ID: 985597459

View in Genome Browser
Species Human (GRCh38)
Location 5:801742-801764
Sequence CTTGCAACGCTGAATGTGTC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 97
Summary {0: 1, 1: 1, 2: 0, 3: 9, 4: 86}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985597450_985597459 23 Left 985597450 5:801696-801718 CCGTGTTGCTGCCCAGACTTTGC 0: 1
1: 1
2: 1
3: 31
4: 188
Right 985597459 5:801742-801764 CTTGCAACGCTGAATGTGTCGGG 0: 1
1: 1
2: 0
3: 9
4: 86
985597455_985597459 11 Left 985597455 5:801708-801730 CCAGACTTTGCAGAGGGTTGGAG 0: 1
1: 0
2: 1
3: 16
4: 161
Right 985597459 5:801742-801764 CTTGCAACGCTGAATGTGTCGGG 0: 1
1: 1
2: 0
3: 9
4: 86
985597454_985597459 12 Left 985597454 5:801707-801729 CCCAGACTTTGCAGAGGGTTGGA 0: 1
1: 0
2: 2
3: 16
4: 154
Right 985597459 5:801742-801764 CTTGCAACGCTGAATGTGTCGGG 0: 1
1: 1
2: 0
3: 9
4: 86

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985597459 Original CRISPR CTTGCAACGCTGAATGTGTC GGG Intronic
900083205 1:874577-874599 CCTGCAAGGCTGAAGCTGTCTGG + Intergenic
901668355 1:10839090-10839112 TGTGCAAAGCTGAATGTGGCAGG + Intergenic
906349762 1:45048353-45048375 CTTGCACAGCTGAATATGGCTGG - Intronic
910252066 1:85208296-85208318 CTTGGAAGGCTTAATGTGGCTGG + Intergenic
921787495 1:219248202-219248224 CTTTTAACACTGAATTTGTCAGG - Intergenic
923921134 1:238565572-238565594 GTTGCAACTCTAAATGTCTCAGG + Intergenic
1068834972 10:61543368-61543390 GTTACAATGTTGAATGTGTCAGG - Intergenic
1075057907 10:119233644-119233666 CTTTTAACCCTGAATGAGTCAGG - Intronic
1075299457 10:121308684-121308706 CTTCCAACGCTGCCTGTGTCAGG - Intergenic
1076481544 10:130788366-130788388 CTTGCAGCGCTCAATCTGTGTGG + Intergenic
1086091698 11:83010976-83010998 TTTGCAAAGCTGCATTTGTCAGG + Intronic
1094162658 12:27408010-27408032 CTTGGGAGGCTGTATGTGTCAGG - Intronic
1094813693 12:34164516-34164538 CCTGCAAGGCTGAAGCTGTCTGG - Intergenic
1095103222 12:38203993-38204015 CCTGCAAGGCTGAAGTTGTCTGG + Intergenic
1098702785 12:73650313-73650335 CTTGCTAAGTTGTATGTGTCTGG - Intergenic
1102876946 12:116456368-116456390 CTTGCCACTCTCAATCTGTCTGG + Intergenic
1103636358 12:122309827-122309849 CTTGCAACGCTGAAAGCTGCTGG + Exonic
1104924343 12:132306162-132306184 CTTCCAACGCTGCCTGTGTAAGG - Intronic
1107423683 13:40272781-40272803 CTTGGAAGGCTGAATGCCTCAGG - Intergenic
1115134512 14:30092594-30092616 CTTGCTAGGTTGCATGTGTCTGG - Intronic
1116915868 14:50525192-50525214 ATTGCATAGGTGAATGTGTCTGG - Intronic
1118554645 14:67003485-67003507 ATTGCAACTCAGAATTTGTCAGG - Intronic
1121080051 14:91100579-91100601 CTTGCAAAGCTGGATGAGGCTGG + Intronic
1122080070 14:99260994-99261016 CTTTCAACGCTGAAAGTGGGAGG - Intronic
1126412025 15:48382049-48382071 CCTGCCAGGCTGACTGTGTCAGG + Intergenic
1132222249 15:100113698-100113720 GTTGCAAAGCTGAAGATGTCAGG - Intronic
1136061342 16:27728725-27728747 CTTTAAAGGCTGAATGTGGCTGG - Intronic
1137389970 16:48073130-48073152 CTTCCAACTCTGAATGTCTATGG + Intergenic
1150835921 17:68564437-68564459 CTTGCAAAGCTGGTTGTTTCTGG - Intronic
1151322959 17:73362497-73362519 CTTGGAAGGCTGAAAGTGGCAGG - Intronic
1158675771 18:59516740-59516762 CTTGGAAGGCAGAATGTGGCAGG + Intronic
1159736643 18:72107531-72107553 CTTACAATGGTGAATGTGTGGGG - Intergenic
1161352404 19:3801348-3801370 CCTGCAAGGCTGACTGTGACTGG + Intronic
1161957193 19:7502804-7502826 CTAGTAAAGCTGAATGTGTATGG + Intronic
1165339507 19:35200688-35200710 CTTGCAATGCTGAATGGGAGGGG + Intergenic
928860735 2:35854544-35854566 CTTGCCAGACTGAATGTGTGGGG + Intergenic
930628723 2:53728209-53728231 CTGGCAATGCTGAATGTGGAAGG + Intronic
931972491 2:67604517-67604539 CTTGCATCCCTGACTATGTCAGG - Intergenic
938000080 2:127726639-127726661 CTTGCAACACTGTAAGTGACAGG - Exonic
938900391 2:135794521-135794543 CCTCCAACGCCGAATGTGCCGGG - Intronic
938995182 2:136670790-136670812 CTTACAGAGCTGCATGTGTCAGG + Intergenic
942931817 2:181502822-181502844 CCTGCAAGACTGAATGTGACTGG - Intronic
944850358 2:203713133-203713155 ATGGCAACTCTGAATGTGTGAGG + Intronic
945389308 2:209244867-209244889 CTTGGGAGGCTGTATGTGTCTGG - Intergenic
946828335 2:223702021-223702043 CTTGCTACCCTGAATTTCTCTGG - Intergenic
1172434894 20:34921810-34921832 CCTGCAATCCTGAATGAGTCCGG + Exonic
1174723018 20:52833785-52833807 CTTGAAGGGCAGAATGTGTCAGG + Intergenic
1174941019 20:54927230-54927252 CTTGAAAAGCTGAATATGGCTGG - Intergenic
1178098159 21:29237423-29237445 CTGGCAAGACTGAATTTGTCAGG + Intronic
1184240722 22:43210146-43210168 CAGCCAACGCTGAATGCGTCTGG - Exonic
1184724726 22:46336888-46336910 CTTGCACTGCTGACTGTGCCGGG - Intronic
949573291 3:5313814-5313836 CTTGCAAGGCCCTATGTGTCAGG - Intergenic
952421499 3:33135519-33135541 CTTGGAAGGCTGAAGGAGTCTGG + Intronic
954840127 3:53504216-53504238 GTTGCAAGGCTGCATGTATCTGG + Intronic
959127817 3:102311774-102311796 CTTGGAAAGTTGTATGTGTCTGG - Intronic
959435939 3:106315149-106315171 CTTGGTAGGCTGTATGTGTCTGG + Intergenic
962818615 3:139024688-139024710 CTTGTATGGCTGAATGTGTCTGG + Intronic
967475712 3:189914989-189915011 CTTGCAAAACTGAATGTGGGTGG - Intergenic
972043053 4:34628137-34628159 CTTGCTGCCCTGAAAGTGTCAGG + Intergenic
972719619 4:41683079-41683101 CTTGAAATGATGAATGTGTCTGG + Intronic
973834293 4:54793597-54793619 CTTACAACTCTGAATGCTTCAGG + Intergenic
975417608 4:74123217-74123239 ATTGCAACACTAAATGTGTGTGG - Intronic
976378867 4:84376794-84376816 CTTGCAACGGTGATTGACTCTGG + Intergenic
978238147 4:106485289-106485311 CTTGAAAGGCTGTATGTGTCTGG + Intergenic
982234042 4:153235713-153235735 CTTACAGACCTGAATGTGTCAGG + Intronic
983552006 4:169027018-169027040 CTTGGAATGCTGACTGGGTCAGG - Intergenic
985583951 5:717443-717465 GTTGCAACGCTGAATGTGTCAGG + Intronic
985597459 5:801742-801764 CTTGCAACGCTGAATGTGTCGGG + Intronic
989685576 5:44082692-44082714 CTTGTAACACAGGATGTGTCAGG + Intergenic
993590774 5:89792540-89792562 CTTCCAACAATGAATGTGCCTGG + Intergenic
994657616 5:102613025-102613047 CTTGGAAGGGTGTATGTGTCAGG + Intergenic
995244801 5:109923306-109923328 CTTCCAACTCTGAATGTTTTTGG + Intergenic
999001401 5:147927143-147927165 CATGCCACGCTGATTGTGTCAGG - Intergenic
1001628390 5:173156262-173156284 CATGCTAAGCTGAGTGTGTCTGG - Intronic
1003291953 6:4787585-4787607 CTGGGCAAGCTGAATGTGTCTGG - Intronic
1003463545 6:6354448-6354470 CTTGCAAAGCTGAATGTGAATGG - Intergenic
1011805362 6:91066563-91066585 CTTGGAACTCTGAATGAGGCTGG - Intergenic
1024215581 7:47245683-47245705 CGTGCAAAGCAGAATGTGTGGGG + Intergenic
1024798815 7:53051770-53051792 CATACAACTCTGAATGTCTCTGG - Intergenic
1032255391 7:130293055-130293077 CTTGCAACTCTGACTGTGACAGG - Intergenic
1033294410 7:140117794-140117816 CTGAAAACACTGAATGTGTCAGG + Intronic
1040618792 8:49066131-49066153 CTTGCAACAGGGAATATGTCGGG - Intronic
1043448406 8:80341711-80341733 CTTGCACAGCTGAATGTGTGAGG - Intergenic
1043462021 8:80469766-80469788 TGTGCAACACTGAATGTGACTGG + Intergenic
1044741593 8:95332790-95332812 GTTGCCACCCAGAATGTGTCTGG + Intergenic
1045091854 8:98754113-98754135 CTAGCAAAGCTGAGTGTGTCTGG - Intronic
1049520306 8:143084999-143085021 CCTGAGACGTTGAATGTGTCAGG - Intergenic
1055010416 9:71559353-71559375 CTGGCATCCCTGATTGTGTCCGG - Intergenic
1058198053 9:102002968-102002990 CTTGCAACACTGAAATTGCCTGG - Intergenic
1058776582 9:108290174-108290196 CTTGCAAAGCTGAAACTGTATGG - Intergenic
1058877061 9:109253441-109253463 CTTTGAACGTTGAATGTCTCCGG + Exonic
1189564324 X:42224874-42224896 CTTGGTAAGTTGAATGTGTCCGG + Intergenic
1192975890 X:76284927-76284949 CTTGGTAGGTTGAATGTGTCTGG + Intergenic
1193411716 X:81171388-81171410 TTTTGAACTCTGAATGTGTCAGG + Intronic
1201727566 Y:17170653-17170675 CTTGCACAGATGAATGTGGCTGG - Intergenic
1201758789 Y:17516575-17516597 CCTGCAAGGCTGAAGCTGTCTGG - Intergenic
1201842766 Y:18389415-18389437 CCTGCAAGGCTGAAGCTGTCTGG + Intergenic