ID: 985594474

View in Genome Browser
Species Human (GRCh38)
Location 5:781948-781970
Sequence CATCTGGGTGGAGGATCATC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985594459_985594474 22 Left 985594459 5:781903-781925 CCAGGTGGCAGATCATCTGGGTG 0: 2
1: 0
2: 1
3: 18
4: 218
Right 985594474 5:781948-781970 CATCTGGGTGGAGGATCATCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985594474 Original CRISPR CATCTGGGTGGAGGATCATC TGG Intergenic
No off target data available for this crispr