ID: 985604010

View in Genome Browser
Species Human (GRCh38)
Location 5:849105-849127
Sequence GGCTGTGTGTGCAGGGCCGA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 426
Summary {0: 2, 1: 0, 2: 5, 3: 31, 4: 388}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985604010_985604013 -10 Left 985604010 5:849105-849127 CCGTCGGCCCTGCACACACAGCC 0: 2
1: 0
2: 5
3: 31
4: 388
Right 985604013 5:849118-849140 ACACACAGCCCTGCTTACCCAGG 0: 1
1: 1
2: 2
3: 29
4: 238
985604010_985604016 6 Left 985604010 5:849105-849127 CCGTCGGCCCTGCACACACAGCC 0: 2
1: 0
2: 5
3: 31
4: 388
Right 985604016 5:849134-849156 ACCCAGGCCTAGAGAAGATGAGG 0: 2
1: 0
2: 2
3: 22
4: 244
985604010_985604020 17 Left 985604010 5:849105-849127 CCGTCGGCCCTGCACACACAGCC 0: 2
1: 0
2: 5
3: 31
4: 388
Right 985604020 5:849145-849167 GAGAAGATGAGGCTACCCATTGG 0: 2
1: 0
2: 0
3: 11
4: 125

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985604010 Original CRISPR GGCTGTGTGTGCAGGGCCGA CGG (reversed) Intronic
900013300 1:133589-133611 GGTGGTGGGTGCAGGGCCGCTGG + Intergenic
900043365 1:489576-489598 GGTGGTGGGTGCAGGGCCGCTGG + Intergenic
900048142 1:525098-525120 GGCTGTGTCCCCAGGGCCTATGG + Intergenic
900064802 1:724573-724595 GGTGGTGGGTGCAGGGCCGCTGG + Intergenic
900090737 1:919339-919361 GGCTGCCTGTGCAGGGCCCCCGG + Intergenic
900322850 1:2093630-2093652 GGCTGTTGGTGCGGGGCCGCTGG + Intronic
900512058 1:3065475-3065497 GGCCGTGTGTGCAGGACAGGAGG - Intergenic
900516012 1:3082555-3082577 GGCTGGGGGTGCAGCTCCGAGGG + Intronic
900593518 1:3470149-3470171 GGCTGTGTGTGCATGGTCAGTGG + Intronic
900618582 1:3576723-3576745 GGTGGAGTGTGCAGGGCTGAGGG - Intronic
900618676 1:3577109-3577131 GGCTGGGTGTGCAGAGCCGAGGG - Intronic
901425168 1:9178049-9178071 GGCTGGGTGTCCAGGGCAGGGGG + Intergenic
901748952 1:11394092-11394114 GGCTGGGTCTGCTGGGCAGAGGG - Intergenic
902744504 1:18464456-18464478 GTGTGTGTGTGCAGAGCAGAGGG - Intergenic
903994765 1:27298835-27298857 GTCTGTCTGGGCAGAGCCGACGG - Intronic
904438742 1:30516172-30516194 GGCTTTGTGTGTAGAGCTGAGGG + Intergenic
906004440 1:42456651-42456673 GGCTGGGCGCGCAGGGCCGGCGG + Exonic
907122696 1:52021470-52021492 GGGTGTGTGTGCTGGGGCGGGGG + Intronic
907869647 1:58431806-58431828 GCCTCTGTGTGCAGAGCCCATGG - Intronic
907882180 1:58560877-58560899 GGCTGTGTGTGGAGGGGCAGGGG + Intergenic
908098200 1:60762814-60762836 GGCTGTGTGTGGTGGGAAGAGGG + Intergenic
909096069 1:71290739-71290761 GGCTTTGTGGGCTGGGCCCATGG + Intergenic
909820094 1:80051012-80051034 CGCTGTGAGTGCAGGCCTGAAGG + Intergenic
910626850 1:89316459-89316481 GGCAGTGGGTGCAGTGCAGAGGG + Intergenic
913247771 1:116885370-116885392 GGCGGTTTGTGCAGGGCAGTTGG - Intergenic
913402873 1:118455368-118455390 GGCTTTGTGGGCTGGGCCCAAGG - Intergenic
913997084 1:143660543-143660565 GGCTGTGTGTGCAGGCCAAATGG - Intergenic
914505169 1:148282244-148282266 GGCTGTGTGTGCAGGCCAAATGG + Intergenic
914507396 1:148301904-148301926 GGCTGTGTGTGCAGGCCAAATGG - Intergenic
914742455 1:150476719-150476741 GCCTGACTGTCCAGGGCCGAAGG + Intergenic
920184400 1:204151388-204151410 GGGGGCGTGTGCAGGGCCAAGGG + Intronic
921300430 1:213746440-213746462 GGGTGTGTGTGGGTGGCCGAGGG + Intergenic
922099702 1:222470592-222470614 GGTGGTGGGTGCAGGGCCGCTGG + Intergenic
922188309 1:223295567-223295589 TGCTGTGGGTGCAGGTCGGAAGG + Intronic
922261739 1:223950087-223950109 GGTGGTGGGTGCAGGGCCGCTGG + Intergenic
922496569 1:226062401-226062423 GGATGGGAGTGCAGGGCCGGGGG + Intronic
922735342 1:227975658-227975680 GGTGGTGGGTGCAGGGCCGCTGG - Intergenic
923071432 1:230568356-230568378 GCCTGAGTGTGGAGGCCCGAGGG + Intergenic
923251104 1:232180379-232180401 GGCTGTGGGGGCAATGCCGAGGG + Intergenic
923638368 1:235724449-235724471 AACTGTGAGTGCAGGGCCAAGGG - Intronic
924342904 1:243052261-243052283 GGTGGTGGGTGCAGGGCCGCTGG + Intergenic
1062831386 10:608252-608274 GGCTGTGTGTGGGGGGCTGTGGG - Intronic
1063170990 10:3509843-3509865 GACTGTGAGGGCAGAGCCGAGGG + Intergenic
1063377697 10:5563899-5563921 GGGTGGGTGTGCAGGCCCGGCGG - Intergenic
1063838582 10:10044749-10044771 GTCTGTGTGTGTAGGGCCATGGG - Intergenic
1064119463 10:12606247-12606269 TGCTGTGTGTGAGGGGCCCATGG - Intronic
1066454285 10:35559797-35559819 GGCTGTGCCTGCTGGGCCCATGG - Intronic
1067472960 10:46549435-46549457 GCCTGTCTGTGGAGGGCCGGAGG - Exonic
1070712119 10:78690330-78690352 GGCTGTGTGGGGAGGGACAAGGG + Intergenic
1072001708 10:91201581-91201603 GGCTGTGGGTGGAGGGAGGAGGG - Intronic
1072443995 10:95481919-95481941 GGCTGTGTGTGTAGGAGCAAAGG - Intronic
1076364649 10:129914199-129914221 GGATGTGGGTGCAGGGCTGGAGG - Intronic
1076519373 10:131071154-131071176 GGCGGGGTGTCCAGGGCAGAAGG + Intergenic
1076754968 10:132564672-132564694 GGCAGTGAGTGCAGGGCAGACGG + Intronic
1076797241 10:132804161-132804183 GGCCGTGGGGACAGGGCCGAGGG - Intergenic
1076797269 10:132804231-132804253 GGCCGTGGGGACAGGGCCGAGGG - Intergenic
1076853684 10:133105044-133105066 GGCTGGGGATGCAGGGCCGCTGG - Intronic
1076854744 10:133110417-133110439 TGCTCTGTGTGCAGGGACGCAGG - Intronic
1076895779 10:133310665-133310687 TGATGTGTGAGCACGGCCGACGG - Intronic
1076969636 11:125793-125815 GGTGGTGGGTGCAGGGCCGCTGG + Intergenic
1076982635 11:213000-213022 GGCTGTGAGTGGAGACCCGAGGG - Intronic
1077032585 11:476180-476202 AGCTGTGTGGGAAGGGCCCAGGG + Intronic
1077289288 11:1781488-1781510 GGCTGTGTGTGCAGGCTGCACGG - Intergenic
1077542515 11:3153985-3154007 TGCTGTGTGTGCGGGGCTGACGG - Intronic
1077723989 11:4655160-4655182 GGCTATGTGTTCAGGACAGAAGG - Exonic
1077851484 11:6077841-6077863 GGCTGTGTGAGTTGGGCCGTGGG - Intergenic
1080668965 11:34358548-34358570 GGCTGTGTTTGGAGGGAGGAGGG + Intergenic
1080770095 11:35332716-35332738 GAGTGTGTGTTCAGGGCAGATGG - Intronic
1081866246 11:46362112-46362134 GTCTGTGGGAGCAGAGCCGAGGG + Intronic
1083544427 11:63538170-63538192 GCCTGTGGGTGCAGAGCCCAGGG + Intronic
1083861648 11:65423216-65423238 GGCAGTGGGTGCAGGGCTGCAGG + Intergenic
1083898974 11:65634584-65634606 GCCTGTGTGTGCTGGGCCGCCGG + Exonic
1083983504 11:66193587-66193609 GACTGTTTGTTCAGGGCCCAGGG + Intronic
1084117108 11:67048930-67048952 GGCTCTGTGTCCAGGGCCCCAGG + Exonic
1084486441 11:69450936-69450958 GGCTGTGTTTGGAAGGCTGATGG - Intergenic
1084777849 11:71389064-71389086 GGGAGTGTGGGCAGGGCCGGGGG - Intergenic
1084891793 11:72240328-72240350 GGCTGCGTGCGGAGGGCCGAAGG - Intronic
1085471101 11:76758658-76758680 GGCTGAGTGTGAAGGGCATAGGG + Intergenic
1090747665 11:129720307-129720329 GGCTGGGCCTGCAGGGCTGAGGG - Intergenic
1090977749 11:131691172-131691194 GGCTGTGGGTGCAGGGCCGGGGG - Intronic
1091330692 11:134728971-134728993 GCCTGTGTGGGCAGGGACAACGG + Intergenic
1091434349 12:460953-460975 GCCTGGGTGTGGACGGCCGAGGG - Intronic
1091903790 12:4166074-4166096 GTGTGTGTGTGCAGGGAAGAGGG - Intergenic
1092091316 12:5805805-5805827 GGCTGTGTGTGGAGGGCCATTGG + Intronic
1092147405 12:6224095-6224117 GGCTGGGAGTGCAGGGCTGGTGG + Intronic
1092369004 12:7900981-7901003 GGCTGTGTGGGCAGCACTGATGG + Intergenic
1094484407 12:30913156-30913178 GGCTGTGTGTAGTGGGCCGGGGG - Intergenic
1095395430 12:41757154-41757176 GGCTTTGTGCGCTGGGCCCAGGG - Intergenic
1096578760 12:52570973-52570995 GGATGTGTCTGCAGAGCTGAGGG + Intronic
1096627369 12:52903961-52903983 GGCAGCGTGGGCGGGGCCGAGGG - Intronic
1096801867 12:54115718-54115740 GGCTGTGTCTGAAGGGCAGCAGG + Intergenic
1098396917 12:70028951-70028973 GTCTGTGGGTACAGGCCCGAGGG + Intergenic
1099607897 12:84828649-84828671 GGTTTTGTGTGCTGGGCCCAGGG + Intergenic
1102184044 12:110934018-110934040 TGCTGTGTCTCCAGGGCTGAAGG + Intergenic
1102547080 12:113665034-113665056 GTCTGTGTGTGCAAGGGAGACGG - Intergenic
1104370166 12:128217321-128217343 GGCTGTATGTGAAGGGGAGAGGG - Intergenic
1105309085 13:19190271-19190293 GGCTGGGTGTGCAGGGATGGAGG + Intergenic
1105503679 13:20992376-20992398 GGCTGTGGGTGCAGAGCTGGAGG + Intronic
1105528520 13:21197877-21197899 GGCTGGGTGTGCAGGGATGGAGG - Intergenic
1106398313 13:29403177-29403199 GTCTGTGTGCACAGGGCCCAGGG - Intronic
1107416920 13:40209632-40209654 GGCAGAGTGTCCAGGGCCCAAGG + Intergenic
1110450583 13:75635445-75635467 GGGTAGGTGTGCAGGGCCGGGGG - Intronic
1113799917 13:113080952-113080974 GGCGGTGTGTGCCGGGCCAGGGG + Intronic
1114807817 14:25857850-25857872 GGCTGTGGGTGCAGGACAGTGGG - Intergenic
1115533254 14:34346086-34346108 TGCTCTGAGTGCAGGGCCCATGG + Intronic
1116275207 14:42824212-42824234 GGTTGTGTGTGCTGGGCCCAGGG + Intergenic
1117219148 14:53584305-53584327 GCCTGTATGTGCAGGGGCTATGG + Intergenic
1118760783 14:68879265-68879287 GGCTGCGTGTGCTGGGGGGAGGG - Intronic
1121517701 14:94563752-94563774 GGCTGTGTGAGCAGGCCCCCAGG - Exonic
1122372002 14:101234082-101234104 GGCTGTGGGTGCAGAGCCCTTGG - Intergenic
1122510516 14:102263225-102263247 GCATGTGTGTGCAGGCCCGCTGG - Intronic
1124218858 15:27832240-27832262 GCCAGTGTGTGCAGGGCAGGTGG - Intronic
1127898273 15:63321715-63321737 TCCTGTGTGTGTAGGGGCGAGGG + Exonic
1128478863 15:68020242-68020264 GACCATGTGGGCAGGGCCGACGG - Intergenic
1128694151 15:69747787-69747809 GGCTGGCTGGGCAGGGCCCACGG - Intergenic
1130081662 15:80739236-80739258 GGCTGTGTTTTCAGGGGCCAGGG - Intronic
1131510165 15:93045298-93045320 GGCTGTGGGTGCAGGGCTGGCGG + Exonic
1132310566 15:100854468-100854490 GGCTGTGTGTGCAGGAGAGCAGG + Intergenic
1132399855 15:101498579-101498601 GGCTGCGGGTGCAGGTCAGAAGG - Intronic
1132514606 16:360296-360318 GACTGTGTGTGCTGGGCCCCAGG + Intergenic
1132599104 16:766044-766066 GGCTGTCTCTGCAGGGCACAGGG - Exonic
1132860911 16:2071317-2071339 GGCTGTGGGTGCTGGGCCTCCGG + Intronic
1133002479 16:2858256-2858278 GGCTGTGGGTCCTGGGCAGAGGG + Intergenic
1133147539 16:3801005-3801027 GGCTCTGTGTTCAGGGTCCAAGG + Intronic
1133710386 16:8395640-8395662 GTCTGTGTGTGCAGGGATTAAGG - Intergenic
1133732700 16:8590216-8590238 GGCTGGGCGTGGAGGGCCGAGGG - Intergenic
1135458722 16:22622519-22622541 GTGTGTGTGTGCAGGACCAAGGG + Intergenic
1136349585 16:29698145-29698167 GGCTGTGAGTGCACAGCAGATGG + Exonic
1138604843 16:58081989-58082011 GTCTGTGTGTGCAAGACAGAGGG + Intergenic
1139428881 16:66900545-66900567 GCCACTGTGTGAAGGGCCGAGGG + Intergenic
1139812805 16:69636746-69636768 GGTTTTGTGTGCTGGGCCCAGGG - Intronic
1140241264 16:73203077-73203099 GGCTGTGTGAGCATGGGGGAGGG - Intergenic
1140736032 16:77898602-77898624 GGCTGTGTGTGCAGGGCTTAAGG + Intronic
1141670540 16:85489511-85489533 GGCTGTGTGTCTGGGTCCGATGG - Intergenic
1141981976 16:87556505-87556527 GGCTCTGTTTCCAGGGCAGAGGG + Intergenic
1142053375 16:87975349-87975371 GGCTGAGGCTGCAGGGGCGAGGG - Intronic
1142363841 16:89639508-89639530 GGGTGTGTGTGCAAGGATGAGGG - Intergenic
1142401748 16:89862478-89862500 GGCTGTGAGCCCAGGGCAGATGG - Intronic
1142409980 16:89911028-89911050 GGCTGTCTGTGCTGGGACTAGGG - Intronic
1142411188 16:89918063-89918085 GGCTGTTGGTGCAGGGCCTGTGG + Exonic
1142451042 16:90173329-90173351 GGTGGTGGGTGCAGGGCCGCTGG - Intergenic
1142456521 17:60366-60388 GGTGGTGGGTGCAGGGCCGCTGG + Intergenic
1143448780 17:7023531-7023553 GGCTGCGTGTGCCGGGGCTAGGG + Intronic
1144724156 17:17493332-17493354 GGGTGTGTGTGCTGGGGCGGAGG - Intergenic
1146273568 17:31500029-31500051 GGCTCTGTTTGCAGGGCAGAGGG + Intronic
1148240531 17:45996975-45996997 GGCTGTGTCTCCACGGCCGGAGG + Intronic
1150161418 17:62901303-62901325 GGCTGTGGGTGAAGGGCTGTAGG + Intergenic
1150658109 17:67053742-67053764 GGATGAGTCTGCAGGGCAGACGG - Intronic
1150978876 17:70119705-70119727 GGTTTTGTGGGCAGGGCCTAGGG - Intronic
1151644493 17:75420776-75420798 GGATGTGTGTGCAAGGCAGCAGG + Intergenic
1152466692 17:80470685-80470707 GTGTGCGTGTGCAGGGGCGACGG + Exonic
1152702894 17:81828271-81828293 GGCTATGTGTGCAGGGTCGGGGG - Intronic
1152732482 17:81979133-81979155 TGCTGAGTGTGCAGGGCTGGCGG - Intronic
1152754604 17:82081969-82081991 GGCAGGGTGGGCAGGGTCGAGGG + Intronic
1159325962 18:66918193-66918215 GTCTGTGTGTGCTGACCCGAGGG - Intergenic
1160646441 19:195719-195741 GGTGGTGGGTGCAGGGCCGCTGG + Intergenic
1160862772 19:1244722-1244744 GGCTGGCTCTGCAGGGCAGAGGG - Exonic
1161079473 19:2303383-2303405 GGCTGTGTTTGACGGGCCCAGGG + Intronic
1161267447 19:3370885-3370907 CGCTGTGTGCTCAGGGCAGATGG - Intronic
1161347388 19:3775122-3775144 GGCTGGGTGGGCAGGGCCAAGGG + Intergenic
1161484032 19:4525187-4525209 GGCAGGTTGTGCAGGGCCGTGGG + Intronic
1161864727 19:6825513-6825535 TGCTGTGTGTTCATGGGCGAGGG + Intronic
1161991370 19:7686139-7686161 AGCTGGGAGTGCAGGGCCCAGGG + Exonic
1162041081 19:7971435-7971457 AGCTGGCTGTGCAGGGCCCAGGG - Intronic
1162145285 19:8609460-8609482 GGCTGCGGGGACAGGGCCGACGG + Intronic
1162343265 19:10105242-10105264 GGCTGAGGGTGGGGGGCCGAGGG - Intergenic
1162349164 19:10138405-10138427 GGCAGTGTGTGGAGGAGCGACGG + Intronic
1162401928 19:10451681-10451703 GTGTGTGTTTGCAGGGCCGTAGG + Intronic
1162858302 19:13486904-13486926 GGCTGCGTGTGTAGGGAAGAAGG - Intronic
1163679823 19:18674721-18674743 GGCTGAGTGCCCAGGGCAGATGG - Intergenic
1165167741 19:33869016-33869038 AGCAGTGTGGGCAGGGCCCAGGG + Intergenic
1165902264 19:39174381-39174403 GGTTGTGTGGGCTGTGCCGAGGG - Intronic
1166258316 19:41620968-41620990 GGCTGTGTGTGCAGGACACTGGG + Intronic
1166369038 19:42291326-42291348 GGTGGTGGGTGCAGGGCCGCTGG - Exonic
1166898628 19:46040690-46040712 GGCTGTGGGTGCAGGTCCTGGGG + Intronic
1167141013 19:47650868-47650890 GGCTGTGCGGGCTGGGCGGATGG - Intronic
1167603641 19:50468454-50468476 GGCTGCGTGTGAGGGGCTGAGGG - Intronic
1167637067 19:50661484-50661506 AGCTGTGTGTGCTGGGGAGAGGG + Intronic
1168121025 19:54252593-54252615 AGTTGTGTGTGCAGGGCAGCTGG - Intronic
1168124603 19:54276500-54276522 AGCTGTGTGTGCAGGGCAGGGGG - Intronic
1168177384 19:54635038-54635060 AGCTGTGTGTGCAGGGCAGGGGG + Intronic
1168241571 19:55091613-55091635 GGCTGTGGGCAGAGGGCCGAGGG - Intronic
1168471377 19:56643315-56643337 GGGTGTGTGTGCCTGGGCGAGGG + Intronic
925291318 2:2750393-2750415 GGTGGTGTGTGTAGGGGCGATGG + Intergenic
925363477 2:3295521-3295543 GGGTGTGTGTGGAGAGACGATGG - Intronic
925505100 2:4553858-4553880 GGCTTTGTGTAGAGGGCAGAGGG - Intergenic
927147228 2:20174173-20174195 GTCTGTCTGTGCAGGGATGATGG + Intergenic
927401916 2:22721469-22721491 GGTTTTGTGTGCCGGGCCCAGGG - Intergenic
927637602 2:24827505-24827527 GGCTGTGAGTGCAGGCCAGGAGG + Intronic
927696463 2:25242728-25242750 GGCTGGGGGGGCAGGGCAGAGGG + Intronic
927971384 2:27307900-27307922 CCCTGTGTGTCCAGGGCCGGCGG - Exonic
929936335 2:46297065-46297087 GGCAGCCTGCGCAGGGCCGAGGG - Intronic
931251116 2:60531228-60531250 GTCTGTGTGTGCAGGACCGTCGG - Intronic
931355861 2:61537532-61537554 GACTGTGTCTTCGGGGCCGAGGG - Intronic
931516578 2:63053736-63053758 GTGTGTGTGTGCAGGGGAGAGGG + Intronic
933778079 2:85783851-85783873 GGCTGTGTGTGGGGGGCGGGGGG - Intronic
934640438 2:96024376-96024398 GGATGTGTGTGCAGTGGTGAAGG - Intronic
934793212 2:97081040-97081062 GGATGTGTGTGCAGTGGTGAAGG + Intergenic
935536607 2:104301524-104301546 GGATGTGTGGGCAGAGACGATGG - Intergenic
936522610 2:113220549-113220571 TGCTGTGAGTGTAGGGCCCAGGG + Intronic
937090916 2:119205612-119205634 GGCTGTGTGTGGAAGGCAAAGGG + Intergenic
937259230 2:120574839-120574861 GGCGGTGTGTTCAGGGCTGAGGG - Intergenic
937378188 2:121352226-121352248 GGCCGGCTGTGCATGGCCGAGGG - Intronic
937916403 2:127101182-127101204 GGGTGTTTGTGCAGGGCAGGTGG - Intronic
938537198 2:132256658-132256680 AGCAGTGTGTGCAGGGAAGAGGG - Intronic
939002112 2:136748389-136748411 GGCTGTGAGAGCAGGGCTGGAGG - Intergenic
939331263 2:140764695-140764717 GGCTGTTTGTGTATGGCGGAAGG - Intronic
941621304 2:167782324-167782346 GGGTGGGTGTGCAGGGTTGAGGG + Intergenic
942116589 2:172735246-172735268 GGCAGTGCGGGCAGGGCTGAGGG - Intergenic
946149218 2:217753000-217753022 GGTTGGGTGTTCAGGGCTGATGG - Intronic
947195200 2:227557381-227557403 GGGTGTGTGTGCAGGGGGGCGGG - Intronic
948064593 2:235067658-235067680 GGCTATGTGTTCAGGGACTAAGG + Intergenic
948375092 2:237515996-237516018 GACTGCGGGTGCAGGGCCCAGGG - Intronic
948407985 2:237737054-237737076 GGCTGTCTGTGCAGGCCTGGGGG - Intronic
948564645 2:238876131-238876153 GGGTGTGGGTGGAGGGCGGATGG + Intronic
948709203 2:239815020-239815042 GCCTGTGTGTGCATGGATGACGG - Intergenic
948768150 2:240233802-240233824 GGCACTGTGGGCAGGGCCGGAGG - Intergenic
948784766 2:240346624-240346646 GCCTGTATGTGCAGGGCTGTGGG - Intergenic
949052640 2:241905318-241905340 AGGTGTGTGTGCAGGGCTGTGGG + Intergenic
1168800335 20:640625-640647 GGGTGTGTGTGAAGGGTGGAGGG + Intergenic
1168974174 20:1951767-1951789 GGCTGTGTGAGCTGGGCAGGAGG - Intergenic
1170150455 20:13221592-13221614 GGCGGGGTGTGCGGGGCCGGGGG - Intergenic
1170161659 20:13319731-13319753 GTGTGTGTGTGCAGGGGGGAGGG - Intergenic
1170799550 20:19579709-19579731 GGCAGAGTGTTCAGGGCAGAGGG + Intronic
1171794844 20:29558748-29558770 GGCTGTGTCTGAAGGGCAGCAGG - Intergenic
1171853612 20:30325517-30325539 GGCTGTGTCTGAAGGGCAGCAGG + Intergenic
1172282818 20:33720078-33720100 GGCTGTGTGAGTGGGGCCGTCGG - Exonic
1172699691 20:36845576-36845598 GGCTGGGTCTGCAGGGACGTGGG + Intronic
1173847260 20:46196054-46196076 GGCTGGGTGGGCAGACCCGATGG + Intronic
1173854366 20:46240683-46240705 GGCTGTATGAGCATGTCCGAGGG + Intronic
1174142992 20:48429870-48429892 GTCTGTGTCTGCAGAGCCAAAGG + Intergenic
1174368006 20:50068041-50068063 CGCTGTGTCTGCTGGGCCTAGGG + Intergenic
1174428287 20:50448873-50448895 GGCGGCGTGTGCAGGGCAGAGGG - Intergenic
1174655220 20:52166253-52166275 GGCAGGGTGGGCAGGGCAGATGG + Intronic
1174877960 20:54248107-54248129 GGCTTTGTGGCCAGGGCAGAGGG - Intergenic
1175138462 20:56842417-56842439 GCCTGTGGGGGCAGGGGCGAAGG - Intergenic
1175224952 20:57439386-57439408 AGCTGGGGGTGCAGGGCAGAGGG - Intergenic
1175246663 20:57586261-57586283 AGCTGGCTGGGCAGGGCCGAGGG + Intergenic
1176034330 20:63028986-63029008 GTCTGTGTGTGCAGGTCCCCCGG + Intergenic
1176034416 20:63029234-63029256 GTCTGTGTGTGCAGGTCCCCCGG + Intergenic
1176111169 20:63411430-63411452 GGATGTCTGTGCAGGTCTGATGG + Intronic
1176279069 20:64290497-64290519 GGTGGTGGGTGCAGGGCCGCTGG - Intergenic
1176295433 21:5069640-5069662 AGCTGTGTGTCCAGGGAAGAAGG + Intergenic
1177775056 21:25558787-25558809 GGATGTGTCTCCAGGGCTGATGG - Intergenic
1178004128 21:28197095-28197117 GGTTTTGTGGGCAGGGCCCAGGG - Intergenic
1178951620 21:36990259-36990281 GGCTCTCTGCGCAGGGCCGCGGG + Intergenic
1179629893 21:42669870-42669892 GGCTGTGTGTGCAGGTTCCCGGG - Intronic
1179861617 21:44192484-44192506 AGCTGTGTGTCCAGGGAAGAAGG - Intergenic
1179998610 21:44985165-44985187 GGCTGTCTCTCCAGGGCCCAGGG - Intergenic
1182116853 22:27761644-27761666 GGCTCTGTGCCCAGGGCAGAAGG - Intronic
1184558766 22:45248856-45248878 GGCTGTGTGTTCATGGACAAGGG - Intergenic
1185016019 22:48342998-48343020 GGATGCCTGTGCAGGGCCCATGG - Intergenic
1185219522 22:49622469-49622491 GGCGGTGTGGGCAGGGCTGGCGG + Intronic
1185294773 22:50047666-50047688 GGAGGGGTGTGCAGGGCCCATGG - Intronic
1185337290 22:50276332-50276354 GGCGCTGTGGGCACGGCCGAGGG + Intronic
1185416888 22:50715458-50715480 GGCTGTGTGGGCAGTGCAGATGG - Intergenic
949414152 3:3798940-3798962 GGCTGTGTGTGCGCGCCCGGGGG - Intronic
949947854 3:9204278-9204300 GGCTGTGTGTCCAGGCCCTGAGG - Intronic
950354518 3:12395038-12395060 AGCTGTGAGTGCATGGCCAAAGG - Intronic
953980097 3:47409321-47409343 GGCTGGGTGAGCAGGGTAGAGGG + Intronic
954428944 3:50458995-50459017 GGCTCTGTGTGCAGGGGACAGGG + Intronic
956760465 3:72438909-72438931 CGCTGTGTATGGAGGGCAGACGG + Intronic
956885081 3:73551109-73551131 CCCTGTATGTGCAGGGCCAAAGG + Intronic
961714253 3:128847826-128847848 GGCTGGGTGTGCTGGGCACATGG + Intergenic
962865144 3:139442387-139442409 GGATCTGTGTGCAGGGCTGGGGG - Intergenic
962947557 3:140185667-140185689 GGATGGGGGTGCAGGGCAGATGG + Intronic
965915707 3:173843215-173843237 GGTTTTGTGTGCTGGGCCCAGGG - Intronic
966735154 3:183181715-183181737 GGCTGTGTCTCCAGGGTCCATGG + Intronic
966767939 3:183479169-183479191 GGCTGTGTCTCCAGGGTCCATGG - Intergenic
966881611 3:184354054-184354076 GGCTGTGGGTGAAGGGCAGAGGG - Intronic
966883173 3:184361260-184361282 GTCTGAGGCTGCAGGGCCGAAGG - Intronic
968007252 3:195251426-195251448 GGCTGTATGAGAAGGGCCGGGGG - Intronic
968371240 3:198223807-198223829 GGTGGTGGGTGCAGGGCCGCTGG - Intergenic
968730306 4:2266309-2266331 CTCTCTGTGGGCAGGGCCGAGGG - Intergenic
968909292 4:3469419-3469441 GGGTGGGTGGGCAGGGCTGATGG + Intronic
968909310 4:3469480-3469502 GGGTGGGTGAGCAGGGCCGATGG + Intronic
968912928 4:3485047-3485069 GGCTGTGGGGGCAGGGTCGCTGG + Intronic
969330099 4:6469900-6469922 GCCAGTGTGTGCAGGGCATAGGG - Intronic
969605780 4:8201611-8201633 GGCTGGGCCTGCAGGGCTGAGGG + Intronic
971082193 4:23226464-23226486 AGATGTGTGTCCAGGGCAGAAGG + Intergenic
971679572 4:29679115-29679137 TGCTATGTGTGCAGAGCCAAGGG - Intergenic
978654735 4:111051994-111052016 GGTTTTGTGAGCAGGGCCCAGGG + Intergenic
981861462 4:149361472-149361494 GGTTTTGTGGGCAGGGCCCAGGG + Intergenic
982002145 4:151030928-151030950 GGCTGTGTGTGAAGAACAGATGG + Intergenic
982380438 4:154743133-154743155 GGGTGTGTGTGTAGGGCGGGGGG - Intronic
983337540 4:166416019-166416041 GGTTTTGTGTGCTGGGCCCAGGG - Intergenic
983595356 4:169460106-169460128 GGCTGTGTGTGTATGGGGGAAGG + Intronic
984299671 4:177899065-177899087 GTGTGTGTGTGTTGGGCCGAGGG - Intronic
985489487 5:171140-171162 GGCTGTGGGGGGCGGGCCGAGGG - Intronic
985589293 5:756441-756463 GGCTGTGTGTGCAGGGCCGATGG - Intronic
985604010 5:849105-849127 GGCTGTGTGTGCAGGGCCGACGG - Intronic
985604022 5:849161-849183 GGCTGTGTATGCAGGGCCAATGG - Intronic
985635000 5:1031501-1031523 GGCGGTGTGTGCTGGGCCGAGGG + Intronic
985640727 5:1062401-1062423 GGCTGTGTCTTCGGGGACGATGG - Intronic
985650840 5:1106646-1106668 GGATGTGTCTGCAGTGCCCAAGG + Intronic
985659990 5:1152229-1152251 GGCCGGGTGTGCAGGGCAGAGGG - Intergenic
985689586 5:1299683-1299705 GGCTGAGTCTCCAGGGCAGATGG + Intergenic
986762173 5:10890023-10890045 GGCTGTGTGTTCAAGGCTGTAGG + Intergenic
988310355 5:29548775-29548797 GGCTTTGTGGGCTGGGCCCAGGG - Intergenic
989455360 5:41637569-41637591 GGCTGAGTGGGCAGGGTGGAAGG - Intergenic
990493817 5:56326953-56326975 GGCTGGGTGTGGAGAGCCCAAGG + Intergenic
994649045 5:102504150-102504172 GGCTTTGTGGGCCGGGCCCAGGG + Intergenic
995210338 5:109530616-109530638 GGCTGTCTGTGGAGGGCTGGAGG - Intergenic
995226043 5:109702351-109702373 GTCTGTGTGTGTAGGGAGGATGG + Intronic
995513215 5:112928482-112928504 GGCTGTGTCTGCAGGGGCTGAGG - Intergenic
995988457 5:118208234-118208256 GGCTCCGAGTGCAGGGCCCACGG + Intergenic
997614974 5:135240100-135240122 GGCTGTGTGGGCGGGGCTGGAGG - Intronic
997651375 5:135523884-135523906 GGTTTTGTGAGCAGGGCCCAGGG - Intergenic
998043293 5:138967145-138967167 GCCAGAGTGTGCAGGGCCCAAGG - Intronic
1001131974 5:169071842-169071864 GGATGAGTGGGCAGGGCAGAGGG + Intronic
1001313674 5:170628234-170628256 GGCTGTGTGTGCCTGGGAGAAGG - Intronic
1001634786 5:173202028-173202050 AGCTGTGTGGCCAGGGCCGTAGG - Intergenic
1001705202 5:173736603-173736625 GGGTGTGGGGGCAGGGCGGAGGG - Intergenic
1001836414 5:174836492-174836514 AGCTTTGTGGGCAGGGCCCAGGG + Intergenic
1002280114 5:178124860-178124882 GGCTGTGGGCGCAGGGAGGAGGG - Exonic
1002441725 5:179267735-179267757 CACTGGGTGTGCAGGGCCCAGGG + Intronic
1002534583 5:179869282-179869304 GGCTGTCTGTGCAGGGGGCAGGG - Intronic
1002730478 5:181329353-181329375 GGTGGTGGGTGCAGGGCCGCTGG - Intergenic
1002754052 6:144751-144773 GGTGGTGGGTGCAGGGCCGCTGG + Intergenic
1002871073 6:1167705-1167727 GGCTGAGGGTCCAGGGCCCAAGG + Intergenic
1004116963 6:12778892-12778914 GGCTGTGTCTGCAGGGGAGGGGG - Intronic
1007665463 6:43510536-43510558 GGCTGAGTGGGTAGGGCTGACGG + Exonic
1007835692 6:44671902-44671924 GCAGCTGTGTGCAGGGCCGAAGG - Intergenic
1008254052 6:49275517-49275539 TGCTCTGAGTGCAGGGCCCACGG - Intergenic
1010165225 6:72906680-72906702 GGATGTGTGTTCAGGGGCGGAGG + Intronic
1011637238 6:89385770-89385792 GGCTGTGGGAGCATGGCCAATGG - Intronic
1012079304 6:94735802-94735824 GGCTGTGAGTGCAGGAGCCACGG + Intergenic
1016010894 6:139135966-139135988 CGCCGTGTGTGCCGGGCCGAAGG + Intronic
1016411210 6:143785883-143785905 GGTTTTGTGGGCAGGGCCCAGGG - Intronic
1017884688 6:158588955-158588977 GGCTCTGTGTGCATGGCTGGTGG + Intronic
1018193950 6:161338280-161338302 AGATGTGTGTGCAGGCCCTATGG + Intergenic
1018735611 6:166685286-166685308 GGGTGTGTGTGCAGGCTGGAAGG + Intronic
1019134253 6:169898253-169898275 AGGTGTCTGTGCAGGGCCGAGGG - Intergenic
1019282281 7:206480-206502 GGACACGTGTGCAGGGCCGAGGG - Intronic
1019282289 7:206526-206548 GGACACGTGTGCAGGGCCGAGGG - Intronic
1019282373 7:206961-206983 GGATACGTGTGCGGGGCCGAGGG - Intronic
1019282383 7:207007-207029 GGATACGTGTGCGGGGCCGAGGG - Intronic
1019282392 7:207053-207075 GGATACGTGTGCAGGGCCGAGGG - Intronic
1019282408 7:207145-207167 GGATACGTGTGCAGGGCGGAGGG - Intronic
1019282419 7:207191-207213 GGATACGTGTGCGGGGCCGAGGG - Intronic
1019282447 7:207329-207351 GGATACGTGTGCGGGGCCGAGGG - Intronic
1019513267 7:1429010-1429032 GGCGGGGTCTGCAGGGCCGAGGG + Intronic
1019548344 7:1589456-1589478 GGCTGTGGGTGCAGGGGTGCTGG - Intergenic
1020109338 7:5439534-5439556 GGGTGTGGGTACAGGGCCCAGGG - Intronic
1020749829 7:12126382-12126404 AGCTCTGTGAGCAGGGCAGATGG - Intergenic
1020845353 7:13274686-13274708 GGCAGTGTGTGCAGGACAGTAGG - Intergenic
1023837649 7:44077732-44077754 AGCAGTGTGTGCAGGGCAAATGG - Intronic
1024075625 7:45816526-45816548 GGTGGTGAGTGCAGGGCCGCTGG - Intergenic
1024137959 7:46429947-46429969 GGTTTTGTGGGCAGGGCCCAGGG - Intergenic
1024383560 7:48725662-48725684 GGGTTTGTGGGCTGGGCCGAGGG - Intergenic
1025051828 7:55739270-55739292 GGTGGTGGGTGCAGGGCCGCTGG + Intergenic
1025128783 7:56364938-56364960 GGTGGTGGGTGCAGGGCCGCTGG + Intergenic
1025177163 7:56807816-56807838 GGTGGTGGGTGCAGGGCCGCTGG + Intergenic
1025694629 7:63768570-63768592 GGTGGTGGGTGCAGGGCCGCTGG - Intergenic
1025865175 7:65374279-65374301 CGCCGAGTGTGCAGGGACGACGG + Intronic
1026326386 7:69314341-69314363 GGCTGGGTGGGCAGGGATGAAGG - Intergenic
1026440328 7:70438394-70438416 GGCTGGGGGTGCAGGGCAGGAGG - Intronic
1031645549 7:124221407-124221429 GGTTCTGTGGGCAGGGCCCAGGG + Intergenic
1032052152 7:128656273-128656295 GGTGGTGGGTGCAGGGCCGCTGG - Intergenic
1032153688 7:129451379-129451401 GGCTGTGTGTGGAGGACAGAGGG + Intronic
1032328162 7:130951495-130951517 GGCAGTGTGTGCAGAACCGCTGG + Intergenic
1032743128 7:134759580-134759602 GCATGTGTGTGCAGGGGTGAAGG + Intronic
1033426832 7:141252327-141252349 GGCTGTGCCTGCAGGACAGAGGG - Intronic
1034911687 7:155003024-155003046 GGCTGCGCGGGCAGGGCCGTTGG - Exonic
1035029360 7:155847411-155847433 AGCCGTGACTGCAGGGCCGAGGG + Intergenic
1035442078 7:158910295-158910317 GCCTGTGGGTGCAGGGCCATTGG + Intronic
1035679408 8:1477088-1477110 GGCTATGTGTGCAGTGCCTGCGG - Intergenic
1035714098 8:1740632-1740654 GGCTATGCGTGCAGGGGAGAGGG - Intergenic
1035788046 8:2278119-2278141 CGCTGTGAGTGCCGGGCCCAGGG + Intergenic
1035804761 8:2443594-2443616 CGCTGTGAGTGCCGGGCCCAGGG - Intergenic
1036273880 8:7333564-7333586 GTCTGTGTCTTCAGCGCCGAGGG - Intergenic
1036347466 8:7976786-7976808 GTCTGTGTCTTCAGCGCCGAGGG + Intergenic
1036842772 8:12137561-12137583 GTCTGTGTCTTCAGCGCCGAGGG + Exonic
1036864047 8:12379065-12379087 GTCTGTGTCTTCAGCGCCGAGGG + Intergenic
1037615935 8:20519138-20519160 GGCTGTGTCTGCAGGGGTGCAGG - Intergenic
1038412084 8:27366804-27366826 GGCTGTGTGTGGAGAGCAGAGGG + Intronic
1038726041 8:30083200-30083222 GGCGGTGTGGGCGGGGCCAAGGG + Exonic
1038726064 8:30083264-30083286 CGCGGTGTGGGCGGGGCCGAGGG + Intergenic
1039088821 8:33806409-33806431 GGCAGTGTGTGCTGGGGAGATGG + Intergenic
1042352698 8:67793902-67793924 GGCTGTGTGGGCAGCCCGGATGG + Intergenic
1042421659 8:68597592-68597614 GTGTGTGTGTGCACGGACGAAGG + Intronic
1042730230 8:71925455-71925477 TGCTGAGTGTGGAGGGCAGATGG - Intronic
1045653950 8:104367728-104367750 GGCTGGGAGGCCAGGGCCGAAGG - Intronic
1045732290 8:105256140-105256162 GGTTTTGTGTGCTGGGCCCAGGG - Intronic
1048355873 8:133653725-133653747 GGGTGTGGGTGCAGGGCACAGGG + Intergenic
1049069164 8:140343890-140343912 AGCTGAGTGTGGAGGGCAGAGGG + Intronic
1049457168 8:142699386-142699408 GGCTTTCTGTGCAGGGCAGGGGG + Intergenic
1049584759 8:143427787-143427809 GGCTGGGGGTGCAGGGCAGGAGG - Intronic
1049824685 8:144661177-144661199 GCCTGTGTGTGAAGGGGCCATGG - Intergenic
1050077680 9:1881821-1881843 GACTGTGTGTGCAGTGCCCCAGG - Intergenic
1050352719 9:4755643-4755665 GGCTGTGTTTCCAGGGGCCATGG - Intergenic
1051468282 9:17405437-17405459 GGCTGTGTCATCATGGCCGAAGG + Intronic
1052999048 9:34567321-34567343 GCCTGTGTGTGCAGGTGTGAGGG - Intronic
1053410616 9:37914104-37914126 GGCTCTCTGTGCAGGGATGAAGG + Intronic
1056183756 9:84111307-84111329 GGCTGAGTGGGCAGGCTCGAGGG + Intergenic
1057229187 9:93308581-93308603 GGCTGTGAGTGCGGGGCGGGTGG + Exonic
1058132114 9:101264942-101264964 GCCTGTGTGTCCAGGGCAGTAGG - Intronic
1060311913 9:122470203-122470225 GGTTTTGTGGGCAGGGCCCAGGG + Intergenic
1060937404 9:127523649-127523671 GCCTGTGGGTGCAGGGTCGGTGG - Intronic
1061626605 9:131844159-131844181 TGCTGTGGGTGCAGGGCCTGTGG + Intergenic
1061893903 9:133637055-133637077 GGCATTGTTTACAGGGCCGAGGG - Intronic
1062284564 9:135767323-135767345 GGCTGTGGGTACAGGGCCTGGGG + Intronic
1062636158 9:137492782-137492804 GGCTGGGTGGGCAGGGCCATGGG + Intronic
1062672924 9:137722543-137722565 GGCTGTGTGTGTGGGCCCCACGG + Intronic
1062754889 9:138281863-138281885 GGTGGTGGGTGCAGGGCCGCTGG - Intergenic
1203578797 Un_KI270745v1:26032-26054 GGTGGTGGGTGCAGGGCCGCTGG - Intergenic
1185642397 X:1595928-1595950 GGGTGTGTGTGCAGGCCTGTGGG + Intronic
1186515577 X:10164221-10164243 GGCTGAGTGCTCAGGGCTGAGGG + Intronic
1186515759 X:10165201-10165223 GGCTGAGTGCTCAGGGCTGAGGG - Intronic
1187181524 X:16947172-16947194 GGCAGTGTGTGCGGGGGCGGAGG + Intronic
1188873168 X:35398715-35398737 GGCTTTGTGGGCTGGGCCCAGGG - Intergenic
1191984110 X:66959999-66960021 GGCTGGTTATGCAGGGCCCAAGG + Intergenic
1192188792 X:68978263-68978285 GGCAGTGTCTGCAGGGAAGAGGG - Intergenic
1193232650 X:79066371-79066393 TGCTGTTTGTTCAGGGCCCAAGG + Intergenic
1193779759 X:85686841-85686863 GGGTGTGTGTGCAGGAGAGAAGG + Intergenic
1194285713 X:92007820-92007842 TGCTGGTTATGCAGGGCCGAAGG + Intronic
1195909946 X:109879042-109879064 GGCTGTGTGTGCTGTGCTAAGGG + Intergenic
1197735399 X:129847057-129847079 GGCTGTGTGTGTGGGGAGGAGGG - Intergenic
1197745815 X:129931911-129931933 GGGCGTGTGTGCAGCGCTGAGGG - Intergenic
1198968233 X:142250425-142250447 GCCTGTGTGTGGAGTGCAGAGGG + Intergenic
1199220363 X:145309759-145309781 GGTTTTGTGTGCCGGGCCCAGGG - Intergenic
1199743999 X:150760441-150760463 GGCTGGGTGTGGAAGGCCCAGGG + Intronic
1200067346 X:153510193-153510215 GGCTCTTCGTGCAGGGCCGAAGG - Intergenic
1200411808 Y:2868442-2868464 GGCTGTGTCTCCAGGGCCCATGG - Intronic
1200871402 Y:8102432-8102454 GGCTGTGGGTGCAGGACAGTGGG - Intergenic
1201469445 Y:14317670-14317692 GGCTGTGTGGGCCAGGCCTAGGG + Intergenic