ID: 985589925

View in Genome Browser
Species Human (GRCh38)
Location 5:759257-759279
Sequence CAGTGTTAACAAAGGGCGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 94
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 82}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985589925_985589940 26 Left 985589925 5:759257-759279 CCCTGCGCCCTTTGTTAACACTG 0: 1
1: 0
2: 0
3: 11
4: 82
Right 985589940 5:759306-759328 AGGCAGGAAAAGAGAGGAGGTGG 0: 2
1: 3
2: 27
3: 302
4: 2508
985589925_985589933 10 Left 985589925 5:759257-759279 CCCTGCGCCCTTTGTTAACACTG 0: 1
1: 0
2: 0
3: 11
4: 82
Right 985589933 5:759290-759312 CCCCGCCCTGTTCTGCAGGCAGG 0: 1
1: 0
2: 3
3: 25
4: 443
985589925_985589930 6 Left 985589925 5:759257-759279 CCCTGCGCCCTTTGTTAACACTG 0: 1
1: 0
2: 0
3: 11
4: 82
Right 985589930 5:759286-759308 TTTCCCCCGCCCTGTTCTGCAGG 0: 1
1: 0
2: 2
3: 23
4: 398
985589925_985589939 23 Left 985589925 5:759257-759279 CCCTGCGCCCTTTGTTAACACTG 0: 1
1: 0
2: 0
3: 11
4: 82
Right 985589939 5:759303-759325 TGCAGGCAGGAAAAGAGAGGAGG No data
985589925_985589938 20 Left 985589925 5:759257-759279 CCCTGCGCCCTTTGTTAACACTG 0: 1
1: 0
2: 0
3: 11
4: 82
Right 985589938 5:759300-759322 TTCTGCAGGCAGGAAAAGAGAGG 0: 1
1: 0
2: 6
3: 58
4: 528

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985589925 Original CRISPR CAGTGTTAACAAAGGGCGCA GGG (reversed) Intronic
902217892 1:14945937-14945959 CAGTGTTGACGGAGGGCTCATGG + Intronic
904955604 1:34280820-34280842 CAGTGTTGCAAAAGGGCCCAGGG - Intergenic
907467158 1:54646123-54646145 CAGTGATAACAAGTGGCCCAGGG - Intronic
915437654 1:155920876-155920898 CAGTGTTAACAAAGTCCTCAAGG - Intronic
922213478 1:223502559-223502581 GAGTGTTAACCAAGGGGGGAAGG + Intergenic
1063402933 10:5765154-5765176 CAGTGCTACCAAAGGAAGCACGG + Intergenic
1065757071 10:28940593-28940615 CAGTGAGTACAAAGGGAGCAAGG + Intergenic
1068150048 10:53120030-53120052 CAGTGTGAACAAAGGCAGAAAGG + Intergenic
1069138807 10:64798741-64798763 CATTGTTAATATAGGGCTCATGG - Intergenic
1079388396 11:20000547-20000569 CAGTTTAAACAAAGGCCTCAAGG + Intronic
1087105531 11:94403247-94403269 CAGTGTCAACAAAGAGTGTATGG + Intergenic
1087549409 11:99628724-99628746 GAGAGCTAACAAAGGGCACAGGG + Intronic
1091571393 12:1690063-1690085 AAGAGATAACAAAGGGTGCAGGG - Intronic
1096165090 12:49415911-49415933 AAATGTTAACAAAGGCCTCAAGG - Intronic
1096430031 12:51535354-51535376 CAGTTTTAACAAATGTAGCAGGG - Intergenic
1097702008 12:62829833-62829855 CAGTGTTGACATATGGCCCAAGG - Intronic
1100534847 12:95498662-95498684 CAGTCTTAACAAATGGTGCTGGG - Intronic
1102038831 12:109787710-109787732 CAGTGAGAAAAAAGGGCCCAAGG - Intronic
1104687015 12:130793143-130793165 CAGGGTTATCAAGAGGCGCATGG + Intronic
1108637447 13:52350059-52350081 CATTGGCAAGAAAGGGCGCAAGG - Intergenic
1116307290 14:43274389-43274411 CAGTGTTATGAAAGGTAGCAAGG + Intergenic
1119853016 14:77879470-77879492 CAGTGTGTGCAAAGGGCCCATGG + Intronic
1121371823 14:93365740-93365762 CAGTGAGAAAAAAGGGCACATGG + Intronic
1124698674 15:31891480-31891502 CAGTGTTAATAAAAGGGGCAGGG - Intergenic
1126509725 15:49455248-49455270 CAGTGTTAACAAAGCGGCCATGG + Intronic
1140664503 16:77215084-77215106 CAGTGTTGCCAAAAGGCGGAAGG + Intergenic
1141257962 16:82421140-82421162 CAGTGTCAGCAAAGGGCTAAGGG - Intergenic
1143226158 17:5305645-5305667 CAGAGGTAACAAAGGGCTCTGGG - Intronic
1145712410 17:26989772-26989794 CAGTGTGCACAAAGGTCACAGGG - Intergenic
1146180286 17:30693803-30693825 CCCTGGTAACAAAGGGCGGACGG - Intergenic
1156900746 18:42297913-42297935 AAGTGTCAACAAAGAGTGCAAGG - Intergenic
1158293522 18:55968882-55968904 CAGTGGTAATAAAGGAAGCAAGG - Intergenic
1162978314 19:14221737-14221759 CCCTGGTAACAAAGGGCGGACGG + Intergenic
1164902118 19:31937330-31937352 CAGTGTTAACACATGACTCAAGG + Intergenic
1166360257 19:42250164-42250186 CTGTGTTACCAAGGGGCTCAGGG + Intronic
925583436 2:5438209-5438231 CAGTGTTAAAAAAGAGGACAGGG - Intergenic
929243923 2:39681803-39681825 CAGTTTTTACAAAGGGAGAAAGG + Intronic
929521151 2:42652140-42652162 CAGGGTTAGCAAAGGTTGCATGG + Intronic
933467075 2:82666055-82666077 CCTAGTTAACAAAGGGAGCAAGG - Intergenic
939707884 2:145478213-145478235 CAGTGTTTACAAAGAGCCCAAGG + Intergenic
947678304 2:232005642-232005664 CAGGGTAAACAAAGGGAGGAAGG - Intronic
948278607 2:236729132-236729154 CTCTGTTCACAAAGGCCGCAGGG - Intergenic
948714702 2:239853399-239853421 CAGCGGTTAAAAAGGGCGCAGGG + Intergenic
949042994 2:241857991-241858013 CAGTGTACACAGAGGGCCCAGGG + Intronic
1170679221 20:18510054-18510076 CAAAGTTAACAAAGTGCGGAAGG + Intronic
1172225569 20:33303046-33303068 CAGGGTGAACAAAGGGCGGAGGG - Exonic
1174584604 20:51598324-51598346 TAGTGTTGTCAGAGGGCGCAGGG + Exonic
1175753206 20:61513382-61513404 CAATGTTAACAAAGGGCCTGGGG + Intronic
1176029715 20:63006065-63006087 CAGTGTTTGCAAAGCGCGGAGGG + Exonic
1176326886 21:5509110-5509132 CTGTGTTAGCAAAGGGCTCTGGG - Intergenic
1176400871 21:6311841-6311863 CTGTGTTAGCAAAGGGCTCTGGG + Intergenic
1176436286 21:6677263-6677285 CTGTGTTAGCAAAGGGCTCTGGG - Intergenic
1176460548 21:7004333-7004355 CTGTGTTAGCAAAGGGCTCTGGG - Intergenic
1176484109 21:7386111-7386133 CTGTGTTAGCAAAGGGCTCTGGG - Intergenic
1176690170 21:9897520-9897542 CAGTGTAAAGACAGGGCCCAAGG - Intergenic
1181615231 22:24049714-24049736 CAGTCTTAACAAAAGGAGCCTGG - Intronic
949801179 3:7906111-7906133 CAGTGTAAACAAAGCCCCCAGGG - Intergenic
951907288 3:27717681-27717703 AAGTGTTGACAAAGGGCTCCGGG + Exonic
960332049 3:116372325-116372347 CAGTATTAACAAATGGTGCTGGG + Intronic
963792648 3:149600212-149600234 CAGTGTAATCAAATGGGGCAAGG + Intronic
967745673 3:193052289-193052311 TAGTGCTAACACAGGGCCCATGG - Intergenic
976582896 4:86760623-86760645 AAGTGTTAACAAGAGGCCCAAGG + Intronic
978395735 4:108277823-108277845 CAGAGTTTACAAAGGGCACAAGG - Intergenic
978496021 4:109359885-109359907 CAGTGTTAACAACGAGCTGATGG - Intergenic
985589925 5:759257-759279 CAGTGTTAACAAAGGGCGCAGGG - Intronic
985822989 5:2173057-2173079 CTGTATTTACAAAGGGCGCATGG + Intergenic
990966690 5:61455828-61455850 CAGTGTTAACAGTGGGGGCGGGG - Intronic
993266471 5:85732338-85732360 CAGTGTAAACAAAAGGGGCAGGG + Intergenic
993590807 5:89793271-89793293 CAGTGGTTACCAAGGGAGCAAGG + Intergenic
997127500 5:131242902-131242924 CATTGTGAACAAAGGGCACAGGG + Intergenic
997252305 5:132398490-132398512 CAGTGTAAACAAAGCCCCCAGGG + Intergenic
999615859 5:153423117-153423139 AAGTGTCAAGAAAGGGCACAGGG - Intergenic
1003601739 6:7523937-7523959 AAGTTTTAACAAAGGGCACAGGG + Intergenic
1009028974 6:58034468-58034490 CTGTGTTCACAAAGGGTGAAGGG + Intergenic
1009204508 6:60785857-60785879 CTGTGTTCACAAAGGGTGAAGGG + Intergenic
1015352894 6:132244025-132244047 CAGTGTTTGAATAGGGCGCAAGG - Intergenic
1018323768 6:162641703-162641725 TAGAGTTAACAGAGGGCGGATGG - Intronic
1032156330 7:129471816-129471838 CAGTGGTAAAAAAGGGTGCTAGG - Intronic
1033449684 7:141451143-141451165 AAGTGTTAACAAAGGCCTCAGGG + Intronic
1036911318 8:12759558-12759580 CAGGGTGCACAAAGTGCGCAAGG + Intergenic
1042862375 8:73327391-73327413 CAGTGTTAACAGACAGCACATGG + Intergenic
1044362505 8:91304693-91304715 TAGTGTTGACAAAGGAAGCAAGG + Intronic
1052161152 9:25261591-25261613 CAGTGTTATCAAATGGAGGATGG - Intergenic
1053626897 9:39882065-39882087 CAGTGTAAAGACAGGGCCCAAGG - Intergenic
1053779093 9:41583955-41583977 CAGTGTAAAGACAGGGCCCAAGG + Intergenic
1054167052 9:61794196-61794218 CAGTGTAAAGACAGGGCCCAAGG + Intergenic
1054216989 9:62368638-62368660 CAGTGTAAAGACAGGGCCCAAGG + Intergenic
1054670494 9:67786702-67786724 CAGTGTAAAGACAGGGCCCAAGG - Intergenic
1055827050 9:80339498-80339520 CAGTGTTAACTCAAGGCCCAAGG - Intergenic
1056562830 9:87747518-87747540 TGGTGTTAACAAGGGGCCCAGGG - Intergenic
1203435229 Un_GL000195v1:131398-131420 CTGTGTTAGCAAAGGGCTCTGGG + Intergenic
1189048252 X:37616431-37616453 CAGTGTTAAAAAAGGACTCTTGG + Intronic
1199877518 X:151946184-151946206 CAGTGATAAGAAAGGAGGCAGGG - Intergenic
1200109016 X:153729612-153729634 GAGTGGTAACAAAGGGCGTGAGG - Intronic