ID: 985592238

View in Genome Browser
Species Human (GRCh38)
Location 5:771446-771468
Sequence ATGGGGGCAGGGTCTCATGG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985592227_985592238 -3 Left 985592227 5:771426-771448 CCTGGTGGGGGCTGGGCCGCATG No data
Right 985592238 5:771446-771468 ATGGGGGCAGGGTCTCATGGGGG No data
985592214_985592238 27 Left 985592214 5:771396-771418 CCAACCCAGCGGAGGATGCAGGG No data
Right 985592238 5:771446-771468 ATGGGGGCAGGGTCTCATGGGGG No data
985592218_985592238 22 Left 985592218 5:771401-771423 CCAGCGGAGGATGCAGGGGCAGG No data
Right 985592238 5:771446-771468 ATGGGGGCAGGGTCTCATGGGGG No data
985592217_985592238 23 Left 985592217 5:771400-771422 CCCAGCGGAGGATGCAGGGGCAG No data
Right 985592238 5:771446-771468 ATGGGGGCAGGGTCTCATGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985592238 Original CRISPR ATGGGGGCAGGGTCTCATGG GGG Intergenic