ID: 985592426

View in Genome Browser
Species Human (GRCh38)
Location 5:772386-772408
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 170
Summary {0: 2, 1: 0, 2: 1, 3: 22, 4: 145}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985592426_985592432 16 Left 985592426 5:772386-772408 CCGGATCTACTGAAGACAGACAC 0: 2
1: 0
2: 1
3: 22
4: 145
Right 985592432 5:772425-772447 GAGGAAAAATGCTTCGGGCTGGG No data
985592426_985592431 15 Left 985592426 5:772386-772408 CCGGATCTACTGAAGACAGACAC 0: 2
1: 0
2: 1
3: 22
4: 145
Right 985592431 5:772424-772446 TGAGGAAAAATGCTTCGGGCTGG No data
985592426_985592427 -3 Left 985592426 5:772386-772408 CCGGATCTACTGAAGACAGACAC 0: 2
1: 0
2: 1
3: 22
4: 145
Right 985592427 5:772406-772428 CACTGCCTTCAAACGTTCTGAGG No data
985592426_985592430 11 Left 985592426 5:772386-772408 CCGGATCTACTGAAGACAGACAC 0: 2
1: 0
2: 1
3: 22
4: 145
Right 985592430 5:772420-772442 GTTCTGAGGAAAAATGCTTCGGG No data
985592426_985592429 10 Left 985592426 5:772386-772408 CCGGATCTACTGAAGACAGACAC 0: 2
1: 0
2: 1
3: 22
4: 145
Right 985592429 5:772419-772441 CGTTCTGAGGAAAAATGCTTCGG No data
985592426_985592433 22 Left 985592426 5:772386-772408 CCGGATCTACTGAAGACAGACAC 0: 2
1: 0
2: 1
3: 22
4: 145
Right 985592433 5:772431-772453 AAATGCTTCGGGCTGGGACTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985592426 Original CRISPR GTGTCTGTCTTCAGTAGATC CGG (reversed) Intergenic
900081581 1:862566-862588 GTGTCTGTCCTCCCTAGACCTGG + Intergenic
902532343 1:17098587-17098609 CTGTCTGAATTCAGTAAATCAGG - Intronic
903595707 1:24492660-24492682 GTGTGTGTCTTTAGTAGACATGG + Intergenic
904278237 1:29398096-29398118 GTCTCTGTATTCAGTAAATAGGG - Intergenic
904673629 1:32183911-32183933 GTGTATGTCTTTAGTAGAGATGG + Intronic
907357863 1:53891200-53891222 GTGTCTGTCTGCAGTTGATTGGG + Intergenic
913390229 1:118302462-118302484 TTTTCTGTTTTCAGTATATCTGG + Intergenic
914433146 1:147637877-147637899 TTGTATGTCTTCAGTAAATGTGG + Intronic
917578326 1:176348017-176348039 TTGTCTGTCTTCAATAGATAGGG + Intergenic
917625266 1:176839619-176839641 GTGTCAGTCTTCAGTGCACCAGG + Intronic
918191017 1:182174701-182174723 ATGTCTCTCTTCTGTATATCAGG + Intergenic
919959956 1:202457048-202457070 GTGTCTATCTTCAATACAGCTGG - Intronic
921959329 1:221018174-221018196 GTGTGTGTTTTCAGTAGAGATGG + Intergenic
923354022 1:233136123-233136145 GTGTCTGTCTTCAGAAAGCCAGG - Intronic
1065311204 10:24417316-24417338 GTTGCCTTCTTCAGTAGATCTGG + Intronic
1068649119 10:59501832-59501854 GTGGCAGTCTTCAGAAGACCTGG - Intergenic
1069485524 10:68820310-68820332 GTGTGTGTTTTTAGTAGATATGG + Intergenic
1072474661 10:95748571-95748593 GTGTGTGTCTCCAGCAGATAAGG + Intronic
1077351078 11:2093437-2093459 GGGTCTGTCATCAGCAGGTCAGG - Intergenic
1078397275 11:10992282-10992304 GTGTGTGTCTTCAGTAGAGACGG + Intergenic
1079334454 11:19559045-19559067 GTGTCTCTCTTCCTTAAATCTGG - Intronic
1080833338 11:35916906-35916928 GAGTTTTTCTTCAGTAGATCAGG + Intergenic
1081569212 11:44279203-44279225 ATGTCTGTCTCCTGTAGGTCTGG + Intronic
1083325672 11:61871866-61871888 CTGTCTGACTTGAGTGGATCCGG + Intergenic
1084631762 11:70356808-70356830 TTTTCTCTCTTCCGTAGATCGGG + Intronic
1085028684 11:73256721-73256743 GTGTGTGTTTTCAGTAGAGACGG + Intergenic
1089938988 11:122395663-122395685 GTGACTGTCTTCTGTAGAACAGG + Intergenic
1092613609 12:10196627-10196649 GTGTGTGTTTTCAGTAGAGATGG + Intergenic
1093874000 12:24327762-24327784 GTGTGTGTTTTTAGTAGATATGG + Intergenic
1104899773 12:132182551-132182573 GTGTCTGTCCTCAGATGAACAGG + Intergenic
1106293221 13:28385026-28385048 CTTTCTTTCTTCACTAGATCAGG - Exonic
1111003043 13:82210309-82210331 GTCTCTTTCTTCAGTTGTTCTGG - Intergenic
1111381607 13:87460939-87460961 TTGTCTGTCTTCATTACAGCTGG + Intergenic
1111639732 13:90952537-90952559 GTGTCTGTCTTAAACAGGTCTGG - Intergenic
1112119125 13:96390590-96390612 GTGTCTGTCTTCATCTGCTCTGG - Intronic
1112161179 13:96869611-96869633 GTGTCTGTTTTCAGTTGTTCTGG + Intergenic
1112832177 13:103466707-103466729 CTTTATGTCTTCATTAGATCAGG + Intergenic
1117051535 14:51865256-51865278 GTGCCTGTCTTTACTAGATCTGG + Intronic
1123817192 15:23991979-23992001 GGGACTCTCTTCAGTGGATCTGG + Intergenic
1124237807 15:28004908-28004930 TTGTCTGTCATCAAAAGATCGGG - Intronic
1124390684 15:29254061-29254083 GGGTCTTTCTTCATTAGATTTGG - Intronic
1126777250 15:52111159-52111181 GTGTGTGTTTTCAGTAGAGATGG - Intronic
1126856619 15:52845526-52845548 GTGTGTGTTGTCAGGAGATCTGG + Intergenic
1127213748 15:56802341-56802363 TCATCTGTCTTCAGTAGATGTGG + Intronic
1128408760 15:67371229-67371251 GTGTCTGTTTTCAGTAGAATAGG + Intronic
1132562171 16:600879-600901 GTCTCTGTCTTCTGAAGAGCTGG + Intronic
1132771450 16:1565765-1565787 TCGTCTGTCTTCACTATATCTGG - Intronic
1133895174 16:9920354-9920376 GTGTTTGTCTTCAGCCGATGAGG - Intronic
1137366215 16:47862033-47862055 GTGTCTGCCTTCGGGAGCTCTGG - Intergenic
1140276434 16:73512943-73512965 GTGGCTGACCTCTGTAGATCAGG + Intergenic
1143824956 17:9597944-9597966 GTGTTTGTTTTCAGTAGAGTGGG + Intronic
1144158744 17:12535806-12535828 GTGTGTGTTTTCAGTAGAGATGG - Intergenic
1145801626 17:27689882-27689904 GTGTCTGTCTTTATTTGATATGG + Intergenic
1147551460 17:41445604-41445626 GTATCTGCATTCAGTAGGTCTGG - Intergenic
1147854115 17:43465722-43465744 GTGTCTGTCTTCAGAAATTCTGG - Intergenic
1148523016 17:48300110-48300132 GTTTCTGGCTTCACTAGTTCAGG + Intronic
1149003533 17:51781033-51781055 GTGTCTATCATAAGTAGTTCAGG + Intronic
1151077667 17:71292894-71292916 GTGTCTGTCTTCTCTAGCTATGG + Intergenic
1152341141 17:79725785-79725807 GTGTGTGTTTTCAGTAGAGACGG - Intergenic
1152606115 17:81291309-81291331 GTGTGTGTTTTCAGTAGAGGTGG - Intronic
1154135601 18:11775110-11775132 AAGGCTGTCTTCAGTAAATCAGG - Intronic
1156505148 18:37585974-37585996 GTGTCTGGCTTCATCAGTTCAGG + Intergenic
1157089386 18:44618301-44618323 GTGTATGTCTTCAATAAATGGGG + Intergenic
1158455441 18:57602906-57602928 GTGTCTGTCATCAGTCTCTCAGG + Exonic
1162228425 19:9244095-9244117 CTGTCTGTCTTTATTTGATCAGG + Intergenic
1167806089 19:51786767-51786789 GTGACTCTCTCCAGGAGATCAGG - Intronic
927268850 2:21183908-21183930 GTGTCTGTTCTCTGTAGAGCAGG - Intergenic
928438362 2:31270864-31270886 CTGCCTGTCTTCCTTAGATCAGG - Intergenic
928520211 2:32081264-32081286 GTGTGTGTTTTCAGTAGAGATGG + Intronic
928843425 2:35638574-35638596 GTGTGTGTTTTCAGTAGAGACGG + Intergenic
935159040 2:100513025-100513047 GACTCTGATTTCAGTAGATCTGG - Intergenic
937295754 2:120808877-120808899 GTTTGTGTCTTCAGTGGCTCGGG + Intronic
937858122 2:126687358-126687380 GTGTTTTTCTTCAGTAGGTCTGG + Intronic
939853775 2:147331978-147332000 GTGTGTGTATTCAGGAAATCAGG - Intergenic
941454557 2:165700026-165700048 ATGTCTGTCTTCAGTGGGTGAGG + Intergenic
944835671 2:203576871-203576893 GTGGATGTCTGGAGTAGATCAGG + Intergenic
944958328 2:204838383-204838405 GTGTGTGTCTTTAGTAGAGACGG + Intronic
948021043 2:234733512-234733534 GTATTTGACTTCATTAGATCAGG + Intergenic
948647002 2:239411645-239411667 GTGTCTGTCTTCAGTAGGACAGG + Intergenic
1169198538 20:3696559-3696581 GTGTCAGTCTTCTGAAGATATGG - Intronic
1173701261 20:45073925-45073947 CTGTCTGACTTCTGTAGATGGGG + Intronic
1175644825 20:60662114-60662136 GTGTCTCTCTTCTGTAGATGAGG - Intergenic
1176065003 20:63189989-63190011 GTGTCTGTCTTCACTAGCTGGGG - Intergenic
1178819885 21:35965443-35965465 GTGTCTGTCTTCTGTAGGCAGGG - Intronic
1180118413 21:45727342-45727364 GTGTGTGTTTTCAGGATATCTGG + Intronic
1180677912 22:17601056-17601078 GTGGCTATCAACAGTAGATCTGG + Intronic
1180928767 22:19574479-19574501 GTGTCTGACTTGGGTGGATCTGG + Intergenic
1184357612 22:43992983-43993005 GTTACTGTCTTCAGCAGACCAGG + Intronic
1184457251 22:44618254-44618276 GTGTGTGGCTTGAGTACATCTGG - Intergenic
1184731441 22:46373167-46373189 GTGTCTGTCCTCAGCTGAGCAGG + Intronic
1185141113 22:49101865-49101887 GTCTCTGCCTTCAGCAGGTCAGG + Intergenic
952734750 3:36677835-36677857 GTGTCTGTCTCCAGTACTGCAGG - Intergenic
957520081 3:81308071-81308093 GTGTTTGTATTCAGTTGATCGGG + Intergenic
959578798 3:107963319-107963341 GTGGCTGACCTCTGTAGATCAGG - Intergenic
959964780 3:112340888-112340910 CTTTCTGTCTTCAGGTGATCAGG + Exonic
961008963 3:123423590-123423612 TTGTCTGTCCTCAGCAGATTGGG - Intronic
962020775 3:131499281-131499303 GTCTCTGTCCACAGTAGAACAGG - Intronic
964372557 3:156016263-156016285 GTGTCTATCTGCAGTAGATTTGG + Intergenic
964952311 3:162311187-162311209 GTGTGTGTTTTCAGTAGAGATGG + Intergenic
966567176 3:181396429-181396451 CTGACTGACTACAGTAGATCGGG + Intergenic
966791671 3:183676777-183676799 TTCTCTCTCTTCAGTAGACCAGG + Intronic
972314949 4:37917545-37917567 GTGTCTGTCCACAGTAGATGGGG + Intronic
972600147 4:40564977-40564999 GTGTGTGTCTTGAATAGGTCCGG + Intronic
975055033 4:69919407-69919429 GTGTCTATCTACAGTCCATCAGG + Intergenic
977980734 4:103318470-103318492 GTGTCTGTCTTCAGTACCGCAGG + Intergenic
979847831 4:125538848-125538870 GTGTCTGTCTACAGTACCACAGG - Intergenic
980572900 4:134645763-134645785 GTTTCTCTCTTCAATAGATTAGG + Intergenic
984270428 4:177542613-177542635 GTGTGTGTCTTTAGTAGAGACGG - Intergenic
985380649 4:189391332-189391354 GAGTCTGGCTTCAGTTGACCAGG + Intergenic
985577495 5:680290-680312 GTGTCTGTCTTCAGTAGATCCGG - Intronic
985592426 5:772386-772408 GTGTCTGTCTTCAGTAGATCCGG - Intergenic
987921097 5:24282994-24283016 GTGTCTAACTTCAGTACTTCCGG + Intergenic
988301672 5:29437704-29437726 ATTTCTGTCTTCAGCAGTTCAGG - Intergenic
988810245 5:34777804-34777826 TTCTCTGTCTTCATGAGATCAGG - Intronic
990682488 5:58260837-58260859 GTGTGTGTCTTTAGTAGAGACGG - Intergenic
994056670 5:95424267-95424289 CTGTCTGTCTTCTGTCTATCTGG - Intronic
996425256 5:123306975-123306997 GTTCCTGATTTCAGTAGATCTGG + Intergenic
998261147 5:140632812-140632834 GTGTGTGTCTGCAGTAGAGGTGG - Exonic
998726212 5:145017655-145017677 GTTTCTTTCTACATTAGATCAGG + Intergenic
1001881999 5:175252578-175252600 ATGTATGTCTTCAGTGGACCAGG - Intergenic
1004206171 6:13593350-13593372 GTGTCTGTCTTTTGTTCATCAGG + Intronic
1010392386 6:75352555-75352577 GTGTCAGTCTTCAGTTGGTTTGG + Intronic
1010794985 6:80107871-80107893 GTGTCTCTCTTCAGAATATCAGG + Intronic
1010806988 6:80248979-80249001 GTGTATGTCTTCAGTGTATTTGG + Intronic
1012302049 6:97601902-97601924 GTGTGTGTTTTCAGTAGATACGG + Intergenic
1012367321 6:98458049-98458071 GGGTCTGCCTTCAGTACTTCAGG - Intergenic
1012916639 6:105178549-105178571 GTGTGTGTCTTCAGGAGTTTGGG - Intronic
1015656703 6:135526586-135526608 GTTTCTGTCTTTTGTTGATCTGG + Intergenic
1016431682 6:143991862-143991884 GTGTCTGTTTGCAGGAGATGTGG + Intronic
1017367598 6:153663165-153663187 GTGTCTGTCTACAGTAGTCCAGG + Intergenic
1017655395 6:156623022-156623044 GTGTCTGTATTCACAAGAGCAGG + Intergenic
1018029213 6:159828874-159828896 GTGTTTTTCTTTAGTAGATACGG - Intergenic
1020769499 7:12370391-12370413 GTATCCGTCTTCCGAAGATCTGG - Exonic
1023903878 7:44507413-44507435 ATTTCTGACTTCAGTACATCAGG + Intergenic
1025826968 7:65018496-65018518 GTGTGTGTTTTTAGTAGATACGG - Intergenic
1025941535 7:66079087-66079109 GTGTGTGTTTTCAGTAGAGACGG + Intronic
1028069577 7:86434828-86434850 GTGGCTGTCTTCTGTAGAGCAGG + Intergenic
1030247891 7:107405527-107405549 GTGTCTGTCTTCCTCAGACCTGG - Intronic
1030358863 7:108573894-108573916 GTGCCTTTCTACAGTAGAACTGG + Exonic
1030507853 7:110446728-110446750 GGGTCAGTCTTAAGCAGATCTGG + Intergenic
1031467703 7:122133833-122133855 GTGTCTGTTTTCATAAGAGCGGG - Intronic
1031977881 7:128105217-128105239 GAGTTTCTGTTCAGTAGATCTGG - Intergenic
1032231438 7:130078195-130078217 GTGTGTGTTTTCAGTAGAGACGG - Intronic
1034989794 7:155541203-155541225 GTCTCTGTCTTCAGAACAGCGGG - Intergenic
1035523686 8:294984-295006 GTGTCTGTCCTCCCTAGACCTGG - Intergenic
1035971426 8:4253635-4253657 GTGTGTCTATTAAGTAGATCTGG - Intronic
1040446261 8:47497802-47497824 GTATCTGTCTACAGTCCATCTGG + Intronic
1041827359 8:62110861-62110883 GTGTCTGTCTTCACTCTCTCAGG - Intergenic
1043581301 8:81719296-81719318 GTGTGTGTTTTCAGTAGAGATGG - Intronic
1044618658 8:94167481-94167503 ATGTATGTCTACAGTAGAGCTGG + Intronic
1045852398 8:106718329-106718351 CTGTCTGTCTTCAATAGGACTGG - Intronic
1045999019 8:108397205-108397227 GTGTCTGCCTCCTGTAGCTCTGG + Intronic
1046223702 8:111248980-111249002 GAGTCTGTCTACAGTGGATTTGG + Intergenic
1048558584 8:135507420-135507442 CAGTCTGTTTTCAGTAGATTTGG + Intronic
1050168927 9:2795493-2795515 GTGTGTGTTTTCAGAAGATCTGG - Intronic
1051168645 9:14294974-14294996 GTGTTTGACTTCAGTAGCTCTGG - Intronic
1051269098 9:15337517-15337539 GTTTCTGGCTTCAGCAGCTCAGG + Intergenic
1051856786 9:21576652-21576674 GTCTCTCTCTTCAGTGAATCTGG + Intergenic
1053369959 9:37552509-37552531 GTGTGTGTTTTCAGTAGAGACGG - Intronic
1055057299 9:72035678-72035700 GTGTCTGTCCTCTGTAGGTTAGG + Intergenic
1056563507 9:87753736-87753758 GTGTGTGTCTTTAGTAGAATTGG + Intergenic
1059019029 9:110553333-110553355 GTTTCTGTCATCAGGAGAACTGG + Intronic
1186453440 X:9692096-9692118 GTGTTTTTATTCTGTAGATCTGG + Exonic
1187230703 X:17419975-17419997 GTGACTTTCTTCAGCAAATCTGG + Intronic
1194585523 X:95729006-95729028 GTGCCTGTTTTCACTTGATCAGG + Intergenic
1195155866 X:102124540-102124562 GTGTATGTCTTGTGTATATCTGG - Intergenic
1195600965 X:106748014-106748036 CTGTCTGTCTTCTGTATAACCGG + Intronic
1195770928 X:108350436-108350458 GTTTCTGACTTTAGTAGGTCTGG - Intronic
1200764707 Y:7070703-7070725 GTGTTTTTATTCTGTAGATCTGG + Exonic
1202575726 Y:26322602-26322624 GTGTCTATCTTCAATATAGCTGG + Intergenic