ID: 985589646

View in Genome Browser
Species Human (GRCh38)
Location 5:757872-757894
Sequence GGGGGACTCACATGGGGGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 233
Summary {0: 1, 1: 0, 2: 3, 3: 23, 4: 206}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985589638_985589646 -10 Left 985589638 5:757859-757881 CCAGCCAGGCCCTGGGGGACTCA 0: 1
1: 0
2: 4
3: 49
4: 394
Right 985589646 5:757872-757894 GGGGGACTCACATGGGGGCCAGG 0: 1
1: 0
2: 3
3: 23
4: 206
985589629_985589646 28 Left 985589629 5:757821-757843 CCGGGGTGTGGTGGGAGCTAGGC 0: 1
1: 0
2: 1
3: 34
4: 219
Right 985589646 5:757872-757894 GGGGGACTCACATGGGGGCCAGG 0: 1
1: 0
2: 3
3: 23
4: 206

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985589646 Original CRISPR GGGGGACTCACATGGGGGCC AGG Intronic
900164862 1:1240595-1240617 TGGGGGCTGGCATGGGGGCCAGG - Intergenic
900169443 1:1259442-1259464 TGGGGACTCGCATTGGGGCAGGG - Intronic
900372211 1:2337081-2337103 GGTGGACTCAGAAGGGGGCGGGG - Intronic
900372462 1:2338043-2338065 GGGACCCTCACATGGGGCCCCGG + Intronic
900385046 1:2406689-2406711 GGGGGCCACACATGGGGGCTGGG - Intronic
900398412 1:2462694-2462716 GGTGGTTTCACATGGGGCCCTGG + Intronic
901323282 1:8351997-8352019 CGGGGAGGCAGATGGGGGCCAGG + Intergenic
902166898 1:14579785-14579807 GGGGGACTCACATGGCAGCCAGG + Intergenic
902169352 1:14598331-14598353 GGGGGCCTCAGAGGGGAGCCGGG - Intergenic
902571574 1:17350551-17350573 GGGGGACGCTCATGGATGCCAGG - Intronic
902733503 1:18384798-18384820 AGGGGACTCACTTGGGGGAGGGG + Intergenic
902754597 1:18540771-18540793 GGGGGACTCACACGCAGGCCTGG - Intergenic
902822453 1:18951533-18951555 GGGCGACTCTTTTGGGGGCCTGG - Intronic
903033201 1:20477713-20477735 GGGGGAGACAAATGGGGGCCTGG + Intergenic
903049719 1:20591546-20591568 AGGGGACTGCCATGGGGGCAGGG - Intronic
903189674 1:21649730-21649752 TGGGGACTCTCAGGAGGGCCTGG - Intronic
903577430 1:24347571-24347593 GGGGGTCTGCCATGGGGGGCGGG - Intronic
904115797 1:28160878-28160900 GTGGGAGTCACATGGGGGCCAGG - Intronic
905107726 1:35574139-35574161 AGGGGACCCATATGGCGGCCTGG + Exonic
905891487 1:41521235-41521257 GAGTGACTCACATGGGGACAGGG - Intronic
906059053 1:42936513-42936535 TGGGGCCTCACTTTGGGGCCTGG + Intronic
906703329 1:47875819-47875841 TGAGAACTCACCTGGGGGCCAGG - Intronic
908151882 1:61310866-61310888 GGTGGAGTCACATGTGTGCCAGG - Intronic
909031440 1:70545780-70545802 CGGGGTCTCACATGTTGGCCAGG + Intergenic
910842157 1:91571113-91571135 GGTGAACTCACTTGAGGGCCAGG - Intergenic
914676316 1:149909724-149909746 GGGGTACTCAGAGAGGGGCCAGG + Intronic
914984182 1:152442107-152442129 GGGGGCAGCACCTGGGGGCCAGG + Intergenic
916418384 1:164613511-164613533 GGGGGGCTCACAGGAGAGCCTGG - Intronic
920343947 1:205293999-205294021 CAGGGCCTCACATGGTGGCCGGG - Intergenic
921315085 1:213882737-213882759 GGGGGATTCACATGGGGGAGAGG + Intergenic
922774811 1:228209811-228209833 GGGGGTCTCACATGTTGCCCAGG + Intronic
922958714 1:229626345-229626367 GGGGGACTCACCTCGGGATCCGG - Exonic
922958730 1:229626393-229626415 GGGGGACTCACCTCGGGACCTGG - Intronic
923270543 1:232351826-232351848 GGGGGGTTCACGTGGGGGCATGG - Intergenic
924707438 1:246511400-246511422 GGGTGACTCAGGAGGGGGCCTGG + Intergenic
1065765972 10:29029648-29029670 GGTGCACTCACATGGTGGGCAGG + Intergenic
1066456902 10:35580509-35580531 GGGGATGTCACCTGGGGGCCAGG - Intergenic
1066694310 10:38064351-38064373 TGGGGACTCACCTGGGGCCCAGG + Intronic
1066998209 10:42582825-42582847 TGGGGACTCACCTGGGGCCCAGG - Intronic
1067431586 10:46249283-46249305 GGGGGCCCAGCATGGGGGCCTGG + Intergenic
1067441834 10:46312891-46312913 GGGGGCCCAGCATGGGGGCCTGG - Intronic
1075547648 10:123367336-123367358 GGGACACTCAGATGGGGTCCTGG - Intergenic
1075667440 10:124241060-124241082 GGGGGACTCAGGCGGGGGCCAGG + Intergenic
1075694364 10:124422695-124422717 GAGGGTCTCACCTGGGGGACGGG - Intergenic
1076720122 10:132388817-132388839 GGGGGGCTCATACGGGGGCGGGG + Intergenic
1076746519 10:132517413-132517435 GGCTGAGTCACATGGGGGCTGGG + Intergenic
1076756749 10:132576527-132576549 GGGGGACGCACACTGGGGACAGG - Intronic
1077031785 11:471734-471756 GGGTGACGCAGATGGTGGCCTGG + Intronic
1077031798 11:471778-471800 GGGTGACGCAGATGGTGGCCTGG + Intronic
1077112902 11:869710-869732 TGGGGAGTCACATGGTGCCCAGG + Exonic
1077115686 11:883620-883642 GGGGGCCGCACATGAGTGCCTGG - Intronic
1077221635 11:1420609-1420631 GGGGGAGTCACAGGGGGTCCAGG - Intronic
1078507883 11:11965798-11965820 GGGGGCCTCACCTGTGGGGCTGG + Exonic
1078700167 11:13672449-13672471 GGGGGGCTGAGATGGGAGCCTGG + Intronic
1083609334 11:63997757-63997779 GGGGGACCCACCTGGGGGGAGGG - Exonic
1083780034 11:64913027-64913049 TGGGGACCCACCTTGGGGCCAGG + Exonic
1083812211 11:65112319-65112341 GGGGGACTAAGATGGACGCCTGG + Intronic
1084334600 11:68449340-68449362 GGAGGACTCTCATGGTGGTCCGG - Intergenic
1089300882 11:117497949-117497971 GGGGGACTCACAAGGGGAGAAGG + Intronic
1092239148 12:6826911-6826933 GGGGGACCCCCACGGGGTCCTGG + Exonic
1096480307 12:51935896-51935918 GTTGGACTAACATGGTGGCCAGG - Intergenic
1096518852 12:52173005-52173027 GGGGGACGCGCCTGGGGGCGGGG - Intronic
1099010044 12:77281123-77281145 GTGGCACTAGCATGGGGGCCTGG + Intergenic
1099200105 12:79666430-79666452 TGGGGACTCACAGGGGTGCTTGG - Intronic
1100680144 12:96909481-96909503 AGGAGAGTTACATGGGGGCCAGG + Intronic
1102467226 12:113137016-113137038 GGGGCACTCCCATTGGTGCCTGG - Intergenic
1102567108 12:113803920-113803942 GGATGACTCCCATGGGGACCTGG + Intergenic
1102755960 12:115340815-115340837 GGGGGTATCACATGGGGTCAGGG - Intergenic
1104020167 12:124986971-124986993 GGGTGGCTCACTTGGGGGTCAGG - Intronic
1104214562 12:126723423-126723445 AGGGAACTCACATGGGGGCTGGG + Intergenic
1104850139 12:131868765-131868787 GGGGAGCTCACACGTGGGCCTGG - Intergenic
1107904826 13:45052276-45052298 TGGGGTTTCACATGGTGGCCAGG + Intergenic
1111864005 13:93745072-93745094 GGAGGACTCACCTGTGAGCCTGG - Intronic
1119324739 14:73753150-73753172 GGAGGACTCAGCTGTGGGCCTGG - Intronic
1121269849 14:92630885-92630907 GGGGGAGGCAACTGGGGGCCAGG - Intronic
1123056768 14:105574591-105574613 GGGAGAGCCACATGGGGGCTGGG - Intergenic
1123081441 14:105697194-105697216 GGGAGAGCCACATGGGGGCTGGG + Intergenic
1123585918 15:21760645-21760667 GGGGGAAACACATGGTGCCCAGG + Intergenic
1123622559 15:22203235-22203257 GGGGGAAACACATGGTGCCCAGG + Intergenic
1124355380 15:28991478-28991500 GGCGGCCTCACAGTGGGGCCGGG - Intronic
1124533058 15:30522926-30522948 GGTGGACTCAGATGGGTGCTGGG + Intergenic
1126140155 15:45430644-45430666 GGGAGACTCACCTGGACGCCGGG - Exonic
1129273719 15:74432717-74432739 GGGGGACTCGCAGTGGGGGCTGG - Intronic
1132341042 15:101078795-101078817 GGGGGACACGCATGCGGGGCTGG + Intergenic
1133335475 16:5004220-5004242 GGGGGACAGACTTAGGGGCCAGG + Intronic
1133340986 16:5035790-5035812 GGGGGACACAGATAGGGGCCAGG + Intronic
1134493253 16:14711940-14711962 GGGGGACTGAGATGGGGGAGGGG + Intronic
1134498634 16:14751064-14751086 GGGGGACTGAGATGGGGGAGGGG + Intronic
1134525188 16:14937694-14937716 GGGGGACTGAGATGGGGGAGGGG + Intronic
1134547707 16:15123225-15123247 GGGGGACTGAGATGGGGGAGGGG - Intronic
1134581940 16:15378021-15378043 GGGGGACTGAGATGGGGGAGGGG - Intronic
1134720640 16:16379496-16379518 GGGGGACTGAGATGGGGGAGGGG + Intronic
1134946787 16:18332389-18332411 GGGGGACTGAGATGGGGGAGGGG - Intronic
1135530900 16:23252787-23252809 GGGGGTCTCACATGTTGGCCAGG - Intergenic
1136626441 16:31464912-31464934 TGGGGACTCACATGGGGGCAAGG - Intronic
1138356304 16:56383755-56383777 GGGAAATTCACATGGGGGCTTGG - Intronic
1139857226 16:69990531-69990553 GGGGGACTGAGATGGGGGAGGGG - Intergenic
1141608001 16:85166411-85166433 GGGGGGATGACATGGGGGCAGGG - Intergenic
1141669482 16:85484310-85484332 GCAGGACTCAGATGGGAGCCTGG + Intergenic
1142129267 16:88425327-88425349 GGGGGTCTGACATGTGGGACTGG + Intergenic
1142695131 17:1629160-1629182 GGGGGAGTCCGCTGGGGGCCGGG - Intergenic
1142745670 17:1956417-1956439 TGAGGACTCAAGTGGGGGCCTGG + Intronic
1142762856 17:2051640-2051662 GCTGGACTCCCGTGGGGGCCTGG + Intergenic
1142848206 17:2692150-2692172 GGGGGCCTGACTCGGGGGCCCGG + Intronic
1143270837 17:5673363-5673385 GGGGTACCCAGGTGGGGGCCAGG + Intergenic
1143520306 17:7440754-7440776 GGCTGAGTCACGTGGGGGCCCGG - Intronic
1143687557 17:8530534-8530556 GGGGGACTGGCAGGGTGGCCGGG - Intronic
1144201972 17:12949719-12949741 GGGGTACTCACTTGGAAGCCTGG - Exonic
1144671299 17:17134086-17134108 AGGAGACACACATGTGGGCCTGG - Intronic
1144809001 17:17986688-17986710 GGGGGGATCACTTGGGGGTCAGG - Intronic
1146903235 17:36601595-36601617 GAGGGACCCACGTGGGAGCCTGG + Exonic
1147028438 17:37609479-37609501 GGGGGAGTCACGTGGGCGCGAGG - Exonic
1147702383 17:42404209-42404231 GGGGGCCTCCCATGGGGGCAGGG + Exonic
1148794150 17:50189157-50189179 GGGGCACTTACAGAGGGGCCAGG + Exonic
1149564459 17:57631158-57631180 GGGGGACTCAGAAAGGGGCTGGG - Intronic
1150249499 17:63698268-63698290 GGGGGCCTCCCAGGGGGTCCTGG + Exonic
1151173193 17:72265687-72265709 GGTGGAGTCACTTGGGGGGCCGG - Intergenic
1152578106 17:81151812-81151834 GGGAGATGCACATGGTGGCCAGG + Intronic
1152581233 17:81166346-81166368 GGGGGACACAGAAGGGGGCTTGG + Intergenic
1152607975 17:81302557-81302579 GGGGGAGCCTCAGGGGGGCCTGG + Intergenic
1152713734 17:81888209-81888231 GGGGGAGCCAGCTGGGGGCCTGG - Intronic
1160022528 18:75191502-75191524 GGGGTCCTCACATGTGAGCCAGG + Intergenic
1161237236 19:3204182-3204204 GGAGCACACACATCGGGGCCGGG + Intronic
1161708571 19:5834296-5834318 TGGGGACTCACATGCTGACCAGG + Intronic
1162261764 19:9539794-9539816 GGGGGACTCCCTTGGGAGACTGG + Intergenic
1162320269 19:9967336-9967358 GGGGAACTCACCGGGGGGCCTGG + Exonic
1162322089 19:9976547-9976569 GGGGCACTCACCGGGGGACCTGG + Exonic
1162373875 19:10294001-10294023 CAGGGGCTCACACGGGGGCCAGG - Intronic
1162433452 19:10643026-10643048 GGGAGACTGGCGTGGGGGCCAGG + Intronic
1162929976 19:13952811-13952833 AGGGGGCTCAGTTGGGGGCCTGG + Intronic
1163375921 19:16930558-16930580 GCGGGAATCAGCTGGGGGCCGGG + Intronic
1163755759 19:19105408-19105430 GGGGCCCTCACATGGGGGTGGGG + Intronic
1163791162 19:19306792-19306814 GGGGCACTGACAAGGGGGCCAGG + Intronic
1163843169 19:19624033-19624055 GGGGGAGTCAGATGGGGTGCAGG - Exonic
1166296495 19:41892577-41892599 CAGGGACACACATGGGGGCTAGG - Intronic
1167645757 19:50704024-50704046 GGGGACCTGACTTGGGGGCCAGG - Intronic
926106983 2:10158741-10158763 GGGAGACTGGCATGGGGGCCGGG + Intronic
929126706 2:38529182-38529204 GGGGGTCTCACATGTTGCCCAGG + Intergenic
932280764 2:70489868-70489890 GGAGGACTCTCCTGGGGGCCTGG - Intronic
932815840 2:74861085-74861107 AGGGGCCACACATAGGGGCCTGG + Intronic
936111749 2:109670782-109670804 GGGGGAATCACAAGGGGACAGGG + Intergenic
936351929 2:111719516-111719538 GGGGGACGCACCTGAGGGCTGGG + Intergenic
937289718 2:120774933-120774955 GGTGGGCTCTCATGGGAGCCCGG - Intronic
941799165 2:169636025-169636047 GAGGGACTCGCATGGGTGCTGGG - Intronic
943735679 2:191351693-191351715 GGGGGTTTCACATGTTGGCCAGG - Intronic
948061333 2:235044998-235045020 GGTGACCCCACATGGGGGCCCGG - Intronic
948097180 2:235344978-235345000 GGGGGACTCACAGTTGGCCCTGG - Intergenic
948556881 2:238818147-238818169 AGAGGCCTCACATGGGGCCCTGG + Intergenic
1172589544 20:36107636-36107658 GGGGGTTTCACATGCTGGCCAGG - Intronic
1172602567 20:36194170-36194192 AGGGGTCTCACATGGTTGCCTGG + Intronic
1172621274 20:36320006-36320028 GGGGGACACAGAGGGAGGCCTGG - Intronic
1172621338 20:36320195-36320217 GGGGGACACAGAGGGAGGCCCGG - Intronic
1172621348 20:36320222-36320244 GGGAGACACAGAGGGGGGCCTGG - Intronic
1175226052 20:57444626-57444648 GGGGCCGTCACATGGGGGCCAGG + Intergenic
1176000861 20:62830648-62830670 GGGGGACTGTCATGGGGGTGGGG - Intronic
1178983130 21:37282030-37282052 GGGGGATTCAAAGGGGGCCCAGG - Intergenic
1179304504 21:40142088-40142110 GGGGCACTCAGGAGGGGGCCAGG - Intronic
1180095677 21:45554438-45554460 GGGGGACTGGGATGGGGGCGCGG - Intergenic
1182472525 22:30557251-30557273 GGGCCACTCACGTGGAGGCCAGG + Exonic
1182475185 22:30573284-30573306 GGGGTCCTGAAATGGGGGCCAGG + Intronic
1183029536 22:35093255-35093277 GGGGGTCTCCCATGGGGACTGGG + Intergenic
1183475484 22:38033777-38033799 AGTGGAGTCACATGGGGGGCAGG - Intronic
1183931943 22:41240447-41240469 GGGGGAGGCTCCTGGGGGCCGGG - Intronic
1184259893 22:43308729-43308751 GGGGGACTCCCGATGGGGCCTGG - Intronic
1184321658 22:43746608-43746630 GAGGGACTTACAAGGGTGCCAGG + Intronic
1184363529 22:44033441-44033463 GGGCAACTCACATGGGCACCAGG + Intronic
1184673234 22:46026724-46026746 GCAGGACACACATGTGGGCCTGG + Intergenic
1185227604 22:49661698-49661720 GGGGGAAACAAATGAGGGCCTGG + Intergenic
1185277699 22:49956909-49956931 AGGGGGCTCACACTGGGGCCTGG + Intergenic
950095736 3:10329180-10329202 GGGGGGCTCACAGGAGGGGCGGG + Intronic
950473317 3:13199721-13199743 GGAGGACTCAGATGGGGGCAGGG - Intergenic
950528029 3:13536050-13536072 GGAAGACTCAGATGAGGGCCTGG + Intergenic
950570823 3:13798927-13798949 GGGGAACGCACCCGGGGGCCTGG + Intergenic
950639898 3:14342141-14342163 GGGGGACTCTCCCAGGGGCCTGG + Intergenic
950644327 3:14368149-14368171 GGGGGTCTCCCATGGGGAGCTGG - Intergenic
953244943 3:41182563-41182585 AGGGGCCTCACCTGGGGCCCAGG + Intergenic
953435294 3:42872951-42872973 GGGAGACTCCCATGTGGGTCTGG + Exonic
959643825 3:108674160-108674182 GGGTGACTCACATGGCAGCAAGG + Exonic
961322191 3:126083917-126083939 GGGGGAGTCAGGTGGGGACCGGG - Intronic
961790275 3:129371086-129371108 GGTTGACTCAGATGGGGGCAGGG + Intergenic
968224995 3:196968039-196968061 GTGGGACTCACAGTGTGGCCGGG - Intronic
968810997 4:2799661-2799683 GGGGGACCCACTTGGGACCCAGG + Intronic
969613985 4:8241792-8241814 TGGGGACTGAGATGAGGGCCGGG - Intronic
973334468 4:48942152-48942174 GAGGGACTCACCTGGGAGCTGGG + Intergenic
985589646 5:757872-757894 GGGGGACTCACATGGGGGCCAGG + Intronic
985792465 5:1937583-1937605 GAGAGACTCACATGGGGGTGGGG + Intergenic
985882638 5:2651339-2651361 TGAGGACACACATGTGGGCCTGG - Intergenic
987862324 5:23504707-23504729 GGGGGTCTCACATGTTGCCCAGG - Intergenic
992401077 5:76411964-76411986 GGGGGTGGCACATGGGGGGCTGG + Intronic
994228349 5:97281787-97281809 TGGAGACTCAGATGGGGGCAGGG - Intergenic
994846041 5:104989655-104989677 GGGGGACTGACATGAGGTCCTGG - Intergenic
996526956 5:124489855-124489877 GGTGGTCTCACATGGGGGTGAGG - Intergenic
998136731 5:139678016-139678038 GGGGGACGCACACAGGGGCTGGG + Intronic
1000801830 5:165737155-165737177 GGGTGGCACACATGGGGGCATGG + Intergenic
1004764894 6:18715056-18715078 AAGGGACTCAAATGGGGACCTGG + Intergenic
1006096930 6:31661920-31661942 GGGGGACTCCCAGGAGGGTCTGG + Exonic
1007784591 6:44272373-44272395 GGGAGACTCACAGGGGAACCAGG + Intronic
1007790718 6:44306653-44306675 GAGGGACTCAAATGGGGAACTGG + Intronic
1007906850 6:45470604-45470626 CTTGGACTCACATGGAGGCCAGG - Intronic
1008092790 6:47309520-47309542 CGGGGACTCGCAGGGGCGCCCGG + Exonic
1008955576 6:57212688-57212710 CAGGGACTCACATGGTGCCCAGG - Intronic
1017814339 6:158005867-158005889 GGGGGACAGACATGGTGGGCGGG - Intronic
1018909034 6:168091410-168091432 GGAGGACTCTGCTGGGGGCCTGG - Intergenic
1019320572 7:413735-413757 GGGAGACACTCACGGGGGCCAGG - Intergenic
1019348764 7:543370-543392 GGGTGACTCACTTTGAGGCCAGG - Intergenic
1019630267 7:2045305-2045327 GGGGGACTCTCATAGGGACGTGG - Intronic
1024939201 7:54744932-54744954 GGGTAGGTCACATGGGGGCCAGG + Intergenic
1026964791 7:74432364-74432386 GGGGGTTTCACATGGTGGCCAGG - Intergenic
1029521709 7:101066960-101066982 GCAGGACTCACAGGGGAGCCAGG + Intergenic
1030558890 7:111061491-111061513 GGGGGACTTAAAGGGTGGCCAGG + Intronic
1030680479 7:112428571-112428593 GGGGGTCTCACTTGGGTGGCTGG + Intronic
1035243838 7:157549866-157549888 GGGAAACCCACATGGGTGCCAGG + Intronic
1036446030 8:8822497-8822519 GGGGGACTGAGATGGGGACAGGG + Intronic
1036446085 8:8822692-8822714 GGGGGACTGAGATGGGGGCAGGG + Intronic
1037741201 8:21610590-21610612 GGAGGACACACATGGTGGGCCGG - Intergenic
1039512272 8:38101765-38101787 GGGTGGATCACATGGGGGTCAGG + Intergenic
1039964110 8:42271458-42271480 GGGGGACTCACCTGTCGGCAGGG - Exonic
1040416235 8:47198331-47198353 CGCAGACTCACATGGGGGCTGGG + Intergenic
1047932624 8:129745870-129745892 GGAGGGCTCACCTGGGGGTCTGG - Intergenic
1054762500 9:69015599-69015621 GGGCGGCTGACATGGTGGCCTGG - Intergenic
1054966016 9:71027150-71027172 GGGGGACTGATATTGGGCCCTGG - Intronic
1056587346 9:87937484-87937506 GGAGGACACCCACGGGGGCCAGG - Intergenic
1056609531 9:88115459-88115481 GGAGGACACCCACGGGGGCCAGG + Intergenic
1056965685 9:91161413-91161435 GGAGGACGCACAGGAGGGCCGGG - Intergenic
1057299069 9:93865971-93865993 GCGGGACCCTCATGGGGCCCTGG + Intergenic
1060548515 9:124474612-124474634 GGAGGACACAGGTGGGGGCCTGG - Intronic
1060638336 9:125217888-125217910 GTGGGACTCAAATGGGGACCTGG - Intronic
1061537470 9:131258862-131258884 GGGGGCCCCTGATGGGGGCCAGG - Exonic
1062400075 9:136368490-136368512 GGGCTGCTCTCATGGGGGCCGGG + Intronic
1194578195 X:95639452-95639474 GGGGGTTTCACATGTTGGCCAGG + Intergenic
1198070413 X:133142972-133142994 GGGAGAATCACTTGGGTGCCAGG - Intergenic
1198974999 X:142326871-142326893 GGGGGACTGGCATTGGGCCCTGG + Intergenic
1202074196 Y:21022016-21022038 TGGGGAATGAGATGGGGGCCTGG - Intergenic