ID: 985591337

View in Genome Browser
Species Human (GRCh38)
Location 5:766974-766996
Sequence GTGGTCTCCCTGACAGTGGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 242
Summary {0: 1, 1: 0, 2: 4, 3: 39, 4: 198}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985591337_985591345 -6 Left 985591337 5:766974-766996 CCACCCACTGTCAGGGAGACCAC 0: 1
1: 0
2: 4
3: 39
4: 198
Right 985591345 5:766991-767013 GACCACGGGGACTGGGAACATGG 0: 1
1: 0
2: 0
3: 19
4: 155
985591337_985591352 23 Left 985591337 5:766974-766996 CCACCCACTGTCAGGGAGACCAC 0: 1
1: 0
2: 4
3: 39
4: 198
Right 985591352 5:767020-767042 GGACCAGCACTGACAGCCAATGG 0: 2
1: 0
2: 0
3: 17
4: 191
985591337_985591347 2 Left 985591337 5:766974-766996 CCACCCACTGTCAGGGAGACCAC 0: 1
1: 0
2: 4
3: 39
4: 198
Right 985591347 5:766999-767021 GGACTGGGAACATGGCCCCCAGG 0: 1
1: 0
2: 2
3: 35
4: 284

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985591337 Original CRISPR GTGGTCTCCCTGACAGTGGG TGG (reversed) Intergenic
900579436 1:3401251-3401273 GTGGTCTCTCTGACACAGGGAGG + Intronic
900687436 1:3957749-3957771 GTTGTCGCCCTCACAGTGTGGGG + Intergenic
900737841 1:4310289-4310311 GTGGTCCGCCTGAGAGTGAGTGG + Intergenic
902643389 1:17780899-17780921 GTGGTCTCTCTGGGACTGGGGGG + Intronic
902827797 1:18989033-18989055 TTGGCCTCCCTCACAGTGGGTGG + Intergenic
903551216 1:24158381-24158403 GTTGTCACCCTGACAGTTAGTGG + Intronic
904286290 1:29454990-29455012 GGGGTCTCCCTGGCAGTGTCTGG + Intergenic
907943135 1:59107957-59107979 CTGGTCACCCAGCCAGTGGGTGG + Intergenic
910443475 1:87276883-87276905 GTGTTCTCCCTGAAATTTGGGGG + Intergenic
912556997 1:110523763-110523785 GGGGTCTCCGGGACAGTGAGGGG - Intergenic
914941761 1:152029281-152029303 GTGGTGGCCTGGACAGTGGGTGG - Intergenic
918704349 1:187641729-187641751 CTGGGCTCCCTGACTGTGGGAGG - Intergenic
919196514 1:194294123-194294145 GTGGTCTTCTTGGCTGTGGGAGG + Intergenic
920090786 1:203451508-203451530 GTGGTTTCACTGTCAGTGGATGG + Intergenic
920698061 1:208196790-208196812 GTGTTGTCCCTGAGAATGGGTGG + Intronic
920845662 1:209591181-209591203 GAGGTCTCACTGGCAGTGGTGGG - Intronic
922252538 1:223863210-223863232 TCGGTCTCCCTGGGAGTGGGTGG - Intergenic
922795037 1:228335633-228335655 GTGGTCACCCTGACAGTGATGGG - Intronic
923071121 1:230565333-230565355 CTGGTCTCCATTCCAGTGGGAGG - Intergenic
923088562 1:230720819-230720841 GTGGTCTCCCTACCAGAAGGTGG - Intergenic
924509101 1:244713550-244713572 GTGGTTACCCTTCCAGTGGGGGG - Intergenic
1067473745 10:46553395-46553417 GTTGTCTCCCTGCCAGGGGCTGG - Intronic
1067715942 10:48691244-48691266 GTGGTCACCCTGACTTAGGGTGG + Intronic
1069508811 10:69024826-69024848 TTGGTCTCCCTGGGAGTGGGTGG + Intergenic
1073419086 10:103409440-103409462 GAGGACTCCCAGAGAGTGGGAGG + Intronic
1074765529 10:116697291-116697313 CTGGTCTCCATGCCTGTGGGAGG + Intronic
1075612399 10:123864246-123864268 GGGGTCTCTCTCTCAGTGGGTGG - Intronic
1077292050 11:1801933-1801955 TTGGTCTCCCTGGGAGTGGGTGG - Intergenic
1079075645 11:17384012-17384034 GGGGTCTCCCTCAGAGTTGGTGG + Intergenic
1082167112 11:48962663-48962685 GTGTTCTCCACCACAGTGGGCGG + Intergenic
1082239923 11:49858542-49858564 GTGTTCTCCACCACAGTGGGCGG - Intergenic
1082609962 11:55283912-55283934 GTGTTCTCCACCACAGTGGGTGG - Intergenic
1082656726 11:55866612-55866634 GTGTTCTCCACCACAGTGGGCGG + Intergenic
1083231771 11:61326079-61326101 GTGGTAGCCCTGATAATGGGGGG - Intronic
1083374644 11:62209571-62209593 TTCCTCTCCCTTACAGTGGGAGG + Intronic
1084088193 11:66864388-66864410 GTGGGCTCCCAGACAGCGAGGGG + Intronic
1085047246 11:73360705-73360727 GTGGCCTCCCTGGCAGGGAGGGG + Intronic
1085267182 11:75243819-75243841 GCGTTCTCCCAGACTGTGGGAGG + Intergenic
1086171036 11:83836706-83836728 GTTGTCTCTCTGATAGTGGTAGG - Intronic
1088017037 11:105073352-105073374 TTGAGCTCCTTGACAGTGGGAGG + Intronic
1088019585 11:105103252-105103274 TTGAGCTCCTTGACAGTGGGAGG + Intergenic
1090090236 11:123690304-123690326 GTGGTCTCCCTCTCAGCTGGAGG + Intergenic
1097309548 12:58103207-58103229 GTGGTGTCCCTGACAGGGAGAGG + Intergenic
1101294745 12:103410203-103410225 ATTGTCTCCCTGGAAGTGGGTGG - Intronic
1103763173 12:123265699-123265721 GTGGCCTCCCTGAGTGTGTGAGG - Intronic
1104153101 12:126104294-126104316 GGGGTCTCACTGACAGTAGCAGG - Intergenic
1107817390 13:44256360-44256382 GTGGCCAACCTCACAGTGGGTGG + Intergenic
1108504425 13:51098328-51098350 GTGGTCTCCTTGGCATTGGCTGG - Intergenic
1113987606 13:114330993-114331015 GTTATCTCCATGAAAGTGGGAGG - Intergenic
1114058809 14:19000500-19000522 TTGGTCTCCCTGAGAGTGGCTGG + Intergenic
1114103735 14:19401254-19401276 TTGGTCTCCCTGAGAGTGGCTGG - Intergenic
1115449311 14:33527850-33527872 CTGATCTCCCTGCCAGAGGGTGG + Intronic
1116107506 14:40528658-40528680 GTGATCACCTTGAAAGTGGGTGG + Intergenic
1116931669 14:50696896-50696918 GGGGTCTCCTTGAGAGTGGAGGG - Intergenic
1118393610 14:65317124-65317146 GAGGGCTGCCTGACAGTGGCTGG + Intergenic
1118605485 14:67499937-67499959 GTGGTCTCCTGGCCAGTGGAAGG + Intronic
1118935024 14:70279854-70279876 GAGGTCTCCTTGAGAGTGGGGGG + Intergenic
1119137576 14:72234644-72234666 GTGGTGTCCCTGTCACTGTGAGG - Intronic
1120338419 14:83188917-83188939 TTGGTGTACCTGAAAGTGGGGGG - Intergenic
1120641152 14:87014750-87014772 GTTGTATCACTGACAGTTGGAGG - Intergenic
1120747973 14:88168730-88168752 TTGGTCTCCATGCCAGTAGGTGG - Intergenic
1121266892 14:92609638-92609660 GTGGTCTCCTGGGCAGTAGGTGG + Intronic
1121605559 14:95237524-95237546 CTGGCCTCCCGGACAGTGGATGG - Intronic
1122101685 14:99416609-99416631 GTCGTCTTTCTGACAGTGGCAGG - Intronic
1122118129 14:99537678-99537700 GTGGTCTGCCTGGCAGGGCGGGG - Intronic
1122262480 14:100531225-100531247 GGGGTATCCCAGACAGAGGGAGG + Intergenic
1122347135 14:101067548-101067570 ATGCTCTCCCTGGCAGAGGGAGG - Intergenic
1123010937 14:105349197-105349219 GGGGTGGCCCTGACAGTTGGCGG - Intronic
1126597574 15:50397630-50397652 GTGGAGTGCCTGACAGTGGGGGG + Intergenic
1126779912 15:52130671-52130693 GTGGTCTCCCTCACACAGGAGGG + Intronic
1129115285 15:73362183-73362205 GAGGTCTGCCTGCCAGTGTGGGG - Intronic
1132657406 16:1046996-1047018 GTGGTCTGCCTGCCTGAGGGTGG + Intergenic
1133203473 16:4218767-4218789 GTGGTCTTCCTGGCAGTTGTAGG - Intronic
1134129610 16:11640345-11640367 GAGGTCACACGGACAGTGGGCGG + Intergenic
1137350829 16:47712744-47712766 CTGGTGTCCCAGGCAGTGGGTGG - Intergenic
1139291668 16:65864102-65864124 GTGGCCTCTCTGATAGTGGCAGG + Intergenic
1139360915 16:66399483-66399505 GTGGGGTCCCTGAAAGTTGGAGG + Intronic
1140255936 16:73336389-73336411 GGGGCCTCCCTGAGGGTGGGGGG - Intergenic
1140342568 16:74179397-74179419 GGGGCCTACCTGACAGTGGAGGG + Intergenic
1140478203 16:75249446-75249468 GTGGTCTCCGTGTAAGAGGGTGG - Intronic
1144573929 17:16417171-16417193 CTGGGCTCCCACACAGTGGGTGG + Intronic
1144637035 17:16916698-16916720 GTTGTCTCAATGACAATGGGGGG - Intergenic
1145862389 17:28221730-28221752 ATGGTCTCCCTGACTTAGGGTGG + Intergenic
1146315868 17:31806356-31806378 GTGGCCTTCCTGACCATGGGAGG + Intergenic
1147250445 17:39150149-39150171 GTGGTCTCCCTGAAAATTGGTGG + Intronic
1147537407 17:41329511-41329533 GTGGTCAGCCTGCCAGTAGGTGG - Intergenic
1147927926 17:43956632-43956654 ATGGTCTCCCTGACTTGGGGTGG - Intronic
1148867861 17:50638413-50638435 GTGAGCTCCCTGTCACTGGGGGG + Intronic
1150235782 17:63591783-63591805 CTGTTCTCCCTGACTGCGGGAGG + Exonic
1151191125 17:72398886-72398908 GTGCTGTACATGACAGTGGGTGG + Intergenic
1152381077 17:79942507-79942529 GTGGTCTCCATGACAGGGTGGGG + Intronic
1152632345 17:81415906-81415928 ATGGTCTCCCTGGCAGGGTGGGG - Intronic
1155254360 18:23981914-23981936 GCTGTCACCCTGACACTGGGAGG - Intergenic
1155611141 18:27669168-27669190 GAAGTCACACTGACAGTGGGAGG - Intergenic
1156624759 18:38895261-38895283 GTGGTCTCTCTGACAGTGTCTGG - Intergenic
1158015677 18:52780722-52780744 GTGGTCTGCCTCACACTTGGAGG - Intronic
1158694684 18:59693394-59693416 TTGGTCTCCCTGAGAGTGGGTGG + Intronic
1161060103 19:2210548-2210570 GGGGTCTCCCGGGCAGGGGGCGG - Intronic
1162059458 19:8085954-8085976 GAGGGCTCCCAGACAGTGGGAGG + Intronic
1162665420 19:12206345-12206367 GGGGTCTACTTGACAGTGGAAGG - Intergenic
1163302770 19:16458113-16458135 GGGGTGTTCCTGACAGTGGGGGG + Intronic
1163645238 19:18485518-18485540 CTGGTCTCCCTGGCCCTGGGAGG - Intronic
1166251782 19:41576346-41576368 GAGGACTCCCTGGGAGTGGGTGG + Intronic
1168535996 19:57171812-57171834 TTGGTCTCCCTGAGAGAGTGGGG + Intergenic
930834802 2:55782112-55782134 TTGATATCCCTGAAAGTGGGAGG + Intergenic
932592679 2:73076488-73076510 AGGGTGTCCCTGACAGAGGGTGG - Intronic
933447483 2:82400818-82400840 GTGGTCTACATGAGAGTGGAAGG - Intergenic
936427837 2:112435125-112435147 GTGGCCTCCCTGAGCGTGGATGG - Intergenic
936501761 2:113072349-113072371 GTAGCCTCCCTCACAGTTGGAGG - Exonic
937220509 2:120340530-120340552 GTGGTCTCTCTGGGAGAGGGAGG + Intergenic
938282386 2:130073717-130073739 TTGGTCTCCCTGAGAGTGGCTGG - Exonic
938333016 2:130462289-130462311 TTGGTCTCCCTGAGAGTGGCTGG - Exonic
938356793 2:130658382-130658404 TTGGTCTCCCTGAGAGTGGCTGG + Intergenic
938433229 2:131265188-131265210 TTGGTCTCCCTGAGAGTGGCTGG + Exonic
938477276 2:131627770-131627792 TTGGTCTCTCTGAGAGTGGCTGG + Intergenic
938579907 2:132636377-132636399 GTGGGCTCCCAGACCCTGGGAGG - Intronic
940673399 2:156698384-156698406 GTGGCTTCCCTGACAGTGAGTGG - Intergenic
941704729 2:168645692-168645714 GGGGCCTCCCTGACGGTGGTGGG - Intronic
942504377 2:176626285-176626307 TTGGTCTCCCTGGGAGGGGGTGG - Intergenic
942956425 2:181779544-181779566 AGGGTCTCCTTGTCAGTGGGTGG + Intergenic
945914159 2:215684897-215684919 GATGTCTCCCTGACACTAGGAGG - Intergenic
947225695 2:227838298-227838320 TTGGTGTACCTGACAGTGGCGGG - Intergenic
947622255 2:231598167-231598189 GAGGTGTCCCTGACAGGTGGTGG + Intergenic
948911948 2:241009316-241009338 GTGGACACCCAGACAGTGTGGGG + Intronic
949050152 2:241893459-241893481 GTGGTCTCCTGGACAGAGGAGGG - Intergenic
1170140980 20:13124688-13124710 GTGGCCTGCCTTACAGTGGTCGG - Intronic
1171882688 20:30630250-30630272 TTGGTCTCCCTGAGAGCGGCTGG - Intergenic
1173671128 20:44799618-44799640 GGAGTCACCCTGAGAGTGGGTGG - Intronic
1176180030 20:63745453-63745475 GTGCTCTACCTGACAATGTGGGG + Exonic
1176374411 21:6080086-6080108 GTGGCCTCCCTGAGCGTGGATGG + Intergenic
1179068635 21:38051156-38051178 GTGGTCTCCCTGAGATTGGGAGG + Intronic
1179254851 21:39706754-39706776 GTGGTCTCCCAGCCCTTGGGAGG + Intergenic
1179749065 21:43458159-43458181 GTGGCCTCCCTGAGCGTGGATGG - Intergenic
1180477294 22:15723116-15723138 TTGGTCTCCCTGAGAGTGGCTGG + Intergenic
1180967177 22:19796665-19796687 GGGGTCTGCCTGGAAGTGGGGGG + Intronic
1181733952 22:24867515-24867537 GATGTCACCCTGTCAGTGGGTGG - Intronic
1183517996 22:38278838-38278860 GTGCTCTCTCTGCCACTGGGGGG - Intergenic
1183910224 22:41073639-41073661 TTGGTCTCCCTGGGAGTGGGTGG - Intergenic
1184419892 22:44373723-44373745 GGCCTCTCCCTGGCAGTGGGAGG - Intergenic
1184475710 22:44720148-44720170 ACGGGCTCCCTGACAGTGGGAGG - Intronic
1184606469 22:45577326-45577348 GGGGTCACCCAGAGAGTGGGTGG - Intronic
1185009897 22:48307024-48307046 ATGGTCTTCCAGACAGTGGAAGG - Intergenic
1185245456 22:49770692-49770714 GTGGGCGCCCCCACAGTGGGTGG + Intergenic
1185332030 22:50256254-50256276 GGGGTCTCCTGGACCGTGGGTGG - Intronic
949367424 3:3298254-3298276 TTGGTCACCCTGATAGTGGAGGG - Intergenic
949400869 3:3664236-3664258 GTGGTCTTCCTCAATGTGGGTGG - Intergenic
950530874 3:13551604-13551626 TTGGTCTCCTTGGCCGTGGGGGG + Intronic
951645511 3:24886303-24886325 TTGGAGTCCCTGACAGTGTGAGG + Intergenic
952568099 3:34682044-34682066 CTGGTCTCCATGAAAGTGGGAGG + Intergenic
953825163 3:46245707-46245729 GGGGTCTACTTGAGAGTGGGAGG - Intronic
955939869 3:64137578-64137600 GTGGTCTCCCTGACATTTTCTGG - Intronic
956480979 3:69673869-69673891 GCTGTCTCCCTGACTGTGTGTGG - Intergenic
958055616 3:88407046-88407068 GTGGTCTACTTGAGGGTGGGAGG - Intergenic
958166499 3:89884068-89884090 GTGGTGTACCTGAAAGTGAGAGG - Intergenic
962090815 3:132242350-132242372 GTGGCATCCCAGACAGTGGGTGG + Intronic
962494891 3:135929211-135929233 TTGTTCTCCCTGAAAATGGGAGG + Intergenic
964243320 3:154620884-154620906 GTGGTGTCCCTGAAAGTGACAGG + Intergenic
964322916 3:155516817-155516839 GAGGGCTCTGTGACAGTGGGGGG - Intronic
966078979 3:175976981-175977003 TTGGTCTCCCTGGGAGTGGGTGG - Intergenic
966516088 3:180822129-180822151 TTGGTCTCCCTGGGAGTTGGTGG + Intronic
966793158 3:183691593-183691615 AAGCTCTGCCTGACAGTGGGAGG - Intergenic
967988625 3:195114858-195114880 GTGGTCTCCCTGCCGGTGCAAGG + Intronic
969469887 4:7381547-7381569 GTGGTGTCCCTGGCGGAGGGAGG + Intronic
970196008 4:13550211-13550233 GTTGTCTATTTGACAGTGGGTGG + Intergenic
970609518 4:17711998-17712020 GTGGTCTACTTTACAGTGTGTGG + Intronic
973366364 4:49212689-49212711 TTGGTCTCCCTGAGAGTGGCTGG - Intergenic
974065318 4:57072150-57072172 GGGGTCTACCTGACAGTGGAGGG - Intronic
975927599 4:79477239-79477261 GTGGTCTTCCTGAAGGTGGAGGG - Intergenic
976938195 4:90665884-90665906 GTGGACCTTCTGACAGTGGGAGG + Intronic
980129221 4:128803104-128803126 GAGGCCTCCCTGACGGTGCGTGG - Intergenic
981698436 4:147582231-147582253 GTGAGCTCCCTGACAGTGCAGGG - Intergenic
985591337 5:766974-766996 GTGGTCTCCCTGACAGTGGGTGG - Intergenic
985604394 5:850657-850679 TTGGTCTCTGTGACAGTGGGCGG - Exonic
986371148 5:7081481-7081503 GTGGTCTCCAAGACAGGGAGTGG + Intergenic
990106552 5:52270606-52270628 GTGGTCTACTTGAGGGTGGGAGG + Intergenic
992801377 5:80299160-80299182 TTGGTCTCCCTGGAAGTGCGTGG - Intergenic
993242629 5:85410499-85410521 GGGGTCTGCTTGACAGTGGAGGG - Intergenic
994316638 5:98340326-98340348 TTGGTCCCCCTGGGAGTGGGTGG + Intergenic
994416146 5:99474334-99474356 GTGGTCTCCCTCTCAGAGGCTGG + Intergenic
994463822 5:100100838-100100860 GTGGTCTCCCTCTCAGAGGCTGG - Intergenic
995364881 5:111347279-111347301 GAGGTCTACATGACAGTGGTTGG + Intronic
995894003 5:116990132-116990154 GTTGTCTCACTGACAGCTGGGGG + Intergenic
997639876 5:135442193-135442215 GGGCTCTGCCTGCCAGTGGGAGG + Intergenic
998133085 5:139660870-139660892 CTGGCCTCCCAGCCAGTGGGTGG - Intronic
998206063 5:140157602-140157624 GTCCGCTCCGTGACAGTGGGCGG + Intergenic
998368756 5:141647880-141647902 TTGATCCCCATGACAGTGGGTGG - Intronic
1002174350 5:177393161-177393183 TTTGTCTCACTGACAGTAGGTGG + Intronic
1005276425 6:24224096-24224118 GTTTTCTCCCTGACAGTCAGAGG + Intronic
1006251647 6:32792160-32792182 TGGGTCTCCCTGGCAGTGGAGGG - Intergenic
1008306855 6:49913828-49913850 CTCTGCTCCCTGACAGTGGGTGG - Intergenic
1008667909 6:53735033-53735055 GTCATCTCCCTGTCAGTGGGTGG + Intergenic
1009860579 6:69325977-69325999 GTGGACTACCTGAGCGTGGGTGG + Intronic
1010940773 6:81915176-81915198 GTCCTGACCCTGACAGTGGGGGG - Intergenic
1011056429 6:83208711-83208733 GGGGTCTACTTGACAGTGGAGGG + Intergenic
1011268654 6:85552723-85552745 GAGGTCTACGTGACAGTGGTTGG - Intronic
1012313351 6:97755562-97755584 TTGTTCTCCCTGAAATTGGGTGG + Intergenic
1013313848 6:108922736-108922758 GTGTTTTCCCTGACTGAGGGTGG + Intronic
1013743624 6:113318849-113318871 CTGGTGTTCCTGAGAGTGGGTGG + Intergenic
1016663151 6:146604479-146604501 TTGGTCTCCCTGGGAGTGGGTGG + Intronic
1018196685 6:161361594-161361616 GTGGTATCCCTGACAGTGGTGGG + Intronic
1018467864 6:164068087-164068109 GAGGTCTTCCTCACAGTGGCAGG + Intergenic
1019357727 7:589678-589700 GTTGTCTCCAGGACAGTGTGGGG - Intronic
1020124765 7:5527216-5527238 TTGGTCTCCCTGGGAGTGGGTGG - Exonic
1025209870 7:57014252-57014274 TCGGTGTCCCTGGCAGTGGGCGG + Intergenic
1027187365 7:75980394-75980416 GGGGTCTCCCTCACCGTAGGTGG - Exonic
1032782710 7:135176952-135176974 CTGGTCTCTATGAAAGTGGGAGG + Intergenic
1033546079 7:142401369-142401391 CTGGTCTCCCTTGCAGTTGGAGG + Intergenic
1034290475 7:149927152-149927174 TTGGTCTCCCTGGGAGTGGGTGG - Intergenic
1034660598 7:152765689-152765711 TTGGTCTCCCTGGGAGTGGGTGG + Intronic
1034810625 7:154128826-154128848 GTCTTCTCCCTGACCCTGGGAGG + Intronic
1035418707 7:158709670-158709692 CTGGTGTCCCCGACAGTGAGGGG + Intergenic
1036632632 8:10526007-10526029 GTGGTCCCCCTCCAAGTGGGAGG - Intronic
1040933396 8:52758684-52758706 GTGCTCTCACTCACAGTGGGGGG + Intergenic
1043815369 8:84794605-84794627 GTGGACTCCCTTCCAGTGTGAGG + Intronic
1044738076 8:95299514-95299536 GAGGTATCCCTGAGAGTGGAAGG + Intergenic
1048321579 8:133404372-133404394 GTGTTTTGCTTGACAGTGGGTGG + Intergenic
1049302021 8:141876227-141876249 ATGTTCTCCCTGAGAGTAGGCGG - Intergenic
1049671441 8:143871837-143871859 GGGGTCCCCCTGAGAGTGGCAGG + Exonic
1049744652 8:144258144-144258166 CTGGTCTCCCTGGCAGTGGCTGG - Intronic
1051112711 9:13657464-13657486 GTGGTATCCCTGAAGGGGGGTGG + Intergenic
1056457938 9:86781428-86781450 GTGGTCTCCCTGCAGGTGGATGG + Intergenic
1058084436 9:100733200-100733222 TTGGTGTCCCTGGGAGTGGGCGG + Intergenic
1058169424 9:101662266-101662288 GTGTTCACCTTGACAATGGGTGG + Intronic
1058639370 9:107068172-107068194 TTGGTCTCCCTGACTGAGGCAGG + Intergenic
1058995138 9:110292202-110292224 CTGGTTTCCCGGACAGTGCGTGG - Intergenic
1059954343 9:119500246-119500268 GTGGTGTCCCTGACTCTGGAGGG + Intronic
1060229307 9:121814951-121814973 GTGGCCTCCCTGGGCGTGGGGGG + Intergenic
1061276928 9:129574323-129574345 GTTGTCTTCCTGACAGTGGTGGG - Intergenic
1061449671 9:130661285-130661307 ATGTTCTCCCTGAAAGGGGGAGG + Intergenic
1061597902 9:131644197-131644219 CTTTTCTCCCTGACCGTGGGAGG + Intronic
1185997799 X:4972120-4972142 GGGGTCTACTTGACAGTGGAGGG + Intergenic
1186165570 X:6822857-6822879 GGGGTCTACCTGAGAGTGGAGGG - Intergenic
1186415190 X:9377224-9377246 GGGGTCTACCTGAGGGTGGGGGG - Intergenic
1188860029 X:35244802-35244824 GCGGTCACCCTGACACAGGGTGG + Intergenic
1189812653 X:44794825-44794847 TTGGTCTCCCTGGGAGTGGGTGG + Intergenic
1193171030 X:78335913-78335935 GTGGCCTCCATGACTGTGGAGGG - Intergenic
1195557055 X:106238773-106238795 GTGGTCTACATGACAGTGGGGGG + Intergenic
1198428289 X:136541361-136541383 GTTGTCTCCCTCACAGAGTGTGG + Intronic
1199297066 X:146171383-146171405 GTGGGTTCACTGTCAGTGGGAGG - Intergenic
1199606244 X:149582096-149582118 GTGTTCTCAGTGGCAGTGGGTGG - Exonic
1199632877 X:149787272-149787294 GTGTTCTCAGTGGCAGTGGGTGG + Exonic
1201409245 Y:13681999-13682021 GTGGGCTCCCTGAAAGTGATGGG + Intergenic