ID: 985593075

View in Genome Browser
Species Human (GRCh38)
Location 5:775329-775351
Sequence CAGTCTCCTCATCCTTGAAG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985593071_985593075 3 Left 985593071 5:775303-775325 CCATGGTGGGACAGTTGCTTGCG No data
Right 985593075 5:775329-775351 CAGTCTCCTCATCCTTGAAGGGG No data
985593070_985593075 4 Left 985593070 5:775302-775324 CCCATGGTGGGACAGTTGCTTGC No data
Right 985593075 5:775329-775351 CAGTCTCCTCATCCTTGAAGGGG No data
985593062_985593075 29 Left 985593062 5:775277-775299 CCCAGAGCTCGCTCCCAGGCAGG No data
Right 985593075 5:775329-775351 CAGTCTCCTCATCCTTGAAGGGG No data
985593061_985593075 30 Left 985593061 5:775276-775298 CCCCAGAGCTCGCTCCCAGGCAG No data
Right 985593075 5:775329-775351 CAGTCTCCTCATCCTTGAAGGGG No data
985593069_985593075 15 Left 985593069 5:775291-775313 CCAGGCAGGTGCCCATGGTGGGA No data
Right 985593075 5:775329-775351 CAGTCTCCTCATCCTTGAAGGGG No data
985593064_985593075 28 Left 985593064 5:775278-775300 CCAGAGCTCGCTCCCAGGCAGGT No data
Right 985593075 5:775329-775351 CAGTCTCCTCATCCTTGAAGGGG No data
985593067_985593075 16 Left 985593067 5:775290-775312 CCCAGGCAGGTGCCCATGGTGGG No data
Right 985593075 5:775329-775351 CAGTCTCCTCATCCTTGAAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985593075 Original CRISPR CAGTCTCCTCATCCTTGAAG GGG Intergenic
No off target data available for this crispr