ID: 985595099

View in Genome Browser
Species Human (GRCh38)
Location 5:784489-784511
Sequence ACTCCGGGCATCCCAATCCG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985595085_985595099 27 Left 985595085 5:784439-784461 CCTTTGCAAAGCCTCCCCGTCGC No data
Right 985595099 5:784489-784511 ACTCCGGGCATCCCAATCCGGGG No data
985595089_985595099 11 Left 985595089 5:784455-784477 CCGTCGCGTCCTCGCACCGAGCC No data
Right 985595099 5:784489-784511 ACTCCGGGCATCCCAATCCGGGG No data
985595090_985595099 2 Left 985595090 5:784464-784486 CCTCGCACCGAGCCCGCAGCGCC No data
Right 985595099 5:784489-784511 ACTCCGGGCATCCCAATCCGGGG No data
985595091_985595099 -5 Left 985595091 5:784471-784493 CCGAGCCCGCAGCGCCGAACTCC No data
Right 985595099 5:784489-784511 ACTCCGGGCATCCCAATCCGGGG No data
985595086_985595099 16 Left 985595086 5:784450-784472 CCTCCCCGTCGCGTCCTCGCACC No data
Right 985595099 5:784489-784511 ACTCCGGGCATCCCAATCCGGGG No data
985595088_985595099 12 Left 985595088 5:784454-784476 CCCGTCGCGTCCTCGCACCGAGC No data
Right 985595099 5:784489-784511 ACTCCGGGCATCCCAATCCGGGG No data
985595094_985595099 -10 Left 985595094 5:784476-784498 CCCGCAGCGCCGAACTCCGGGCA No data
Right 985595099 5:784489-784511 ACTCCGGGCATCCCAATCCGGGG No data
985595087_985595099 13 Left 985595087 5:784453-784475 CCCCGTCGCGTCCTCGCACCGAG No data
Right 985595099 5:784489-784511 ACTCCGGGCATCCCAATCCGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985595099 Original CRISPR ACTCCGGGCATCCCAATCCG GGG Intergenic