ID: 985604022

View in Genome Browser
Species Human (GRCh38)
Location 5:849161-849183
Sequence GGCTGTGTATGCAGGGCCAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 231
Summary {0: 1, 1: 0, 2: 2, 3: 22, 4: 206}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985604022_985604030 -2 Left 985604022 5:849161-849183 CCATTGGCCCTGCATACACAGCC 0: 1
1: 0
2: 2
3: 22
4: 206
Right 985604030 5:849182-849204 CCCTGTGCCAGTCGGGGACCGGG 0: 2
1: 0
2: 1
3: 13
4: 149
985604022_985604027 -8 Left 985604022 5:849161-849183 CCATTGGCCCTGCATACACAGCC 0: 1
1: 0
2: 2
3: 22
4: 206
Right 985604027 5:849176-849198 ACACAGCCCTGTGCCAGTCGGGG 0: 2
1: 0
2: 1
3: 18
4: 188
985604022_985604026 -9 Left 985604022 5:849161-849183 CCATTGGCCCTGCATACACAGCC 0: 1
1: 0
2: 2
3: 22
4: 206
Right 985604026 5:849175-849197 TACACAGCCCTGTGCCAGTCGGG 0: 1
1: 1
2: 2
3: 13
4: 165
985604022_985604025 -10 Left 985604022 5:849161-849183 CCATTGGCCCTGCATACACAGCC 0: 1
1: 0
2: 2
3: 22
4: 206
Right 985604025 5:849174-849196 ATACACAGCCCTGTGCCAGTCGG 0: 1
1: 1
2: 0
3: 15
4: 126
985604022_985604028 -3 Left 985604022 5:849161-849183 CCATTGGCCCTGCATACACAGCC 0: 1
1: 0
2: 2
3: 22
4: 206
Right 985604028 5:849181-849203 GCCCTGTGCCAGTCGGGGACCGG 0: 2
1: 0
2: 1
3: 12
4: 137
985604022_985604035 23 Left 985604022 5:849161-849183 CCATTGGCCCTGCATACACAGCC 0: 1
1: 0
2: 2
3: 22
4: 206
Right 985604035 5:849207-849229 GGCTGCCCCCGTGCCCCTTTTGG 0: 1
1: 1
2: 0
3: 15
4: 127
985604022_985604032 2 Left 985604022 5:849161-849183 CCATTGGCCCTGCATACACAGCC 0: 1
1: 0
2: 2
3: 22
4: 206
Right 985604032 5:849186-849208 GTGCCAGTCGGGGACCGGGAAGG 0: 2
1: 0
2: 0
3: 17
4: 183

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985604022 Original CRISPR GGCTGTGTATGCAGGGCCAA TGG (reversed) Intronic
900048142 1:525098-525120 GGCTGTGTCCCCAGGGCCTATGG + Intergenic
900295301 1:1946262-1946284 GGCTGTGGAGGCAGGGGCCAGGG + Intronic
900593518 1:3470149-3470171 GGCTGTGTGTGCATGGTCAGTGG + Intronic
900593549 1:3470260-3470282 GGGTGTGTATGCATGGGCAAGGG + Intronic
900593554 1:3470280-3470302 GGGTGTGTATGCATGGGCAGGGG + Intronic
900618676 1:3577109-3577131 GGCTGGGTGTGCAGAGCCGAGGG - Intronic
901066796 1:6498102-6498124 GGCTGTTTCTGTAGGGCAAAGGG - Intronic
901767912 1:11515562-11515584 GGCTTTGTATCCAGGGAGAAAGG - Intronic
905319272 1:37104444-37104466 GTTTGTGTATGCAGGGTGAAGGG + Intergenic
905974669 1:42165702-42165724 GACTGTATCTGCAGGGGCAAGGG - Intergenic
907098039 1:51799763-51799785 GGCTCTGAATGAAGGCCCAAGGG + Intronic
907882180 1:58560877-58560899 GGCTGTGTGTGGAGGGGCAGGGG + Intergenic
908006887 1:59736940-59736962 GGTTTTGTAGGCAGGGCCCAGGG + Intronic
908544805 1:65151811-65151833 GGCAGTGTAGGAAGGGCCAATGG - Intronic
909084525 1:71155343-71155365 TGCTGATTATCCAGGGCCAAGGG + Intergenic
909405912 1:75289396-75289418 GGGTGTTCATTCAGGGCCAAGGG - Intronic
912858329 1:113191628-113191650 GACAGGGTATGCAGGGACAAGGG - Intergenic
912956346 1:114156453-114156475 GGTTGGGTTTGCAGGGCAAAGGG - Intergenic
913997084 1:143660543-143660565 GGCTGTGTGTGCAGGCCAAATGG - Intergenic
914505169 1:148282244-148282266 GGCTGTGTGTGCAGGCCAAATGG + Intergenic
914507396 1:148301904-148301926 GGCTGTGTGTGCAGGCCAAATGG - Intergenic
916531805 1:165663688-165663710 GGGTGTACAGGCAGGGCCAAGGG - Intronic
920184400 1:204151388-204151410 GGGGGCGTGTGCAGGGCCAAGGG + Intronic
921053377 1:211526727-211526749 GGGTGGGAATGCAGGGCCATTGG + Intergenic
923291209 1:232547888-232547910 GACTGTGAATGCAGTGACAAAGG + Intronic
923299874 1:232630620-232630642 GGCTGTGTATGTAGCCCCAGCGG - Intergenic
923638368 1:235724449-235724471 AACTGTGAGTGCAGGGCCAAGGG - Intronic
1062901590 10:1150812-1150834 TGCTGAGCATGGAGGGCCAACGG + Intergenic
1062994392 10:1852250-1852272 GGCACTGTCTGCAGGGGCAAAGG + Intergenic
1063838582 10:10044749-10044771 GTCTGTGTGTGTAGGGCCATGGG - Intergenic
1066454285 10:35559797-35559819 GGCTGTGCCTGCTGGGCCCATGG - Intronic
1070530426 10:77332134-77332156 GGCTGAGTACGCAGGGGTAAGGG + Intronic
1070712119 10:78690330-78690352 GGCTGTGTGGGGAGGGACAAGGG + Intergenic
1072443995 10:95481919-95481941 GGCTGTGTGTGTAGGAGCAAAGG - Intronic
1072471769 10:95719982-95720004 AGCTGGGTATGGAGGGACAATGG + Intronic
1074987809 10:118672914-118672936 GGCTCTGTCTGCAGGCCCAGAGG + Intergenic
1075912688 10:126139572-126139594 GGCTAGGTATGCAGGGGCCATGG + Intronic
1076853684 10:133105044-133105066 GGCTGGGGATGCAGGGCCGCTGG - Intronic
1077266843 11:1655177-1655199 AGATGAGTATGCAGGGCCCAGGG - Intergenic
1077709636 11:4523150-4523172 TGCTGTTTATTCAGGGCCCAAGG - Intergenic
1082765492 11:57164289-57164311 GGCTGAGAATGTAGGGGCAATGG - Intergenic
1084131810 11:67141813-67141835 GGGTGTGTATGAGGGGCAAAGGG - Intronic
1085348923 11:75785807-75785829 GACCATGTTTGCAGGGCCAAGGG + Intronic
1085465814 11:76722521-76722543 AGGTGTGTATGCAGGGCACAGGG - Intergenic
1087610871 11:100432721-100432743 GGCTATTTCTGCAGGTCCAAAGG + Intergenic
1088985168 11:114899445-114899467 TGCTGATTATGCAGGGCCCAGGG - Intergenic
1089310687 11:117556318-117556340 GGCTTTGAATGCCGGGGCAAGGG + Intronic
1090977749 11:131691172-131691194 GGCTGTGGGTGCAGGGCCGGGGG - Intronic
1091034255 11:132218885-132218907 GGCTTTGAAGGCAGGTCCAAGGG + Intronic
1091330692 11:134728971-134728993 GCCTGTGTGGGCAGGGACAACGG + Intergenic
1091415142 12:276368-276390 TGCTGTGTATGGAGGGATAAAGG + Intergenic
1092091316 12:5805805-5805827 GGCTGTGTGTGGAGGGCCATTGG + Intronic
1092497618 12:9012448-9012470 TGCTGATTATTCAGGGCCAAAGG - Intergenic
1095998453 12:48109432-48109454 TGCTTTCTATGCAGGGGCAAAGG - Intronic
1100400173 12:94222509-94222531 GGGTGTGCATGGAGGACCAAAGG - Intronic
1103451654 12:121033465-121033487 GGCTCTGTAGGCAGGCACAATGG + Exonic
1112618902 13:101034858-101034880 TGCTGTTTATTCAGGGCCCACGG + Intergenic
1113799917 13:113080952-113080974 GGCGGTGTGTGCCGGGCCAGGGG + Intronic
1114680506 14:24480124-24480146 GGCTGCATATGCTGGGCCCAGGG - Intergenic
1116087061 14:40253977-40253999 TGCTGATTATTCAGGGCCAAAGG + Intergenic
1116275207 14:42824212-42824234 GGTTGTGTGTGCTGGGCCCAGGG + Intergenic
1116354794 14:43914637-43914659 GGCTGATTATTCAGGGCCCAAGG - Intergenic
1116356482 14:43937175-43937197 GGTTTTGTAGGCAGGGCCCAGGG - Intergenic
1117752267 14:58936260-58936282 GGTTTTGTATGCTGGGCCCAGGG - Intergenic
1119175462 14:72565059-72565081 GGCTGTGTAGACCAGGCCAATGG - Intronic
1120193578 14:81460911-81460933 AGTTGTGTATGGAGGGCCTATGG - Intergenic
1121063793 14:90941518-90941540 GTCTGTGCATTCAGGGACAATGG - Intronic
1121114353 14:91332940-91332962 GGCAGGGTTTGCAGAGCCAAGGG - Intronic
1123010200 14:105346440-105346462 AGCCGTGCATGCAGGGCCACGGG - Intronic
1125102525 15:35931094-35931116 AGCTGTCTAGGCAAGGCCAAGGG - Intergenic
1127907553 15:63387449-63387471 GGCTGTGTCTGAGGGACCAAGGG + Intergenic
1128111857 15:65081539-65081561 GGCTGTGAACCCAGGGCCACAGG + Intergenic
1129792635 15:78351678-78351700 GGCTTTGAATGCCAGGCCAAAGG - Intergenic
1130081662 15:80739236-80739258 GGCTGTGTTTTCAGGGGCCAGGG - Intronic
1132256773 15:100383172-100383194 GTCTGCTTTTGCAGGGCCAAGGG + Intergenic
1132599104 16:766044-766066 GGCTGTCTCTGCAGGGCACAGGG - Exonic
1135458722 16:22622519-22622541 GTGTGTGTGTGCAGGACCAAGGG + Intergenic
1138190457 16:55009785-55009807 GGCTGAGTATGCAAGGCCAGAGG + Intergenic
1140736032 16:77898602-77898624 GGCTGTGTGTGCAGGGCTTAAGG + Intronic
1140772436 16:78217185-78217207 GACTGTGGATGCAGGGCAATGGG - Intronic
1141094984 16:81156823-81156845 GACGGTGTACGCAGCGCCAATGG + Intergenic
1144801911 17:17935002-17935024 GGCTTTGTATGCAGTGCACATGG - Intronic
1144829727 17:18124444-18124466 GGCTGTGTCTGCAGGTTGAAGGG - Intronic
1146273568 17:31500029-31500051 GGCTCTGTTTGCAGGGCAGAGGG + Intronic
1146702773 17:34976149-34976171 GGCTGTGTATTCTGGTCCATTGG - Intronic
1149457143 17:56797271-56797293 GTCTAAGTTTGCAGGGCCAAGGG + Intronic
1150648279 17:66993307-66993329 GGCTGGGTAGGCAGGGCCACTGG + Intronic
1151290387 17:73145715-73145737 GACTGTATATGCAGAGACAATGG + Intergenic
1152537628 17:80959833-80959855 GGCTGTCCCTCCAGGGCCAAGGG + Intronic
1157583690 18:48787892-48787914 GGCTGTGTCCACAGTGCCAAGGG + Intronic
1160187244 18:76685451-76685473 GTCTGTAAATGCAGGGCTAAGGG - Intergenic
1160985641 19:1837354-1837376 GGCTGTGCATGGAGGGCCCCGGG - Intronic
1161079473 19:2303383-2303405 GGCTGTGTTTGACGGGCCCAGGG + Intronic
1161199395 19:3006116-3006138 GGCAGTGTTTGCAGGTCAAAGGG - Intronic
1161269657 19:3382836-3382858 GCCAGTGCATGCAGGGCCCAGGG + Intronic
1161326409 19:3666170-3666192 GGCTACGGACGCAGGGCCAAGGG + Intronic
1161347388 19:3775122-3775144 GGCTGGGTGGGCAGGGCCAAGGG + Intergenic
1162794124 19:13077992-13078014 GGCTGTGCAGGCAGAGCCAGAGG - Intronic
1166000935 19:39877076-39877098 GGCTGCGGCTGCTGGGCCAATGG - Exonic
1166003716 19:39893329-39893351 GGCTGCGGCTGCTGGGCCAATGG - Exonic
1166339958 19:42131418-42131440 GGCTGTGTAGGCATGACCATGGG - Intronic
925157457 2:1658582-1658604 GGCTGTGGATGAAGGGTCCAGGG - Intronic
929299538 2:40287614-40287636 GTGTGTGCATGCAGGGACAAGGG + Intronic
930427885 2:51234391-51234413 GGTTTTGTAGGCAGGGCCCAGGG - Intergenic
932226585 2:70045995-70046017 GGCTGTGCTTGCAGGGGAAAAGG - Intergenic
936618135 2:114069543-114069565 GCCTGTGCAGGCAGGGCAAATGG + Intergenic
937090916 2:119205612-119205634 GGCTGTGTGTGGAAGGCAAAGGG + Intergenic
938828560 2:135031542-135031564 GGCTGTGTCTTCAGGGCAATAGG + Intronic
943731160 2:191305238-191305260 GGCAGGGTAAGTAGGGCCAAAGG + Intronic
946419086 2:219554812-219554834 AGGGGTGTAGGCAGGGCCAAGGG - Intronic
946865272 2:224036784-224036806 AGCTGAGGATGCAGGGACAAGGG + Intronic
948379161 2:237541070-237541092 AGCCGTGCATGCTGGGCCAATGG - Intronic
948935004 2:241158133-241158155 GGCTGTGTATGACTGGCCACTGG + Intronic
1169189580 20:3649643-3649665 TGATGTGCTTGCAGGGCCAAGGG - Exonic
1170874814 20:20240516-20240538 AGCTGTGTATGCAGGGTTACAGG - Intronic
1171383029 20:24747553-24747575 TGCTGTGGATGCAGTGACAACGG + Intergenic
1171420410 20:25013895-25013917 GGCTGGGCAGGCAGGGACAAGGG + Intronic
1172515314 20:35528960-35528982 GGCTGTGAAGACAGGGCCAAGGG + Intronic
1173004187 20:39127087-39127109 TGCTGGCTATTCAGGGCCAAAGG + Intergenic
1174142992 20:48429870-48429892 GTCTGTGTCTGCAGAGCCAAAGG + Intergenic
1174368006 20:50068041-50068063 CGCTGTGTCTGCTGGGCCTAGGG + Intergenic
1175705134 20:61171174-61171196 AGCTGTGCATGCAGGGCCTTGGG - Intergenic
1179174282 21:38996080-38996102 TGCTCTGTCTGAAGGGCCAAGGG - Intergenic
1179541280 21:42084570-42084592 GGCTGTGCCTGCAGTGCCACAGG + Intronic
1179998610 21:44985165-44985187 GGCTGTCTCTCCAGGGCCCAGGG - Intergenic
1181151373 22:20885791-20885813 GCCTGTGTCAGCAGGGCCAGAGG - Intronic
1182317410 22:29457279-29457301 GGCTGAGCAGGCAGGGCCAGGGG - Intergenic
1182361088 22:29746950-29746972 GGCTGTGGTTGCAAGGCCACAGG - Intronic
1184248871 22:43249159-43249181 GGCTGAGCATGCAGGGCCAGAGG + Intronic
1184558766 22:45248856-45248878 GGCTGTGTGTTCATGGACAAGGG - Intergenic
949898069 3:8785092-8785114 GGCTGGGTTTGCAGTGCCAGGGG + Intronic
950354518 3:12395038-12395060 AGCTGTGAGTGCATGGCCAAAGG - Intronic
950697461 3:14714304-14714326 GGCTGTTTCTGCAGGGACATAGG + Intronic
950702446 3:14759725-14759747 AGGTGTGCATGCAGGCCCAAGGG + Intronic
952965426 3:38618138-38618160 GGGTGGGAATGCAGTGCCAAGGG - Intronic
953369054 3:42371897-42371919 GGCTGTGTAGGAAGACCCAATGG - Intergenic
953392445 3:42541286-42541308 GGCTGTGTCTCCAGGGTCACTGG - Intergenic
955667706 3:61368031-61368053 GCCTGAGGATGCAGGGCCAAGGG - Intergenic
956625569 3:71263185-71263207 TGCTGTGTATGCAGCACAAAGGG + Intronic
956760465 3:72438909-72438931 CGCTGTGTATGGAGGGCAGACGG + Intronic
956885081 3:73551109-73551131 CCCTGTATGTGCAGGGCCAAAGG + Intronic
957621881 3:82604517-82604539 TGCTGTTTATTCAGGGCCCAAGG - Intergenic
958876663 3:99624642-99624664 TGCTGATTATTCAGGGCCAAAGG - Intergenic
963526950 3:146426936-146426958 GTCTTTGGATGTAGGGCCAAAGG - Intronic
964209322 3:154210320-154210342 AGCTGTTTATTCAGGGCCCAAGG + Intronic
965249781 3:166327965-166327987 GGTTTTGTAGGCAGGGCCCATGG - Intergenic
966192888 3:177287466-177287488 GCCTTTGTATGAAAGGCCAAAGG + Intergenic
966735154 3:183181715-183181737 GGCTGTGTCTCCAGGGTCCATGG + Intronic
966767939 3:183479169-183479191 GGCTGTGTCTCCAGGGTCCATGG - Intergenic
969500771 4:7551458-7551480 GGCTGTGCATGCTGAGCCAGAGG + Intronic
969596430 4:8151783-8151805 GGCTGTGTAAGCAGGGGGAGAGG + Intronic
971095685 4:23399512-23399534 TGCTGATTATTCAGGGCCAAAGG + Intergenic
971679572 4:29679115-29679137 TGCTATGTGTGCAGAGCCAAGGG - Intergenic
977456178 4:97262878-97262900 CTCTGTGTATGAAGGGCCCATGG - Intronic
977854781 4:101876163-101876185 TGCTGTTTATTCAGGGCCAAGGG - Intronic
978287794 4:107098950-107098972 TGCTGGTTATACAGGGCCAAAGG - Intronic
985305270 4:188532816-188532838 TGCTTAGAATGCAGGGCCAAGGG + Intergenic
985350455 4:189055846-189055868 GGCTGTGTAGACAGGGCATATGG - Intergenic
985589293 5:756441-756463 GGCTGTGTGTGCAGGGCCGATGG - Intronic
985604010 5:849105-849127 GGCTGTGTGTGCAGGGCCGACGG - Intronic
985604022 5:849161-849183 GGCTGTGTATGCAGGGCCAATGG - Intronic
985635000 5:1031501-1031523 GGCGGTGTGTGCTGGGCCGAGGG + Intronic
985650840 5:1106646-1106668 GGATGTGTCTGCAGTGCCCAAGG + Intronic
987577644 5:19752040-19752062 GGGTGTGTATTCAAGGGCAACGG - Intronic
988370885 5:30365627-30365649 CGCTGAGGATGCAGGACCAAAGG + Intergenic
989694508 5:44183833-44183855 GGGTGTGTTTCCAAGGCCAATGG + Intergenic
990214251 5:53513399-53513421 TGCTGGTTATGCAGGGCCCAAGG + Intergenic
991192016 5:63885443-63885465 GTGTGTGTATCCAGTGCCAAAGG - Intergenic
992442365 5:76808194-76808216 TGCTGTGTATGCTGGGCCAGGGG - Intergenic
993060256 5:83030110-83030132 TGCTAACTATGCAGGGCCAAAGG - Intergenic
995513215 5:112928482-112928504 GGCTGTGTCTGCAGGGGCTGAGG - Intergenic
995686502 5:114778067-114778089 GGCTGTTTTTACATGGCCAAAGG - Intergenic
996432017 5:123391197-123391219 GGCTCTGTTTGGAGGGTCAAGGG + Exonic
997626683 5:135335947-135335969 GGATGTGAATCCAGGGCCACTGG - Intronic
998176038 5:139902693-139902715 GGATGTGTATGTAGGGGGAATGG + Intronic
1004902611 6:20208095-20208117 GGCTTTGCAAGCATGGCCAAGGG + Intronic
1005179653 6:23090222-23090244 GGCTGTGGATTCTGGGCAAATGG - Intergenic
1006176988 6:32128366-32128388 GACTGTGTAGGCGGGCCCAATGG + Intergenic
1007398674 6:41591418-41591440 GGCTGTTTCTGCAGGACTAATGG - Intronic
1009318105 6:62248813-62248835 TGCTGTGTTTGCAGTGGCAATGG - Intronic
1011637238 6:89385770-89385792 GGCTGTGGGAGCATGGCCAATGG - Intronic
1017913198 6:158812841-158812863 GGTTGGATATGCAGGGCCAAGGG - Intronic
1018298902 6:162378890-162378912 GGCTGTCTCTGCAGAGCCACAGG + Intronic
1019038407 6:169082740-169082762 GGCTGTGAAGGCAGAGGCAAGGG - Intergenic
1019188503 6:170235967-170235989 GGCTGTGAATGGAGAGCCAGGGG + Intergenic
1019513267 7:1429010-1429032 GGCGGGGTCTGCAGGGCCGAGGG + Intronic
1020553277 7:9635356-9635378 AGCTGTGTATATAGGGCTAAAGG - Intergenic
1022526474 7:31041161-31041183 GGCCGTGAATGCCAGGCCAAGGG - Intergenic
1023837649 7:44077732-44077754 AGCAGTGTGTGCAGGGCAAATGG - Intronic
1027937803 7:84632121-84632143 GGTTTTGTAGGCAGGGCCCATGG + Intergenic
1028086058 7:86639350-86639372 GGCTGGATATGCAGGGGCAATGG - Intergenic
1032799376 7:135306244-135306266 GGAGGAGTCTGCAGGGCCAAGGG + Intergenic
1034002656 7:147432770-147432792 GGCTGTGTTTGCAGGATGAAGGG - Intronic
1034822816 7:154232566-154232588 GGCTGTGTATGGAGAACCAATGG + Intronic
1035216393 7:157370886-157370908 GGGTGTGGATGCAGAGCCAGAGG + Intronic
1035295834 7:157866767-157866789 GGCCGTGTATCCAGGGCCTCAGG - Intronic
1035442078 7:158910295-158910317 GCCTGTGGGTGCAGGGCCATTGG + Intronic
1035732255 8:1861265-1861287 AGCTGTGTCTGCAGAGCCACAGG + Intronic
1036274461 8:7338292-7338314 GTCTGTGTCTTCAGCGCCAAGGG - Intergenic
1036346887 8:7972054-7972076 GTCTGTGTCTTCAGCGCCAAGGG + Intergenic
1036396543 8:8376202-8376224 GACTCTGTCTGCAGGGCAAAGGG - Intronic
1036936209 8:13004638-13004660 CGCTGGTTATTCAGGGCCAAAGG - Intronic
1037820201 8:22131487-22131509 GGCTGTGCCTGCCGGGCCACTGG + Exonic
1038726041 8:30083200-30083222 GGCGGTGTGGGCGGGGCCAAGGG + Exonic
1044066224 8:87703458-87703480 GGCTGACTATTCAGGGCCCAAGG - Intergenic
1044553198 8:93534760-93534782 TGCTGTGGATGCAGGTCCAGTGG - Intergenic
1049420224 8:142513167-142513189 GGCAGTGTCTGCAGAGCCACGGG + Intronic
1050352719 9:4755643-4755665 GGCTGTGTTTCCAGGGGCCATGG - Intergenic
1053161930 9:35819242-35819264 GGCTGTGTTTGCAGCGACATTGG + Exonic
1057177577 9:93011021-93011043 GGATGTGTCTGCAGGGTCAGAGG + Intronic
1060666693 9:125436050-125436072 GGCTGGGGATGCAGGGCTACAGG + Intergenic
1061283103 9:129608665-129608687 CCCTGTAGATGCAGGGCCAAGGG - Intergenic
1061806233 9:133139228-133139250 GGGTGTGTATCCAGGGCCTCTGG - Intronic
1062576205 9:137209573-137209595 GGCTGTGGACCCAGGGCCCATGG + Intronic
1062636158 9:137492782-137492804 GGCTGGGTGGGCAGGGCCATGGG + Intronic
1186999010 X:15156109-15156131 GGCTGTGTCTCCTGGGCCACTGG + Intergenic
1188046275 X:25428801-25428823 TGCTGGGTATTCAGGGCCCAAGG + Intergenic
1189533054 X:41907024-41907046 GGATGAGTAAGCAGGGCAAAAGG + Intronic
1189929674 X:45996029-45996051 TGCTGTTTATTCAGGGCCCAAGG + Intergenic
1190618481 X:52262400-52262422 GGCTGTGGATGCTGGGACATTGG - Intergenic
1190952676 X:55161725-55161747 GGCTGTGGATGCTGGGGCACTGG - Intronic
1191984110 X:66959999-66960021 GGCTGGTTATGCAGGGCCCAAGG + Intergenic
1193173050 X:78358579-78358601 TGCTGGTTATTCAGGGCCAAGGG + Intergenic
1194285713 X:92007820-92007842 TGCTGGTTATGCAGGGCCGAAGG + Intronic
1194839800 X:98726450-98726472 TCCTGTTTATTCAGGGCCAAGGG + Intergenic
1194841988 X:98754184-98754206 TGCTGTTTATTCAGGGCCCAAGG + Intergenic
1195909946 X:109879042-109879064 GGCTGTGTGTGCTGTGCTAAGGG + Intergenic
1196354607 X:114775822-114775844 GGCTTTTTATACAGGGCCAAGGG + Intronic
1196498061 X:116346154-116346176 TGCTGGTTATTCAGGGCCAAAGG + Intergenic
1197380846 X:125736901-125736923 TGCTGATTATTCAGGGCCAAAGG + Intergenic
1200411808 Y:2868442-2868464 GGCTGTGTCTCCAGGGCCCATGG - Intronic