ID: 985594459

View in Genome Browser
Species Human (GRCh38)
Location 5:781903-781925
Sequence CACCCAGATGATCTGCCACC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 239
Summary {0: 2, 1: 0, 2: 1, 3: 18, 4: 218}

Found 16 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985594459_985594478 28 Left 985594459 5:781903-781925 CCAGGTGGCAGATCATCTGGGTG 0: 2
1: 0
2: 1
3: 18
4: 218
Right 985594478 5:781954-781976 GGTGGAGGATCATCTGGGTGGGG No data
985594459_985594479 29 Left 985594459 5:781903-781925 CCAGGTGGCAGATCATCTGGGTG 0: 2
1: 0
2: 1
3: 18
4: 218
Right 985594479 5:781955-781977 GTGGAGGATCATCTGGGTGGGGG No data
985594459_985594473 13 Left 985594459 5:781903-781925 CCAGGTGGCAGATCATCTGGGTG 0: 2
1: 0
2: 1
3: 18
4: 218
Right 985594473 5:781939-781961 GTGGGGGATCATCTGGGTGGAGG No data
985594459_985594470 6 Left 985594459 5:781903-781925 CCAGGTGGCAGATCATCTGGGTG 0: 2
1: 0
2: 1
3: 18
4: 218
Right 985594470 5:781932-781954 CATCTGGGTGGGGGATCATCTGG No data
985594459_985594475 23 Left 985594459 5:781903-781925 CCAGGTGGCAGATCATCTGGGTG 0: 2
1: 0
2: 1
3: 18
4: 218
Right 985594475 5:781949-781971 ATCTGGGTGGAGGATCATCTGGG No data
985594459_985594476 26 Left 985594459 5:781903-781925 CCAGGTGGCAGATCATCTGGGTG 0: 2
1: 0
2: 1
3: 18
4: 218
Right 985594476 5:781952-781974 TGGGTGGAGGATCATCTGGGTGG No data
985594459_985594467 -5 Left 985594459 5:781903-781925 CCAGGTGGCAGATCATCTGGGTG 0: 2
1: 0
2: 1
3: 18
4: 218
Right 985594467 5:781921-781943 GGGTGGGGGATCATCTGGGTGGG No data
985594459_985594465 -9 Left 985594459 5:781903-781925 CCAGGTGGCAGATCATCTGGGTG 0: 2
1: 0
2: 1
3: 18
4: 218
Right 985594465 5:781917-781939 ATCTGGGTGGGGGATCATCTGGG No data
985594459_985594468 -4 Left 985594459 5:781903-781925 CCAGGTGGCAGATCATCTGGGTG 0: 2
1: 0
2: 1
3: 18
4: 218
Right 985594468 5:781922-781944 GGTGGGGGATCATCTGGGTGGGG No data
985594459_985594469 -3 Left 985594459 5:781903-781925 CCAGGTGGCAGATCATCTGGGTG 0: 2
1: 0
2: 1
3: 18
4: 218
Right 985594469 5:781923-781945 GTGGGGGATCATCTGGGTGGGGG No data
985594459_985594464 -10 Left 985594459 5:781903-781925 CCAGGTGGCAGATCATCTGGGTG 0: 2
1: 0
2: 1
3: 18
4: 218
Right 985594464 5:781916-781938 CATCTGGGTGGGGGATCATCTGG No data
985594459_985594466 -6 Left 985594459 5:781903-781925 CCAGGTGGCAGATCATCTGGGTG 0: 2
1: 0
2: 1
3: 18
4: 218
Right 985594466 5:781920-781942 TGGGTGGGGGATCATCTGGGTGG No data
985594459_985594471 7 Left 985594459 5:781903-781925 CCAGGTGGCAGATCATCTGGGTG 0: 2
1: 0
2: 1
3: 18
4: 218
Right 985594471 5:781933-781955 ATCTGGGTGGGGGATCATCTGGG No data
985594459_985594472 10 Left 985594459 5:781903-781925 CCAGGTGGCAGATCATCTGGGTG 0: 2
1: 0
2: 1
3: 18
4: 218
Right 985594472 5:781936-781958 TGGGTGGGGGATCATCTGGGTGG No data
985594459_985594474 22 Left 985594459 5:781903-781925 CCAGGTGGCAGATCATCTGGGTG 0: 2
1: 0
2: 1
3: 18
4: 218
Right 985594474 5:781948-781970 CATCTGGGTGGAGGATCATCTGG No data
985594459_985594477 27 Left 985594459 5:781903-781925 CCAGGTGGCAGATCATCTGGGTG 0: 2
1: 0
2: 1
3: 18
4: 218
Right 985594477 5:781953-781975 GGGTGGAGGATCATCTGGGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985594459 Original CRISPR CACCCAGATGATCTGCCACC TGG (reversed) Intergenic
900695959 1:4010573-4010595 CTCCCAGGTGATCTGACTCCTGG + Intergenic
900950592 1:5856258-5856280 CACCTAGAGGTTCTGCCTCCAGG + Intergenic
901784796 1:11617417-11617439 CTCCGAGATGCTCTGCCAGCTGG + Intergenic
904670421 1:32160747-32160769 CCCCCAAATGACCTGCCACGTGG - Intronic
905583109 1:39097196-39097218 CACCCAGATGTTCAGGCTCCAGG + Intronic
906083058 1:43107299-43107321 CACCCAGTGGATCTCGCACCAGG + Intergenic
910622588 1:89273301-89273323 CACCCAGTGGATCTTGCACCGGG + Intergenic
913610349 1:120504484-120504506 CACCAAGATGCTCTTCCAGCAGG + Intergenic
913984452 1:143552350-143552372 CACCAAGATGCTCTTCCACCAGG - Intergenic
914580841 1:149017755-149017777 CACCAAGATGCTCTTCCAGCAGG - Exonic
915242250 1:154532025-154532047 CACCCAGTGGATCTCGCACCGGG + Intronic
915666027 1:157446219-157446241 CACCCAGTGGATCTCCCACGGGG + Intergenic
919921628 1:202169608-202169630 CTCCCAGATTGGCTGCCACCCGG - Intergenic
921085989 1:211793083-211793105 CACACTGATGATGTGCCTCCAGG - Exonic
922168928 1:223138903-223138925 CACGCAGAAGACCTGCCCCCAGG - Intronic
924318001 1:242818418-242818440 CACTCAGTTAATCTGCCACCAGG - Intergenic
1062782627 10:229479-229501 CCCACAGATTATCTGCCAACTGG - Intronic
1063143413 10:3275425-3275447 GGCCCAGATGATCTGCCAGCAGG - Intergenic
1064301790 10:14129552-14129574 CACCCAGCAGATGAGCCACCTGG - Intronic
1065981494 10:30902747-30902769 CACCCAGTGGATCTCCCACCGGG + Intronic
1066425115 10:35301164-35301186 AACTCAGATAATCTGGCACCAGG + Intronic
1071337048 10:84609102-84609124 AACCCAGCTCCTCTGCCACCAGG - Intergenic
1071963706 10:90832111-90832133 CACCCAGTGGATCTGGCACTGGG + Intronic
1073187774 10:101626988-101627010 GGCCCTGATCATCTGCCACCAGG + Intronic
1074732541 10:116393776-116393798 CACCCAGTGGATCTTGCACCGGG - Intergenic
1075594295 10:123716829-123716851 TAGCCATATGATCTGTCACCTGG - Intronic
1077959023 11:7052883-7052905 AAACCAGAGGTTCTGCCACCTGG + Intronic
1078512301 11:11994510-11994532 TTCCCAGAGGATCTGCCTCCTGG - Intronic
1078977525 11:16495426-16495448 CACCCAGATGATGTGGCACTTGG - Intronic
1081580968 11:44351487-44351509 CATCCAGGTGCTCAGCCACCTGG - Intergenic
1085941203 11:81208039-81208061 CACCCAGTGGATCTGGCACCTGG - Intergenic
1086087649 11:82971101-82971123 CACCCAGTGGATCTGCCACCGGG - Intergenic
1087214115 11:95476704-95476726 CACCCACATGACCTGACACGTGG - Intergenic
1087407235 11:97745551-97745573 CACCCAGTGGATCTCCCACCAGG + Intergenic
1087479422 11:98680668-98680690 CAACCAGATGGTCTGCCTCAGGG + Intergenic
1087979968 11:104599827-104599849 CACCCACATCATATGCCATCAGG + Intergenic
1089582487 11:119489999-119490021 CAACCAGATAATCTACCAACCGG + Intergenic
1089731773 11:120523785-120523807 CACCCTGATCATCTCCCAGCTGG - Intronic
1092190695 12:6518051-6518073 CACACAGATATGCTGCCACCAGG + Intronic
1092732536 12:11547672-11547694 CACCCAGTGGATCCCCCACCGGG - Intergenic
1093172420 12:15875007-15875029 CACCCAGTGGATCTCGCACCGGG - Intronic
1093580096 12:20777347-20777369 CACCCAGTGGATCTTGCACCGGG + Intergenic
1094223670 12:28022904-28022926 CACCCAAATAATCTGCATCCAGG - Intergenic
1095444882 12:42273644-42273666 CACCCAGTGGATCTTGCACCAGG + Intronic
1096255241 12:50058350-50058372 CACCCAGATGGGCTGACCCCGGG - Intronic
1097664121 12:62461211-62461233 CACCCAGTGGATCTCGCACCAGG + Intergenic
1102518062 12:113463354-113463376 CACCGACATGATCTCGCACCCGG - Exonic
1103206923 12:119136982-119137004 CTCCCAGATGAACTCCTACCAGG + Intronic
1103420025 12:120773261-120773283 CAGCCAGATGAGCTGCTCCCTGG - Intronic
1103439140 12:120950262-120950284 CACCCAGTGGATCTCCCACTGGG + Intergenic
1104140526 12:125983125-125983147 CATCCAGGTCATCTGTCACCAGG + Intergenic
1105762606 13:23527999-23528021 CAACCAGATGATCCGACAACAGG + Intergenic
1106353303 13:28955755-28955777 CACCCACTTGACCTGGCACCAGG + Intronic
1108533521 13:51348474-51348496 CACACAGGTGGTCTGCCTCCAGG + Intronic
1110751321 13:79119573-79119595 CACCCAGTGGATCCTCCACCGGG + Intergenic
1111006722 13:82258383-82258405 CACCCAGCGGATCTCGCACCGGG - Intergenic
1111627270 13:90805189-90805211 ATCCCAGATGATATGTCACCAGG + Intergenic
1112303572 13:98252541-98252563 AAGCCAGACCATCTGCCACCAGG - Intronic
1112400031 13:99068349-99068371 ACCTCAGGTGATCTGCCACCTGG - Intronic
1112486953 13:99828492-99828514 CACCCAAATAATTTGCCACTAGG - Intronic
1114559801 14:23581182-23581204 CACCCAGTGGATCCCCCACCAGG - Intergenic
1116250954 14:42482321-42482343 CACCCAGTGGATCCGGCACCGGG + Intergenic
1116657060 14:47665985-47666007 CACCCAGTGGATCTCGCACCAGG - Intronic
1118004421 14:61552968-61552990 CACCAAGATAAACTGCCAGCTGG + Intronic
1120704677 14:87734666-87734688 CACCCAGTGGATCTCGCACCAGG + Intergenic
1121350583 14:93170050-93170072 CACCCAGCGGAACTGGCACCAGG + Intergenic
1121831111 14:97053263-97053285 CACCCAGACCATCTGCCATGGGG - Intergenic
1122396434 14:101435990-101436012 CACCCGGATCAACTGCCACCTGG + Intergenic
1122542662 14:102506763-102506785 CACCCAGAAAACCTGCCACTTGG + Exonic
1123030520 14:105449191-105449213 GGCCCAGATGATCTTCAACCGGG + Intronic
1124387778 15:29224730-29224752 CACCCAGTGGATCCGGCACCGGG + Intronic
1125501912 15:40245175-40245197 CACCCAGAGGATCCCTCACCAGG - Intronic
1127211674 15:56780071-56780093 CACCCAGTGGATCTCCCATCGGG - Intronic
1129158187 15:73732121-73732143 CACCCAGTGGATCCCCCACCGGG + Intergenic
1129687241 15:77693766-77693788 CATCCAGCTGATCAGCCAGCTGG - Intronic
1133612902 16:7450018-7450040 CACCCAGAAAAGCTGCCACAAGG - Intronic
1137464283 16:48693927-48693949 CACCCAGCCCATCTGCTACCTGG - Intergenic
1138202605 16:55101266-55101288 TAACCAGAGGATCTGCCCCCTGG + Intergenic
1138340673 16:56287090-56287112 CACCCATGTGTCCTGCCACCTGG - Intronic
1139349307 16:66325306-66325328 AAGCCAGATGATCTGGGACCAGG - Intergenic
1139425942 16:66880152-66880174 CACCCTGATGTCCAGCCACCTGG - Intronic
1142477000 17:194481-194503 CACCCAGCTGCCCTGTCACCCGG - Intergenic
1143794061 17:9322149-9322171 TACCCAGATGACATGCCACAGGG + Intronic
1146740381 17:35278849-35278871 CACCCAGTGGATCCCCCACCAGG + Intergenic
1149754049 17:59172944-59172966 CACCCAGTGGATCTCGCACCGGG - Intronic
1150073193 17:62169933-62169955 CACCCTGATGCTGTGCCACTAGG + Intergenic
1151568129 17:74911507-74911529 CAACCAGATGATCTAACAGCAGG + Intergenic
1152176837 17:78793434-78793456 CACCCAGATGATCTTCTCCAAGG + Intronic
1154208773 18:12361136-12361158 ACCTCAGGTGATCTGCCACCTGG - Intronic
1155611635 18:27673824-27673846 CACCCAGTGGATCTCGCACCAGG + Intergenic
1156079571 18:33316582-33316604 CACCCAGTGGATCTCCCACTGGG - Intronic
1156182795 18:34625398-34625420 CAGGCAGATTATCTGACACCAGG - Intronic
1156494648 18:37517870-37517892 AACACAGGTGATCTGCCACGGGG - Intronic
1159567939 18:70076078-70076100 CACACACATGAACTGCCACCAGG + Intronic
1162897889 19:13776344-13776366 CACCCACATCATTTCCCACCGGG + Intronic
1163193983 19:15701751-15701773 CACCCAGTTGGCCTGCCACAAGG - Intergenic
1163414163 19:17175689-17175711 CACCCAGAAGAGCTGCCAAGAGG + Exonic
1164511610 19:28901838-28901860 AACCCAGAACATCTGGCACCAGG - Intergenic
1164620832 19:29695183-29695205 CACCCAGACTACCTGACACCCGG + Intergenic
1164621453 19:29698031-29698053 CACCCAGACACTCTGTCACCTGG + Intergenic
1164650227 19:29886081-29886103 GACCCAGCTGATCTGCAGCCAGG + Intergenic
1164816663 19:31209404-31209426 AACCCAGATGATCTGAATCCTGG - Intergenic
925088615 2:1134661-1134683 CACCCAGTGGATCCCCCACCGGG + Intronic
925098899 2:1229534-1229556 CACCCAGTGGATCCGGCACCGGG + Intronic
928255001 2:29714595-29714617 CACCCTGACGACCTCCCACCAGG + Intronic
929330486 2:40675306-40675328 CAGCCAGATGATCTAACAACAGG + Intergenic
931633907 2:64325157-64325179 CCTCCAGACGATCTGCCATCTGG - Intergenic
932178355 2:69622465-69622487 CACCCAGTGGATCTTGCACCAGG - Intronic
933060765 2:77734715-77734737 CACCCAGTGGATCCGGCACCGGG + Intergenic
939723298 2:145681788-145681810 AACCCAAATGATCTACCAACTGG - Intergenic
939924473 2:148155627-148155649 CACCCAGCTGGTCTGCTGCCAGG + Intronic
940114368 2:150192217-150192239 CACCCAGAGGAAATCCCACCAGG + Intergenic
941600050 2:167531409-167531431 AACCCAAATGATCAACCACCAGG + Intergenic
944055249 2:195516051-195516073 CACCCAGTGGATCTCGCACCAGG - Intergenic
945045006 2:205774153-205774175 CACCAAGAGGATCTGCTGCCTGG - Intronic
945987920 2:216370155-216370177 CCCCCAGATGTTGCGCCACCAGG - Exonic
946785572 2:223239975-223239997 CACCCAGGTTATCTTCCACCAGG - Intergenic
947103871 2:226648436-226648458 CACCCAGTGGATCTCACACCTGG - Intergenic
947937949 2:234024213-234024235 CACCCAGTGGATCTCACACCAGG + Intergenic
948224490 2:236298593-236298615 CCCCCAGAAGATATGCCCCCTGG + Intergenic
948869358 2:240790488-240790510 CACCCTGGGGACCTGCCACCAGG + Intronic
1169203762 20:3729000-3729022 CACCCAGCTGAACTTCCTCCAGG - Intergenic
1172974898 20:38899017-38899039 CCCTCAGATGATCAGCCCCCTGG - Intronic
1173231480 20:41202282-41202304 GACCCAGATGAGCTCCCAGCAGG - Exonic
1173532196 20:43778614-43778636 CAGCATGCTGATCTGCCACCAGG - Intergenic
1174179812 20:48667780-48667802 CACCAAGATGACATCCCACCTGG - Intronic
1174274919 20:49396686-49396708 CACCCCCATGATCTGGCCCCAGG - Intronic
1175923133 20:62459211-62459233 CCCCCAGGTGCTCAGCCACCAGG - Intergenic
1177182315 21:17757523-17757545 CACCCAGTGGATCTGGCACTGGG + Intergenic
1179827417 21:43973905-43973927 CACCCTGAGCATCTGCCTCCTGG - Intronic
1183785084 22:40024539-40024561 CTCCCAGAGCAGCTGCCACCTGG + Intronic
1185227127 22:49659567-49659589 CAACCAGATGGTCGGCCACCAGG + Intergenic
951734858 3:25852134-25852156 CACCCAGTGGATCTCACACCGGG - Intergenic
953307526 3:41844104-41844126 CACCCAGTGGATCCCCCACCGGG + Intronic
954980127 3:54738240-54738262 AAGCCAGATTATCTGCCACTTGG - Intronic
955742243 3:62103680-62103702 GACACAGATACTCTGCCACCTGG - Intronic
956196936 3:66662273-66662295 CACCCACAGCATCTGCCACATGG + Intergenic
956563704 3:70612238-70612260 CACCCAGTGGATCTTGCACCAGG - Intergenic
956666305 3:71645257-71645279 GCCCCAGATGATCTGGCCCCTGG - Intergenic
958022718 3:88016113-88016135 CACCCAGTGGATCCCCCACCGGG - Intergenic
960572601 3:119199748-119199770 CCCCCAGATGATCTGCTGTCAGG + Intronic
961543366 3:127615785-127615807 CACCCACATGCTCTGGCATCAGG - Intronic
962628305 3:137249531-137249553 CAATCAGTTGATCAGCCACCTGG - Intergenic
963939408 3:151085298-151085320 CACCAAGATGCTGGGCCACCTGG - Intergenic
964198216 3:154088396-154088418 CACCCAGTGGATCTCACACCGGG - Intergenic
964375121 3:156041691-156041713 CACTCAGTGGATCTCCCACCGGG - Intronic
965167337 3:165211905-165211927 CACTCAGATCATTTGTCACCTGG + Intergenic
966246000 3:177808885-177808907 CACCCAGTGGATCTTGCACCGGG + Intergenic
967448580 3:189596549-189596571 CGCCCAGTGGATCTCCCACCGGG - Intergenic
968811249 4:2800574-2800596 CCCCCAGGTGAAGTGCCACCTGG - Intronic
969176452 4:5402611-5402633 GACCCAGGTGATGTGCCACCAGG - Intronic
969839919 4:9873672-9873694 TGCCCAGATGACCTGCCAGCTGG + Intronic
971701106 4:29977689-29977711 CACCCCCATGACCTCCCACCAGG - Intergenic
972307108 4:37841577-37841599 AACTCAGATGATCTGGCAACTGG - Intronic
972505711 4:39718449-39718471 CACCCAGTGGATCTCGCACCGGG + Intronic
973699032 4:53518775-53518797 CCCCCAAATAATCAGCCACCAGG - Intronic
975439870 4:74399000-74399022 CACCCAGTGGATCCCCCACCGGG + Intergenic
976518608 4:86000795-86000817 CATCCAGGTGACCAGCCACCTGG - Exonic
976693334 4:87892252-87892274 CAACCAGTTTCTCTGCCACCAGG - Intergenic
978254802 4:106681383-106681405 CACCCAGTGGATCTCACACCAGG + Intergenic
983558762 4:169080952-169080974 TCCCCATATGATCTGCCAGCAGG + Intergenic
984776029 4:183482623-183482645 CACCCAGTGGATCCCCCACCGGG + Intergenic
985579588 5:689780-689802 CACTCAGATGATCCCCCACCCGG - Intronic
985579608 5:689828-689850 CACCTGGATGATCCCCCACCGGG - Intronic
985579613 5:689844-689866 CACCCAGATGATCTGCCACCTGG - Intronic
985594434 5:781839-781861 CACTCAGATGATCCCCCACCCGG - Intergenic
985594454 5:781887-781909 CACCTGGATGATCCCCCACCGGG - Intergenic
985594459 5:781903-781925 CACCCAGATGATCTGCCACCTGG - Intergenic
986298334 5:6457712-6457734 CACAGAGCTGAGCTGCCACCAGG + Intronic
986384432 5:7217799-7217821 CACCCAGAGGAGCTGCAGCCTGG - Intergenic
986993349 5:13578895-13578917 CACCCAGTGGATCCGGCACCGGG - Intergenic
987649452 5:20721250-20721272 AACCCAGATGATTTCCCAGCTGG + Intergenic
990215699 5:53529580-53529602 CATCCAGAAGATCTTCCATCAGG + Intergenic
991215024 5:64150496-64150518 CACCCAGTGGATCTCGCACCAGG - Intergenic
992301108 5:75381326-75381348 CACCAAGCTGATATGACACCAGG + Intronic
994620429 5:102155366-102155388 CACCCAGTGGATCTCCCACAGGG - Intergenic
996987457 5:129584506-129584528 CACCCAGGTGCTCTGTCACAGGG + Intronic
997663474 5:135607743-135607765 CACCAAGATGAGCTTCCACTAGG - Intergenic
999132885 5:149298074-149298096 AACCCAGGTGATCTGGCTCCAGG + Intronic
1001526350 5:172431300-172431322 CATCCAGAAGAGCTGCAACCCGG + Intronic
1003178556 6:3772017-3772039 CACCCAGTGGATCTCGCACCGGG - Intergenic
1003581517 6:7344641-7344663 CACCCAGTGGATCCGGCACCGGG - Intronic
1003671617 6:8164759-8164781 CACCCAGTGGATCTGGCACCGGG - Intergenic
1004499592 6:16198034-16198056 CACCCAGTGGATCTCGCACCGGG + Intergenic
1004906284 6:20239439-20239461 CACCCAGTGGATCCGGCACCGGG - Intergenic
1005042192 6:21609834-21609856 CACCCAGAGGATCCCACACCAGG + Intergenic
1005544261 6:26848520-26848542 AACCCAGATGATTTCCCAGCTGG - Intergenic
1007030125 6:38619579-38619601 CAACCAGATAATCTGTCAACAGG + Intronic
1009015047 6:57890147-57890169 AACCCAGATGATTTCCCAGCTGG - Intergenic
1009471482 6:64031548-64031570 CACCCAGTGGATCTTGCACCGGG - Intronic
1014920994 6:127214524-127214546 CACCCAGTGGATCCGGCACCGGG + Intergenic
1016306785 6:142693267-142693289 CATTCAGATGATCTACCCCCAGG + Intergenic
1016858720 6:148697127-148697149 CACCCAGTAGATCCCCCACCGGG + Intergenic
1021624735 7:22581814-22581836 CACACAGAACATCTCCCACCAGG - Intronic
1022031793 7:26498502-26498524 CACGCAAATGATCCTCCACCAGG - Intergenic
1023139149 7:37083736-37083758 CAGCCAGAAGACCTGCCAGCTGG + Intronic
1023396130 7:39753884-39753906 CACCCAGTGGATCTCGCACCTGG + Intergenic
1024700557 7:51900819-51900841 CACCCAGTGGATCTGGCACTGGG + Intergenic
1027051936 7:75026063-75026085 CACTCAGCTGGCCTGCCACCTGG - Intergenic
1027797736 7:82715096-82715118 ATCCCAGATGACTTGCCACCGGG - Intergenic
1030297187 7:107940850-107940872 CATCCTGATAATGTGCCACCTGG + Intronic
1030599906 7:111581878-111581900 CACCCAGTGGATCTCCCACCAGG + Intergenic
1030678388 7:112408565-112408587 CACAAAGTTGATCTGCTACCTGG - Intergenic
1031137659 7:117902645-117902667 CTCCCAGCTGCTCTGCCACGTGG + Intergenic
1032438932 7:131926845-131926867 AACCCAGAAGACCTACCACCAGG - Intergenic
1033670143 7:143484493-143484515 CACCCAGATTTTCTGCCAGGAGG - Intergenic
1033982437 7:147182048-147182070 CACTGAGATCATCTGCCTCCTGG - Intronic
1036970491 8:13349528-13349550 CAACCAGATCACCAGCCACCAGG + Intronic
1039587684 8:38720222-38720244 CACCCAGTGGATCGGGCACCGGG - Intergenic
1040622152 8:49102937-49102959 CACCCAGTGGATCTCGCACCGGG + Intergenic
1040791081 8:51231027-51231049 CACCCAGTGGATCTCGCACCGGG - Intergenic
1041753436 8:61286594-61286616 CACACAAATTATCTGCCACATGG + Intronic
1042148939 8:65760813-65760835 CACCCAGGTGTTCTGTCAGCAGG + Intronic
1043857233 8:85276452-85276474 CACCCAGTGGATCTCGCACCAGG - Intronic
1048112927 8:131487453-131487475 CACCCAGTGGATCAGGCACCGGG - Intergenic
1048281582 8:133109543-133109565 CACCCAGACGAGCTGCCACTTGG - Intronic
1052146859 9:25060921-25060943 CACCCAGGTGCTCTGTCACAGGG + Intergenic
1054722531 9:68617449-68617471 CACCCAGTGGATCCGGCACCAGG - Intergenic
1056914114 9:90729916-90729938 CACCCAGTGGATCTGGCACAGGG - Intergenic
1057819451 9:98319788-98319810 CAGCCAGATGAGATGCCCCCTGG + Intronic
1058727607 9:107818227-107818249 CACCCAGTGGATCTCACACCGGG - Intergenic
1059713418 9:116890331-116890353 CACGCAGATGATCGGCTGCCTGG + Intronic
1186293283 X:8122033-8122055 CACCCAGTGGATCTGGCACTGGG - Intergenic
1187904087 X:24050117-24050139 CACCCAGTGGATCCGGCACCGGG - Intergenic
1193607222 X:83583537-83583559 CCCCCAGATGATCAGCAACAAGG - Intergenic
1194230225 X:91313250-91313272 CAACCAGATCATCTGAAACCTGG - Intergenic
1194493132 X:94576426-94576448 AGCCCTGATGATCTGCCCCCAGG + Intergenic
1195294808 X:103465334-103465356 CACCCACATGATGAACCACCTGG - Intergenic
1196319460 X:114270496-114270518 CACCCAGTGGATCCGGCACCGGG + Intergenic
1198483528 X:137063489-137063511 CACCTAGGTGCTCTGCCTCCTGG - Intergenic
1198694529 X:139321228-139321250 CACCCAGTGGATCCCCCACCGGG - Intergenic
1199628177 X:149758950-149758972 CACCCAGTGGATCGGGCACCAGG - Intergenic
1199668010 X:150117372-150117394 CACCCACCTAATCTGCCATCAGG + Intergenic
1200147228 X:153932555-153932577 GACCCAGATGATGTGCCCCATGG - Exonic
1201221475 Y:11774928-11774950 CACTCAGTTAATCTGCCACCAGG - Intergenic
1201424323 Y:13831764-13831786 CACCTAGTGGATCTGGCACCAGG - Intergenic
1201487139 Y:14506075-14506097 CACCCAGTTGATCCAGCACCAGG - Intergenic
1201488229 Y:14513238-14513260 CACCCAGTTGATCCAGCACCGGG - Intergenic
1201901038 Y:19046500-19046522 CACCCAGCGGATCTGGCACTGGG + Intergenic