ID: 985602658

View in Genome Browser
Species Human (GRCh38)
Location 5:843278-843300
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 155
Summary {0: 2, 1: 0, 2: 1, 3: 10, 4: 142}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985602643_985602658 10 Left 985602643 5:843245-843267 CCCCACCCTCCCACAACTACATG 0: 1
1: 1
2: 1
3: 38
4: 370
Right 985602658 5:843278-843300 ATGGTGTGACAGGTGCTACAGGG 0: 2
1: 0
2: 1
3: 10
4: 142
985602641_985602658 26 Left 985602641 5:843229-843251 CCTGCAGGATGGGCACCCCCACC 0: 2
1: 0
2: 3
3: 30
4: 272
Right 985602658 5:843278-843300 ATGGTGTGACAGGTGCTACAGGG 0: 2
1: 0
2: 1
3: 10
4: 142
985602644_985602658 9 Left 985602644 5:843246-843268 CCCACCCTCCCACAACTACATGG 0: 1
1: 1
2: 1
3: 15
4: 170
Right 985602658 5:843278-843300 ATGGTGTGACAGGTGCTACAGGG 0: 2
1: 0
2: 1
3: 10
4: 142
985602646_985602658 8 Left 985602646 5:843247-843269 CCACCCTCCCACAACTACATGGC 0: 1
1: 1
2: 0
3: 16
4: 306
Right 985602658 5:843278-843300 ATGGTGTGACAGGTGCTACAGGG 0: 2
1: 0
2: 1
3: 10
4: 142
985602642_985602658 11 Left 985602642 5:843244-843266 CCCCCACCCTCCCACAACTACAT 0: 1
1: 1
2: 0
3: 37
4: 596
Right 985602658 5:843278-843300 ATGGTGTGACAGGTGCTACAGGG 0: 2
1: 0
2: 1
3: 10
4: 142
985602647_985602658 5 Left 985602647 5:843250-843272 CCCTCCCACAACTACATGGCCCC 0: 1
1: 1
2: 0
3: 6
4: 144
Right 985602658 5:843278-843300 ATGGTGTGACAGGTGCTACAGGG 0: 2
1: 0
2: 1
3: 10
4: 142
985602648_985602658 4 Left 985602648 5:843251-843273 CCTCCCACAACTACATGGCCCCA 0: 1
1: 1
2: 0
3: 14
4: 162
Right 985602658 5:843278-843300 ATGGTGTGACAGGTGCTACAGGG 0: 2
1: 0
2: 1
3: 10
4: 142
985602649_985602658 1 Left 985602649 5:843254-843276 CCCACAACTACATGGCCCCACAG 0: 1
1: 1
2: 0
3: 17
4: 115
Right 985602658 5:843278-843300 ATGGTGTGACAGGTGCTACAGGG 0: 2
1: 0
2: 1
3: 10
4: 142
985602650_985602658 0 Left 985602650 5:843255-843277 CCACAACTACATGGCCCCACAGG 0: 1
1: 1
2: 0
3: 8
4: 146
Right 985602658 5:843278-843300 ATGGTGTGACAGGTGCTACAGGG 0: 2
1: 0
2: 1
3: 10
4: 142

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900741956 1:4335865-4335887 ATGGTGTGACAGGAGCTGGCAGG - Intergenic
903209402 1:21808305-21808327 AGGGTGTTACAGGGGTTACAGGG + Intergenic
903848224 1:26290959-26290981 ATGCTGTGCCAGGTGCTTCAGGG - Intronic
904522598 1:31107249-31107271 AAGCTGTGGCAGGTGCTACAGGG - Intergenic
904597985 1:31658658-31658680 ATCGTGTGCCAGGGACTACAGGG + Intronic
906843656 1:49166670-49166692 ATGGTTTGACAGGAGGTATAAGG - Intronic
909350216 1:74643851-74643873 ATGTTGTGACAGGGACAACAAGG - Intronic
909420380 1:75457945-75457967 AGGGTTTGACACATGCTACAAGG - Intronic
912523066 1:110259693-110259715 ATGGTGGGGCAGGAGCTAGAAGG + Intronic
913522303 1:119656389-119656411 ATGCTGTGAAAGGTGGGACAGGG + Intergenic
917604906 1:176617300-176617322 AGGGGGTGGCAGGCGCTACAGGG + Intronic
917982252 1:180277334-180277356 ATGGGGTATAAGGTGCTACATGG + Exonic
922168058 1:223132014-223132036 AAGTTGTGCCAGGTACTACAGGG - Intronic
923054609 1:230416677-230416699 ATGGTAGGACGCGTGCTACAAGG + Intronic
923067001 1:230527292-230527314 CTGGTGTTCCAGGTGCCACAGGG + Intergenic
924027690 1:239852877-239852899 ATGTATTGACAGGTGTTACATGG + Intronic
924426774 1:243958458-243958480 ATGCTGAGACAGTTGCCACATGG + Intergenic
1062908721 10:1198617-1198639 GTGGTGTGGCAGGTGCCACCTGG + Intronic
1064461785 10:15541640-15541662 ATCCTGTGTCAGGTGATACAAGG + Intronic
1067431753 10:46249953-46249975 ATGGGCTGACAGGTGCTGCAGGG - Intergenic
1067441667 10:46312221-46312243 ATGGGCTGACAGGTGCTGCAGGG + Intronic
1070644234 10:78190411-78190433 ATGGTGAGACAGGTGGGACCAGG - Intergenic
1073100949 10:101006436-101006458 ATGGTGAGACAGGTTCTCCTGGG - Intronic
1073604475 10:104880073-104880095 CTGGTTGGACAGGTGGTACATGG - Intronic
1076127099 10:127983853-127983875 ATCCTGTGACAGGTGCTTCCGGG + Intronic
1077670516 11:4153127-4153149 ATGGTGTAAGAAGAGCTACAGGG + Intergenic
1078457999 11:11490639-11490661 ATGGTGTGACCAGAGTTACAAGG + Intronic
1081877167 11:46416675-46416697 GTGGTGTGACAGTTCCAACAGGG - Intronic
1084773103 11:71357092-71357114 ATGGAGAGGCAGGTGCGACAGGG - Intergenic
1084795078 11:71500116-71500138 ATGGTCTCACAGGTGCTGGAAGG - Intronic
1085469644 11:76749363-76749385 ATGATGTGACATGTTCTAAAAGG - Intergenic
1087203048 11:95365391-95365413 AATATGTGCCAGGTGCTACATGG + Intergenic
1088429868 11:109747422-109747444 ATAGTGTGCCAGGTATTACAGGG + Intergenic
1088845684 11:113664210-113664232 GTGGTGTGACACATGATACAGGG + Intergenic
1089077675 11:115751379-115751401 ATGAGGTGGGAGGTGCTACAGGG - Intergenic
1089626945 11:119757293-119757315 AGGGTCTGACAGGTGGTAGATGG - Intergenic
1091063348 11:132485544-132485566 ATGGGGTGGCAGGAGCCACATGG - Intronic
1094351951 12:29536707-29536729 GTGGTGTGACCAGTACTACAGGG - Intronic
1095247921 12:39943933-39943955 CTGGTGTTACAGGTGCCACTGGG - Intronic
1097881706 12:64692253-64692275 ATGGTGTGAAATGTCCTACATGG + Intronic
1098661125 12:73095008-73095030 ATGATGTTACAGTGGCTACAGGG - Intergenic
1099452933 12:82829703-82829725 TTGCTGTGATAGGTGCTATAAGG + Intronic
1103757220 12:123218094-123218116 GTGGTGGTACAGGTGGTACATGG - Intronic
1104768139 12:131343849-131343871 ATGGGGTGGCAGGTGCCCCAGGG + Intergenic
1105065619 12:133194838-133194860 AGGGTGTGACAGGTGCTGCCTGG - Intronic
1105349996 13:19606391-19606413 AGGGTGTGCCATCTGCTACAGGG - Intergenic
1105673955 13:22650317-22650339 ATGGTGTGAAATATGCTACCTGG + Intergenic
1106394675 13:29368256-29368278 GGGGTGGGACAGGTGATACATGG - Intronic
1106875547 13:34068237-34068259 TAGGTATGACAAGTGCTACAGGG + Intergenic
1109183444 13:59242193-59242215 ATCCTGTGATAGGAGCTACATGG + Intergenic
1112218619 13:97463258-97463280 CTGTTGTGAAATGTGCTACATGG + Intronic
1113249334 13:108434308-108434330 ATGGTGTGACATTTTCTCCAAGG - Intergenic
1113283869 13:108824103-108824125 ATGATGTGACAGATTTTACAAGG - Intronic
1114622421 14:24104172-24104194 ATTGTGAGACAGGTGTTAGAGGG - Intronic
1117067153 14:52022394-52022416 ATGGTGTGAGAGGCCCTCCAAGG - Intronic
1118924071 14:70175623-70175645 ACAGTGTGACAAGTGCTTCAGGG - Intronic
1120848187 14:89144771-89144793 GTGATGTGACATGTGCAACATGG - Intronic
1122013707 14:98775028-98775050 GTTGTGTGACGGGTGCTTCATGG + Intergenic
1122152748 14:99733523-99733545 ATGATGGGGCAGGTGCTGCAGGG - Intergenic
1123816079 15:23980772-23980794 CAGGTCTGACAGGAGCTACAAGG - Intergenic
1123826661 15:24088816-24088838 ATTGTTTGACAGCTGCTTCAGGG + Intergenic
1123860953 15:24466114-24466136 ATTGTTTGACAGCTGCTTCAGGG + Intergenic
1124942371 15:34229922-34229944 GTGGGGTGACAGGTCCTAGAAGG + Exonic
1125168334 15:36737468-36737490 TTGCTGTGACAGGGACTACATGG + Intronic
1126517574 15:49553663-49553685 ATGGTGTGACAGTGGCTACAGGG - Intronic
1126771317 15:52059233-52059255 ATGTTGTGACAGTGGCTACAGGG - Intronic
1129515153 15:76152786-76152808 CTGGTGTGATGGGTACTACAAGG - Intronic
1137481277 16:48853705-48853727 ATGGTTTGACAACTTCTACAAGG - Intergenic
1143890477 17:10098582-10098604 TAGGTATGACAGGAGCTACAAGG + Intronic
1147876160 17:43622146-43622168 GTGGTGTGACAGATGCCACGGGG + Intergenic
1148982283 17:51588224-51588246 ATGGAGTGACAAGTGCTCCTTGG - Intergenic
1152830336 17:82493436-82493458 AAGGAGTGCCAGCTGCTACATGG - Intergenic
1155139321 18:23029875-23029897 ATGGTGGCACAGGAGCTACTTGG + Intergenic
1155333948 18:24746077-24746099 ATGGTGTGGCATGTGACACAGGG + Intergenic
1157209821 18:45732605-45732627 ATAGTGTGACAGCTGCTTCTTGG - Intronic
1160489549 18:79325720-79325742 ATGGTGTCACCGGTGCTGCGTGG - Intronic
1161004689 19:1929335-1929357 CAGGAGTGACAGGTGCTGCAGGG + Intergenic
1166212098 19:41313338-41313360 ATGGTCCGACTGCTGCTACACGG - Intronic
1167257050 19:48436883-48436905 ATGGGGTGTCAGGTGGCACAGGG + Intronic
1167584032 19:50363133-50363155 GTGATGTGACAAGTGCTTCAAGG - Intronic
1168069327 19:53941184-53941206 ATAAGGTGATAGGTGCTACAAGG - Intronic
925429305 2:3777305-3777327 CAACTGTGACAGGTGCTACAAGG - Intronic
925848045 2:8051706-8051728 AAGGTGGGACAGGGGCTTCAGGG + Intergenic
929787432 2:45002665-45002687 ATGGAGAGGCAGGTACTACATGG - Intergenic
930436128 2:51344677-51344699 ATGGTGAGACAAGTGCTTTATGG + Intergenic
937235363 2:120428769-120428791 ACTATGTGTCAGGTGCTACATGG - Intergenic
937884142 2:126888721-126888743 ATGGTCTGGCTGGTGCTACAGGG - Intergenic
946827138 2:223690573-223690595 ATGGTGTTACAGCAGCCACAGGG - Intergenic
947732462 2:232439018-232439040 GTGGTGTGACAGTGGCTGCAGGG - Intergenic
948055043 2:235004811-235004833 CTGTTGTGACTGGTGCTACTAGG + Intronic
948147452 2:235718600-235718622 ATGCTAGGACAGGTGTTACAGGG - Intronic
948340052 2:237242633-237242655 ATGCTGTGACAGAGGCTTCAAGG - Intergenic
1173034007 20:39391109-39391131 AGAGAGTGTCAGGTGCTACATGG + Intergenic
1174287125 20:49481724-49481746 ATGGAGTGACCAGTGCCACATGG + Intronic
1175589551 20:60177718-60177740 CTGGGGTGACAGGTGGTAGAGGG + Intergenic
1176335888 21:5599857-5599879 ATTGTGTGATAGGAACTACAGGG - Intergenic
1176391869 21:6221091-6221113 ATTGTGTGATAGGAACTACAGGG + Intergenic
1176469550 21:7095083-7095105 ATTGTGTGATAGGAACTACAGGG - Intergenic
1176493111 21:7476861-7476883 ATTGTGTGATAGGAACTACAGGG - Intergenic
1176507531 21:7661522-7661544 ATTGTGTGATAGGAACTACAGGG + Intergenic
1177665302 21:24148944-24148966 ATTGTGTGGCAGCTGATACATGG - Intergenic
1179634418 21:42698230-42698252 CTGGTAAGAGAGGTGCTACAAGG - Intronic
1180000780 21:44994449-44994471 ATGCTGAGACTGGGGCTACATGG + Intergenic
1182950485 22:34370669-34370691 ATGGTGTTTCAGTTTCTACATGG + Intergenic
1183078277 22:35440471-35440493 TAGGTATGCCAGGTGCTACAGGG + Intergenic
1184876927 22:47282216-47282238 ATGGTGTGACATGGGATAAACGG + Intergenic
1185143114 22:49114429-49114451 AAGCTGTGACAAGTGCAACAAGG - Intergenic
954116309 3:48468715-48468737 CTGGTGTGACAGGCCCTACTTGG + Exonic
955868791 3:63415538-63415560 CAGTTGTGACAGGTTCTACAGGG - Intronic
963821261 3:149896960-149896982 ATAGTTTGACAGCTACTACATGG + Intronic
966682222 3:182654947-182654969 AGGGTTTGCCAGGGGCTACAGGG + Intergenic
970681092 4:18509247-18509269 ATGATGTGACAGGTGGTATCAGG - Intergenic
976363033 4:84202730-84202752 CTGGTGTTACAGGTGCCACTGGG - Intergenic
976977992 4:91187043-91187065 AAGCTGTGACAGATGCTACCTGG - Intronic
979266844 4:118713313-118713335 AGGGTGTCACAGCTGCTACTAGG + Exonic
985328296 4:188797189-188797211 AGGGTGTGTGAGGTGCTACGCGG - Intergenic
985587989 5:750811-750833 ATGGTGTGACAGGTGCTACAGGG + Intronic
985602658 5:843278-843300 ATGGTGTGACAGGTGCTACAGGG + Intronic
989125859 5:38051868-38051890 AAGTTTTGAAAGGTGCTACAAGG + Intergenic
989194134 5:38699751-38699773 ATGGTGTTCCAGGTGCCACTGGG - Intergenic
991397783 5:66222870-66222892 CTGGTGTTCCAGGTGCTACTGGG + Intergenic
994000349 5:94772283-94772305 ACAGTGTGACAGGTGGCACAGGG - Intronic
996422309 5:123276344-123276366 ATGGTGAGAGAGGGTCTACAAGG - Intergenic
997114069 5:131106816-131106838 ATGGTGTACCAGGGGCTGCAGGG + Intergenic
999872876 5:155770667-155770689 ATGTTGTGACAGGTGCTAGGGGG - Intergenic
1001449276 5:171811753-171811775 GTGGTGTGACAGCTGAGACAAGG + Intergenic
1002500143 5:179642922-179642944 CTGGTGTGAAGGGTGCTTCAGGG + Exonic
1002761899 6:208968-208990 CTGGTGTAACTGCTGCTACATGG + Intergenic
1004061067 6:12198601-12198623 AGAAGGTGACAGGTGCTACAGGG + Intergenic
1009773308 6:68173416-68173438 ATGGTTTGACAGGCTGTACAGGG - Intergenic
1011398382 6:86934618-86934640 GTGGTGTGACAGAGGCTAGAGGG - Intergenic
1013349998 6:109297024-109297046 ATGGGGAGGCAGGTGTTACATGG + Intergenic
1013781033 6:113728852-113728874 ATGATGTGTCAGGTGTTACATGG - Intergenic
1015307522 6:131726351-131726373 AGGTTGTTATAGGTGCTACACGG + Intronic
1017900446 6:158714865-158714887 ATCGTGTGACAGCTGACACAGGG - Intronic
1021710517 7:23411647-23411669 ATGCTGTGTTAGGTGCTACTTGG - Intronic
1028523610 7:91759205-91759227 CTGGTGTTCCAGGTGCTACTGGG - Intronic
1028806070 7:95027105-95027127 CTGGTGTTACAGGTGCCACCGGG + Intronic
1030657943 7:112188923-112188945 GTGGTGTGACATGGGCTACCAGG - Intronic
1032312610 7:130802523-130802545 ATGGTGTTCCAGGTGCCACTGGG + Intergenic
1038000703 8:23389011-23389033 TTAGGGTGACAGGTGCTTCAAGG - Intronic
1040791913 8:51240646-51240668 ATGGTGTGTCAGCTACTAGAGGG + Intergenic
1042669636 8:71247127-71247149 AGGGGGTGAGAGGTGCTAGAGGG - Intronic
1043587385 8:81784770-81784792 AGGAGGTTACAGGTGCTACAGGG + Intergenic
1043938890 8:86174276-86174298 ATGCTGTGACAGATGGTACCTGG - Intergenic
1049244540 8:141555104-141555126 ATGGTGTTAAAGGTGGTTCATGG + Intergenic
1049569966 8:143364911-143364933 ATGGAGTAACAGGTACCACAGGG - Intergenic
1056420365 9:86420205-86420227 ATGGTATGAGAGGTGGAACAAGG + Intergenic
1057380367 9:94561870-94561892 ATGGAGTGACATGTGCTTAAGGG + Intronic
1061499546 9:130994020-130994042 ATGGTTTGGCAGCTGCTGCAGGG - Intergenic
1203425750 Un_GL000195v1:35045-35067 ATTGTGTGATAGGAACTACAGGG + Intergenic
1194389087 X:93293901-93293923 AGGCAGTGACACGTGCTACATGG + Intergenic
1195571996 X:106407267-106407289 AAGCTGTGACAGGTGGTACCTGG + Intergenic
1195950345 X:110265101-110265123 GTACTGTGAAAGGTGCTACAAGG + Intronic
1199239188 X:145526617-145526639 ATGGGGTGGCAGTGGCTACAGGG + Intergenic