGTTGG - Intronic
1128636803 15:69307779-69307801 CTGGGGGACCCTGTGGCTGTCGG + Intronic
1128723747 15:69972597-69972619 CTCTGGGGCCATGTGGGTGTGGG + Intergenic
1128914012 15:71543429-71543451 ATGTGGGGCCATAGACCTGTTGG + Intronic
1129066087 15:72905136-72905158 CTGTGGGACCAGGTTCCTGTTGG + Intergenic
1130059657 15:80560293-80560315 CTTTGGGGCCAGGTAGATCTAGG + Intronic
1130159709 15:81386430-81386452 TTGTTGGGCTATGTAGCTCTGGG - Intergenic
1130426455 15:83805987-83806009 CTGTGAAGCAATGCAGCTGTGGG - Intronic
1130515495 15:84622962-84622984 TTATGGGGCTATGTACCTGTTGG - Exonic
1133221763 16:4321964-4321986 CTGTGGGTCCAGGTACCTGAGGG - Intronic
1134690271 16:16186639-16186661 CTTTGGGGCCATCTAGTTGACGG + Intronic
1138641269 16:58389327-58389349 CTGATGGGCCATTTAGCTGATGG + Intronic
1140430290 16:74897234-74897256 CTATGAAGCCATGTAGCTGCAGG - Intronic
1141639280 16:85332213-85332235 CTTTGGGGTCCTGTAGCCGTCGG + Intergenic
1142889966 17:2936819-2936841 CTGTGCGCCCAGGCAGCTGTGGG + Intronic
1143841120 17:9732447-9732469 CTGTGGGCCCTTGGAGCTTTTGG - Intergenic
1144033134 17:11340330-11340352 CTGTGGTTGCATTTAGCTGTGGG + Intronic
1146297604 17:31661897-31661919 CTGTGGGGCCAGGCAGCTCATGG + Intergenic
1148105648 17:45117382-45117404 GTGTGGGGGCATGTGCCTGTAGG - Intronic
1148339121 17:46863013-46863035 CTGTGGGGCCCTGTACCTTGGGG - Intronic
1152205538 17:78972613-78972635 CTATGGGGCCAGGCAGCTGCAGG - Exonic
1152376832 17:79922892-79922914 CCGTGGTGCACTGTAGCTGTTGG - Intergenic
1152503186 17:80726685-80726707 CTGTAGGGTCAGGTGGCTGTAGG + Intronic
1152575845 17:81140683-81140705 CCGTGGGGCCGTTGAGCTGTGGG + Intronic
1153739913 18:8113405-8113427 CTGTGGGTCCATGCAGTTGAAGG + Intronic
1155299578 18:24417221-24417243 CTATGGGGCCATCTAGTTGCAGG - Intergenic
1156338563 18:36190103-36190125 CTGGAGGGCCAAGTAGCTATTGG - Intronic
1161569264 19:5021454-5021476 GTGTGGTGGCATGTACCTGTGGG + Intronic
1161614994 19:5265150-5265172 CTGTGGGCCCATGTCGATGTTGG + Exonic
1163103865 19:15112398-15112420 CTGTGGGGTCATGCGGTTGTAGG - Exonic
1164905755 19:31966645-31966667 GAGTGGGGCCATGTACCTGCCGG - Intergenic
1165161508 19:33819677-33819699 CTGTGGGGCCTGGGCGCTGTCGG - Intergenic
1165708310 19:37991838-37991860 CTGTGGAGCCTTGCAGCTGATGG + Intronic
1166117106 19:40662964-40662986 CTGTGGGGCCACGTGGTTGCCGG - Intergenic
1166230660 19:41424415-41424437 CTGTGGGGACATGGGGCAGTGGG - Intronic
1166230860 19:41425315-41425337 CTGTGGGGCCCTGGAGTGGTGGG - Intronic
1166381357 19:42356882-42356904 CCGTGGTGCCATGTATCTGCTGG + Exonic
1167398957 19:49252253-49252275 CTGAAGGGCCATGAAGCTGATGG + Intergenic
925697734 2:6598917-6598939 CTGTGGTGCCATGTGGAAGTAGG + Intergenic
932422738 2:71611288-71611310 CTGAGGAACCATGTAGATGTTGG - Exonic
937358530 2:121213205-121213227 CTGTGGGCCCATGCTGCTCTGGG + Intergenic
939548284 2:143581376-143581398 CTGTGGGGCTATGGGGCTGTGGG - Intronic
1169075924 20:2759780-2759802 CTGCGGGGCCAAGCAGCTGTTGG - Exonic
1169234257 20:3916871-3916893 CTGTTGGGCTTTGTTGCTGTTGG + Intronic
1172446387 20:34995626-34995648 CTTTGGGGCCAGGTGGCTGCAGG + Intronic
1173765871 20:45608998-45609020 CTGTAGGGACATGTAGATGGAGG - Intronic
1175529776 20:59666463-59666485 CTGTGGGCACATTGAGCTGTGGG + Intronic
1176242466 20:64081423-64081445 CTGTGGGAAAATGCAGCTGTGGG + Intronic
1176301517 21:5101218-5101240 CTCTCGGGACAGGTAGCTGTGGG - Intergenic
1177536962 21:22440565-22440587 GTGTGGTGCCATGTACCTATAGG + Intergenic
1178920537 21:36735597-36735619 CTGTGGGGCCAAGCAGCAGTGGG - Intronic
1178981840 21:37270862-37270884 CTGTGAGGCCAAGTATCTGAAGG + Intergenic
1179855514 21:44160681-44160703 CTCTCGGGACAGGTAGCTGTGGG + Intergenic
1179966934 21:44812765-44812787 GTGTGGGGCCGTGTACATGTGGG - Intronic
1180469790 22:15643658-15643680 CTGTGGGGCCAGGGCACTGTAGG + Intergenic
1182972650 22:34592292-34592314 CAGTGGGGAAATGGAGCTGTGGG + Intergenic
1185282013 22:49976170-49976192 CTGTGGGGCCATGGGGCTGCTGG + Intergenic
950549388 3:13656943-13656965 CTGTCTGGCCATGTGGCTTTGGG - Intergenic
950549541 3:13657905-13657927 CTTTGGGGCCGTGGAGCTTTGGG - Intergenic
952822566 3:37498035-37498057 CTGGGTGGCCAGGGAGCTGTGGG + Intronic
953405868 3:42659473-42659495 CCGTGTGGCCATGTGACTGTGGG - Exonic
954898733 3:54000415-54000437 CTTCAGGGTCATGTAGCTGTAGG - Intergenic
956718463 3:72098534-72098556 CTGTGGGGCCTGGGAGCTGATGG + Intergenic
959481792 3:106882215-106882237 CTGTGAAGCCATCTAGCTGTAGG - Intergenic
961260147 3:125595522-125595544 CTGTGGGGCTGTGGGGCTGTGGG - Intergenic
961260150 3:125595530-125595552 CTGTGGGGCTGTGGGGCTGTGGG - Intergenic
962578598 3:136777008-136777030 GTGTGGTGGCATGTACCTGTAGG + Intergenic
967217612 3:187223734-187223756 CTGTGGGGCAATGTGGAAGTGGG + Intronic
967517794 3:190390922-190390944 TTGTGGGGACATGCACCTGTAGG - Intronic
968426434 4:526499-526521 CTGTGAGGCCATGTGGGTCTAGG + Intronic
969568250 4:7992781-7992803 CTGTGTGGTCAAGAAGCTGTGGG + Intronic
970543528 4:17103520-17103542 CTGTGGAGCCAAGTAGGGGTGGG + Intergenic
972879875 4:43410162-43410184 GTCGGGGGCCAGGTAGCTGTAGG + Intergenic
973545569 4:51978199-51978221 CTGTGGGGACCTGGTGCTGTGGG - Intergenic
975632827 4:76419857-76419879 ATTTGGGGCCATCTAGCTGGGGG + Intronic
976335886 4:83885742-83885764 TTGAGGAGCCATGTATCTGTGGG + Intergenic
976842079 4:89443729-89443751 TTGTGGATCCATGTAGTTGTAGG - Intergenic
978735133 4:112076753-112076775 CAGTGGGACCATGGAACTGTGGG - Intergenic
978962372 4:114698107-114698129 CAGTGGAGCAATGTTGCTGTTGG + Intergenic
985587980 5:750787-750809 CTGTGGGGCCATGTAGCTGTGGG - Intronic
985602649 5:843254-843276 CTGTGGGGCCATGTAGTTGTGGG - Intronic
985766440 5:1782085-1782107 CACTGGGGCCATTTAGCTGAGGG + Intergenic
987015912 5:13819409-13819431 CTGTGGGACCCTGCAGGTGTTGG - Intronic
990861315 5:60330850-60330872 CCCTGTGGCCATGTAGCTTTTGG - Intronic
997932415 5:138083506-138083528 CTGTGAGGTGATGGAGCTGTGGG - Intergenic
999254727 5:150203996-150204018 CTGCGTGGCCATGTACCTGATGG + Exonic
1000636725 5:163652416-163652438 CTGTTGGGCAATGTAGCTAAAGG + Intergenic
1001303592 5:170555524-170555546 CCGTGGGGCCAGCTAGCTCTTGG - Intronic
1001528606 5:172446414-172446436 CTGTGGGTCCCTGCAGCTGCAGG - Intronic
1002535617 5:179873966-179873988 CTGTGGGCCTAAGTAGCTTTTGG - Intronic
1002656603 5:180753590-180753612 CTATGGGGCCAAGCAGCTGTGGG + Intergenic
1003894084 6:10590519-10590541 GTGTGGGGCCAAGTAGTTGCTGG - Intronic
1006170305 6:32088220-32088242 GGGTGGGGCCCTGTAGCTGAAGG + Intronic
1006405967 6:33845002-33845024 CTGAGGGGTCATGTACCTGGGGG + Intergenic
1012528842 6:100210462-100210484 CTCTAGGGCCATGTGGCTTTCGG - Intergenic
1015726617 6:136306018-136306040 CTGTGGTTCCATGCAGATGTTGG - Intergenic
1015764829 6:136705439-136705461 TTGTGGTGGCATGTACCTGTAGG - Intronic
1016536467 6:145112193-145112215 CTGTTGGGAGATCTAGCTGTTGG - Intergenic
1018195082 6:161348403-161348425 CCGTGGGGCCATGTTGGAGTCGG + Exonic
1018364156 6:163100584-163100606 CTGTGGGCCCAGGCAGGTGTGGG - Intronic
1022687298 7:32608830-32608852 CTGTGTGGCCAGGACGCTGTAGG + Intergenic
1023822480 7:43987863-43987885 CCGTGGGGCCGTGAAGCTCTGGG + Intergenic
1026137247 7:67674303-67674325 CTGTGAGGCCATGGGGCTTTGGG + Intergenic
1029503691 7:100949615-100949637 CGCTGGGCCCATGCAGCTGTTGG + Exonic
1029750743 7:102541278-102541300 CCGTGGGGCCGTGAAGCTCTGGG + Intronic
1029768698 7:102640389-102640411 CCGTGGGGCCGTGAAGCTCTGGG + Exonic
1031906761 7:127468638-127468660 CAGTGTGGCTAAGTAGCTGTGGG - Intergenic
1034993300 7:155561568-155561590 CTGGGGGGCCCAGCAGCTGTGGG + Intergenic
1036094150 8:5704738-5704760 TTGTGGAGCCTTGTATCTGTGGG - Intergenic
1036614801 8:10379819-10379841 CAGTGGGTCCATGTTGCTTTGGG + Intronic
1039041757 8:33415121-33415143 CTGTGGTGGCATGTGCCTGTAGG + Intronic
1041574475 8:59378363-59378385 CTGATGAGCCATGTAGCTTTGGG - Intergenic
1042711110 8:71718634-71718656 CTGTGGTGGCATGTGCCTGTAGG + Intergenic
1047533547 8:125698665-125698687 CTTTGGGGACACGTAGCTGGGGG + Intergenic
1048260807 8:132943622-132943644 CTGTGGTGCCATGCACATGTTGG - Intronic
1048528914 8:135229633-135229655 CTCTGGGCCCATGTTGCTCTAGG - Intergenic
1049116559 8:140693632-140693654 CTGTGGGGCCATGTGACCTTGGG + Intronic
1049577037 8:143394250-143394272 CTGTGGGGCCAGGGGGCTGTGGG + Intergenic
1049671157 8:143870456-143870478 CTGTGCGGCCTGGGAGCTGTGGG - Exonic
1049783448 8:144439388-144439410 CTGAGTGGCCAGGCAGCTGTGGG - Intronic
1051417090 9:16853269-16853291 CCGTGGTGGCATGCAGCTGTAGG + Intronic
1052029332 9:23610596-23610618 AGGTGGGGGCATGTAGCTGCTGG - Intergenic
1052345928 9:27409279-27409301 CTCTGGGGCCAAGCAGCTTTGGG - Intronic
1055620865 9:78123709-78123731 CTCTGGGGAAATGTAGGTGTTGG - Intergenic
1060346924 9:122825298-122825320 GTGTGGGGGCATGCGGCTGTAGG - Intronic
1061683949 9:132259513-132259535 CTGTGGGCCCATTCACCTGTGGG - Intergenic
1062086934 9:134653856-134653878 CTGTAGGGCCAGGCATCTGTAGG + Intronic
1062596841 9:137303414-137303436 ATGTGGGGACATGGAGCTGGTGG - Intergenic
1187853986 X:23619029-23619051 CTCTGTGCCCATGTAGCTTTAGG - Intergenic
1192056943 X:67782858-67782880 ATTTGGGGCCATGTAGATATGGG - Intergenic
1192211788 X:69132507-69132529 CTGTTGTGCCCTGTGGCTGTTGG - Intergenic
1192329832 X:70166357-70166379 GAGTGGGGACATTTAGCTGTGGG + Intergenic
1195940904 X:110167337-110167359 CCTTGGGGCCATGTAGCCTTGGG - Intronic
1200309361 X:155061969-155061991 CTTTGATTCCATGTAGCTGTTGG + Exonic