ID: 985604344

View in Genome Browser
Species Human (GRCh38)
Location 5:850429-850451
Sequence GCCTTTCCTCGGCCACCTTC GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 203
Summary {0: 1, 1: 1, 2: 1, 3: 5, 4: 195}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985604344_985604347 -5 Left 985604344 5:850429-850451 CCCGAAGGTGGCCGAGGAAAGGC 0: 1
1: 1
2: 1
3: 5
4: 195
Right 985604347 5:850447-850469 AAGGCCCACGAAGACAGCCCAGG 0: 1
1: 0
2: 2
3: 15
4: 151
985604344_985604354 19 Left 985604344 5:850429-850451 CCCGAAGGTGGCCGAGGAAAGGC 0: 1
1: 1
2: 1
3: 5
4: 195
Right 985604354 5:850471-850493 CACCACCTGGAAGTAGTGCAGGG 0: 1
1: 1
2: 0
3: 11
4: 132
985604344_985604350 6 Left 985604344 5:850429-850451 CCCGAAGGTGGCCGAGGAAAGGC 0: 1
1: 1
2: 1
3: 5
4: 195
Right 985604350 5:850458-850480 AGACAGCCCAGGTCACCACCTGG 0: 1
1: 2
2: 4
3: 12
4: 240
985604344_985604355 20 Left 985604344 5:850429-850451 CCCGAAGGTGGCCGAGGAAAGGC 0: 1
1: 1
2: 1
3: 5
4: 195
Right 985604355 5:850472-850494 ACCACCTGGAAGTAGTGCAGGGG 0: 1
1: 1
2: 1
3: 14
4: 210
985604344_985604353 18 Left 985604344 5:850429-850451 CCCGAAGGTGGCCGAGGAAAGGC 0: 1
1: 1
2: 1
3: 5
4: 195
Right 985604353 5:850470-850492 TCACCACCTGGAAGTAGTGCAGG 0: 1
1: 1
2: 1
3: 9
4: 121

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985604344 Original CRISPR GCCTTTCCTCGGCCACCTTC GGG (reversed) Exonic
900095429 1:938235-938257 GCCTCCCCTCTGCCACCTGCTGG + Intronic
900095446 1:938292-938314 GCCTCCCCTCTGCCACCTGCTGG + Intronic
900394321 1:2446931-2446953 ACCTTTCCGGGGCCAGCTTCAGG + Intronic
901969448 1:12895649-12895671 GCCCTTCCTCCGCCTCCCTCTGG - Exonic
902015724 1:13306131-13306153 GCCCTTCCTCCGCCTCCCTCTGG + Intronic
902026756 1:13389834-13389856 GCCCTTCCTCCGCCTCCCTCTGG + Exonic
902030177 1:13416531-13416553 GCCTTTCCTCCGCCTTCCTCTGG + Exonic
902866556 1:19284023-19284045 GCATGACCTCGGCCACCCTCCGG - Exonic
908321903 1:62986724-62986746 TCCTTGCCTCTTCCACCTTCTGG - Intergenic
910103960 1:83610501-83610523 TCCTTCCCTCTTCCACCTTCTGG - Intergenic
911260249 1:95677393-95677415 GCCTTTCCTGCAACACCTTCTGG - Intergenic
912376219 1:109212058-109212080 CCCTTTCCTCTGCCTCCCTCAGG + Intergenic
912595650 1:110873177-110873199 GCCTTGTCTCGGCCACCTCAAGG + Exonic
913313547 1:117529932-117529954 CCCTTTCCTCCCCCAACTTCTGG + Intergenic
915357352 1:155263268-155263290 TCCTTTCTTCGCCCGCCTTCGGG - Exonic
915360557 1:155284157-155284179 GCCTTTCCTGGGCCTTCTTAGGG + Intronic
917156012 1:171999870-171999892 TCCTTGCCTCTGCCAACTTCTGG - Intronic
917661583 1:177181917-177181939 GCCACTCCTCGGCAACCTCCGGG - Intronic
917795555 1:178530315-178530337 GCCCATCCTCAGCCACCTTCTGG - Intronic
920562446 1:206948355-206948377 GCCTCTCCTTGCCCACCTTGTGG + Intergenic
920578102 1:207077970-207077992 GGCTCTCTTCTGCCACCTTCTGG + Intronic
922400529 1:225249525-225249547 CCCTTCCCTGGGCCACCATCTGG - Intronic
924757109 1:246951437-246951459 TCCTTGCCTCGCCCAGCTTCTGG - Intronic
1064458789 10:15513181-15513203 TTCTTCCCACGGCCACCTTCCGG - Intergenic
1064521738 10:16209954-16209976 GCCAATCCTCTGCCACCCTCTGG - Intergenic
1067176918 10:43956656-43956678 TCCTTTCCTCTTCCAGCTTCTGG + Intergenic
1078437278 11:11335830-11335852 TCCTTGCCTCAGCCAGCTTCTGG - Intronic
1078540793 11:12211499-12211521 ACCTTTCCTTAGCCACCTTTGGG - Intronic
1079510666 11:21206208-21206230 TCCTTGCCTCTTCCACCTTCTGG + Intronic
1083489535 11:63005739-63005761 TCCTTGCCTCTGCCAGCTTCTGG - Intronic
1084604579 11:70165097-70165119 GCCTTGCCTCTCCCAGCTTCTGG + Intronic
1086115930 11:83250170-83250192 GTCTTTCTCCTGCCACCTTCTGG + Intronic
1089343114 11:117773048-117773070 GAGTTTCCTTGGCCAGCTTCAGG + Intronic
1089353133 11:117832640-117832662 ACCTTCCCTCCACCACCTTCCGG + Intronic
1089453170 11:118610685-118610707 GCCCTTCCTTGGCCTCCTTCAGG + Intronic
1090080425 11:123608908-123608930 TCCTTCCCTCGGCCACCTCAGGG + Intronic
1092288368 12:7143105-7143127 TCCCTTCCTCTGCCACCTCCTGG + Intronic
1099923544 12:88988501-88988523 GCCTTCCCTAGGTCACTTTCTGG - Intergenic
1100725708 12:97406214-97406236 GGCTTTCCTGGGTCAACTTCAGG + Intergenic
1101326398 12:103719523-103719545 TCCTTTCCTCTTCCAGCTTCTGG + Intronic
1101334135 12:103781432-103781454 GCCTTCACTCGGCCACCCTTCGG + Intronic
1101836570 12:108299757-108299779 TCCTTGCCTCTGCCAGCTTCTGG - Intronic
1103205958 12:119129086-119129108 GCCCTTGCTCTGCCACTTTCAGG + Intronic
1103731652 12:123031840-123031862 GCCTTTCCCTGTGCACCTTCTGG - Intronic
1103905709 12:124326355-124326377 GCCTTCCCGCCGCCACCTGCAGG + Exonic
1104424562 12:128664674-128664696 GCCTTTCCTCTGGCCCCATCCGG - Intronic
1108765514 13:53624241-53624263 GCTCTTCCTAGGCCACCTTATGG + Intergenic
1109982987 13:69935164-69935186 GCATTTCCTGTGCCACCTACTGG + Intronic
1112447985 13:99483990-99484012 CCCTTTCCACACCCACCTTCAGG + Intergenic
1113104541 13:106758513-106758535 GCCTTCCCTCTTCCAGCTTCTGG + Intergenic
1113570037 13:111346973-111346995 GCCCTTCCTCGGCTACCCTGAGG - Intergenic
1113778776 13:112963845-112963867 GCCCTGCCTCTGCCAGCTTCTGG - Intronic
1115834577 14:37385508-37385530 GCCATTCTTAGGCCACTTTCAGG - Intronic
1118280125 14:64420684-64420706 GCCTTGCCACGTTCACCTTCTGG + Intronic
1119324900 14:73753982-73754004 GCCCTTCCTCAGCCTCCCTCTGG - Intronic
1121507751 14:94489613-94489635 GGCTTACCTCGCCCACTTTCAGG + Exonic
1124112428 15:26804438-26804460 CCCTTTCCTCAGCCAAGTTCTGG + Intronic
1125836004 15:42752007-42752029 TTCTTTCCTCGGCCACCACCAGG - Exonic
1130035727 15:80359776-80359798 GCCCTTCCTCGGCCACCCTCTGG + Intronic
1131881029 15:96862377-96862399 GCATTTCCTCAGCAGCCTTCAGG - Intergenic
1131960790 15:97788375-97788397 GACTTTCCAGGGCCACCTTGCGG - Intergenic
1132551003 16:553792-553814 GCCTGGCCTCGGCCCCCGTCGGG - Exonic
1133342525 16:5045897-5045919 GCCTTTCCTGGAACACCTCCAGG - Intronic
1134135301 16:11673267-11673289 GCCTCTCCCCTGCCACCATCCGG - Intronic
1138480391 16:57298949-57298971 GCCTTTCCTCTTCCAGCTGCTGG - Intergenic
1138928678 16:61624414-61624436 GAATGTCCTTGGCCACCTTCAGG - Intergenic
1140718422 16:77748312-77748334 TCCTTTCCTCTTCCAGCTTCCGG - Intergenic
1141277049 16:82597690-82597712 TCCTTTCCTTTCCCACCTTCTGG - Intergenic
1142161806 16:88561742-88561764 TCCTTTCCCCGGCCTCCTTGGGG + Intergenic
1142442310 16:90106685-90106707 ACCTTTCCTCGGGCAGCCTCGGG - Intergenic
1143248459 17:5504780-5504802 GCCTTTCCCAGGCCGCATTCTGG + Intronic
1144762922 17:17717500-17717522 GCATTTCCTCAGGCACCCTCTGG + Intronic
1147663519 17:42130284-42130306 GCATTTCTTTGGCAACCTTCAGG + Intronic
1148211374 17:45810824-45810846 GTCTTTGCTCGGCCACCTCATGG - Intronic
1148745859 17:49917774-49917796 ACCTTTCCTGGGCCCCCATCTGG + Intergenic
1149595600 17:57862810-57862832 CCCTTTCCTCAGCTCCCTTCTGG - Exonic
1150069290 17:62138346-62138368 GCATCTCCCGGGCCACCTTCTGG + Intergenic
1150103527 17:62444611-62444633 GGCTGTCCTCGGGCCCCTTCAGG + Intronic
1152353963 17:79797862-79797884 CCCTGCCCTCGGCCACCCTCCGG + Intronic
1152424838 17:80213322-80213344 GCCTTTCCTCTTCCAACTTCTGG - Intronic
1153792827 18:8595532-8595554 TCCTTTCCTCCCCCAGCTTCTGG + Intergenic
1154008521 18:10556248-10556270 GACTGTCCTCAGCCACCATCAGG - Intergenic
1157421731 18:47553656-47553678 ACCTTTCCTGGGCCTCCCTCTGG + Intergenic
1157623723 18:49031385-49031407 GCTCTTCCTGGGCCCCCTTCAGG + Intergenic
1158448897 18:57546148-57546170 CCTGTTCCTGGGCCACCTTCAGG + Intergenic
1160102262 18:75934012-75934034 GGCCTTCCTCAGCCAACTTCAGG + Intergenic
1160155432 18:76430071-76430093 GAACTTCCTGGGCCACCTTCTGG + Intronic
1160393958 18:78558614-78558636 GCCTTCCCTCATCCACTTTCTGG + Intergenic
1160726901 19:621381-621403 GCATCTCCCGGGCCACCTTCTGG + Exonic
1163203904 19:15788320-15788342 GCCTTGCCTCTTCCAGCTTCTGG + Intergenic
1163248279 19:16110798-16110820 GCCCGCCCTCGGCCACCTTAGGG - Intergenic
1166782984 19:45352001-45352023 GCCGTGCCTGGGCCACCTGCTGG + Intronic
1167085535 19:47307229-47307251 TCCTTGCCTCTCCCACCTTCAGG - Intronic
927676470 2:25110181-25110203 TCCCTTCCTCTGCCACCCTCCGG + Intronic
929863492 2:45698764-45698786 GTCTGTCCTTGGCCACCCTCAGG - Intronic
932083598 2:68737796-68737818 CCCTTTCCTGGGTCACATTCTGG - Intronic
933678254 2:85076874-85076896 TCCTTCCCTGGGCCACCTTAAGG - Intergenic
935000615 2:99011041-99011063 GGCTTGCCACGGCCACCTTGGGG - Intronic
935197144 2:100823818-100823840 TCCTTTCCTGGGCCCCTTTCTGG - Intronic
938690361 2:133782854-133782876 TCCTTTCCTCTTCCAGCTTCTGG + Intergenic
941284594 2:163593739-163593761 GCCTTTCCTCCATCAGCTTCTGG + Intronic
948243454 2:236457784-236457806 TCCTTGCCTCTGCCAGCTTCTGG - Intronic
1168965796 20:1897130-1897152 GCCTTTCCTGGGGCACCGGCTGG + Intronic
1175228432 20:57458947-57458969 GCCTTCCCTCAGCCAGCTTTGGG + Intergenic
1175467315 20:59198108-59198130 AAGTTTCCTCGGCCACCTCCAGG - Intronic
1175939339 20:62530755-62530777 GCCTTCCCTCGAACCCCTTCAGG - Intergenic
1176410879 21:6448839-6448861 AACTTTCCTGGGCCACCCTCAGG + Intergenic
1179112589 21:38460238-38460260 GCCTTTCCTGGTTCACCTCCTGG - Intronic
1179451112 21:41469048-41469070 GCCTCCCCTCGGGCATCTTCTGG + Intronic
1179654325 21:42835807-42835829 GGCTTTCCTTGGCCTCCCTCTGG + Intergenic
1179686372 21:43057161-43057183 AACTTTCCTGGGCCACCCTCAGG + Intronic
1180604474 22:17046516-17046538 GCCTTACCTGGGCAACCTTGGGG + Intergenic
1181589921 22:23877700-23877722 GCCTCTCCTCTGCCTCCTTAGGG + Exonic
1182536658 22:31008759-31008781 TACTTTCCTCTTCCACCTTCTGG - Intergenic
1184265159 22:43342764-43342786 CCCTTTCCCCGTCCACCTCCTGG + Intronic
1184766818 22:46576661-46576683 GCCTTTCCTCGACCGCCTCGCGG - Intronic
1184860346 22:47169946-47169968 GCCATCCCTCGGTCACATTCAGG - Intronic
957989585 3:87612023-87612045 GCTTTTCCTGGGTGACCTTCAGG + Intergenic
960672579 3:120167375-120167397 GCCTTTCTTCGCCAGCCTTCTGG - Exonic
960971458 3:123142903-123142925 TCCTTTCATCTGCCACCTCCAGG + Intronic
966400103 3:179539030-179539052 TCCTTTCCTCTTCCAGCTTCTGG - Intergenic
967102881 3:186230688-186230710 GGATTTCCTCAGCCACCCTCTGG - Intronic
968362582 3:198157649-198157671 ACCTTTCCTCGGGCAGCCTCGGG - Intergenic
968693507 4:2008743-2008765 GCCTTACCTCGTCCACCGTGCGG + Exonic
970953252 4:21780865-21780887 TCCTTTCCTCTTCCAGCTTCAGG + Intronic
973973250 4:56236283-56236305 TCCTTTCCTCTTCCAGCTTCAGG - Intronic
975526272 4:75353857-75353879 TCCTTTCCTCTCCCAGCTTCTGG - Intergenic
978033908 4:103971726-103971748 GACTTTCCTGGGCCACTCTCTGG + Intergenic
985591286 5:766746-766768 GCCTTTCCTTGGCCACCTTCAGG - Exonic
985604344 5:850429-850451 GCCTTTCCTCGGCCACCTTCGGG - Exonic
985762294 5:1755748-1755770 GCCTGTCCTCAGCCAGCCTCAGG - Intergenic
987181585 5:15373563-15373585 GCCTTGCCTCTTCCACCTTCTGG + Intergenic
988644602 5:33080466-33080488 TCCTTTCCTCTTCCAGCTTCTGG - Intergenic
991503545 5:67301460-67301482 GCCTTTCCAGGGCCGCCCTCAGG + Intergenic
997421044 5:133766981-133767003 GCCTTTCCTTGACCATCTCCTGG - Intergenic
997518760 5:134508764-134508786 GCCTTGCCTCTTCCAGCTTCTGG - Intergenic
997980339 5:138464594-138464616 GCCTTGCCTCTGCCACCTGTCGG - Intergenic
998283367 5:140834698-140834720 GCCTTTCCACGATCACCTCCAGG - Exonic
999462711 5:151771125-151771147 GCCTTCCACCGGCGACCTTCCGG + Intronic
999582737 5:153057731-153057753 GCTTTTCCCCTTCCACCTTCTGG - Intergenic
999720294 5:154394492-154394514 GCCTTGGCACTGCCACCTTCCGG - Intronic
1001648732 5:173300670-173300692 TCCGTTCCTTGGCCAGCTTCTGG + Intergenic
1004750083 6:18553736-18553758 TCCTTGCCTCTTCCACCTTCTGG - Intergenic
1004881588 6:20013745-20013767 GCCTTTCCTCTGTCCCTTTCTGG + Intergenic
1006720345 6:36145922-36145944 GGCTTTCATGGGTCACCTTCTGG - Intergenic
1007288475 6:40765688-40765710 GCCTGTCCCCGACCTCCTTCTGG + Intergenic
1013188170 6:107779863-107779885 GCCTTTCCTCGTCCACACACTGG + Intronic
1014925734 6:127267400-127267422 GCCTTTACCCGGGGACCTTCTGG + Intronic
1016397520 6:143641368-143641390 TCCTTTCCTCCTCCAGCTTCTGG - Intronic
1018103446 6:160461896-160461918 GCCTTCTCTCAGCCAGCTTCAGG + Intergenic
1018111736 6:160543151-160543173 GCCTTCTCTCAGCCAGCTTCAGG + Intronic
1018745903 6:166761978-166762000 GGTTATCCTCGGCCACTTTCTGG - Intronic
1019253100 7:31058-31080 ACCTTTCCTCGGGCAGCCTCGGG + Intergenic
1021232365 7:18101283-18101305 TCCTTTCCTGGGCCACAATCTGG + Intronic
1022793263 7:33710848-33710870 TCCTCTCCTCTGCCAGCTTCTGG + Intergenic
1023000362 7:35801614-35801636 GCCTTTCCTCAGTCTCCTCCCGG + Intronic
1023727775 7:43162363-43162385 GCCTTTCCTCTCCTAGCTTCTGG + Intronic
1023794975 7:43784370-43784392 CCCTTTCCTCTGCCTCCTACTGG + Intronic
1026567000 7:71497426-71497448 GTCTTTCCTCAGTCACATTCTGG + Intronic
1026915834 7:74120015-74120037 TCCTTGCCTCTTCCACCTTCTGG + Intronic
1027266429 7:76497505-76497527 GCCTTTGCTAAGCCTCCTTCCGG + Intronic
1027268209 7:76505385-76505407 GCCTCTTCCAGGCCACCTTCAGG - Exonic
1027317809 7:76995623-76995645 GCCTTTGCTAAGCCTCCTTCCGG + Intergenic
1029257553 7:99279764-99279786 GCTTTTCTCAGGCCACCTTCAGG + Intergenic
1030661845 7:112228073-112228095 TCCTTTCCTCTTCCAGCTTCTGG + Intronic
1033121261 7:138668740-138668762 CCCCTTCCCCTGCCACCTTCCGG + Intronic
1034858138 7:154573165-154573187 GCCTTTCCTGGGCCCACCTCTGG + Intronic
1036504040 8:9339208-9339230 GATTTTCCTGGGCCACCTTGAGG + Intergenic
1036643425 8:10598025-10598047 CCATTTCCTCAGCCACCCTCTGG + Intergenic
1036727443 8:11232156-11232178 ACCTTTCCTCTGACACCTACTGG + Intergenic
1037492762 8:19411523-19411545 GCCTTTGCTGGGCCACTTGCTGG - Intronic
1038564120 8:28605558-28605580 GCAGTTCCTCGTCTACCTTCAGG + Intronic
1039575174 8:38617629-38617651 TCCTTTCCTCCTCCATCTTCTGG + Intergenic
1040807340 8:51408835-51408857 GGCTTTCCTTGGCCTCCCTCCGG - Exonic
1041812417 8:61926404-61926426 TCCTTGCCTCGTCCAGCTTCTGG - Intergenic
1042344954 8:67717869-67717891 CCCTTGCCTCTTCCACCTTCTGG - Intronic
1043530801 8:81147921-81147943 GGCCTTCCTTGGCCACTTTCTGG - Intergenic
1044938656 8:97318188-97318210 TCCTTGCCTCTTCCACCTTCTGG + Intergenic
1045305111 8:100951588-100951610 GCCATGCCTCGTCCACCTTCGGG + Intronic
1045468514 8:102490490-102490512 GCCTTGCCTCTTCCAGCTTCTGG - Intergenic
1047232179 8:123007080-123007102 GCCTTGCCTCTTCCAGCTTCCGG + Intergenic
1048202888 8:132391484-132391506 GCCATTACCCGGCCACCTGCTGG - Intronic
1049232097 8:141489768-141489790 ACCTGTCCTGGGCCACCTCCTGG + Intergenic
1049372645 8:142275068-142275090 CCCTTCCCTGGGCCACCTCCAGG - Intronic
1050905251 9:10994843-10994865 GCCTTTCCTCTCCCACCATATGG + Intergenic
1051414452 9:16824475-16824497 GCCTGTCCTCAGTCACCTCCTGG + Intronic
1051906598 9:22102529-22102551 TCCTTGCCTCTTCCACCTTCTGG + Intergenic
1053265811 9:36712502-36712524 GCCTTTCCTCTGTCTCTTTCTGG + Intergenic
1056617396 9:88180222-88180244 GACTTTCCTCTTCCTCCTTCTGG + Intergenic
1057063157 9:92023802-92023824 GCCTTGCCTCCTCTACCTTCTGG + Intergenic
1058507359 9:105679873-105679895 ATCTTTCCACAGCCACCTTCCGG - Intergenic
1059632576 9:116140453-116140475 GCCTTTGATGGGCCACCATCTGG + Intergenic
1060520783 9:124292772-124292794 GCCTCTCCTCTGCCAACTGCTGG + Intronic
1060986001 9:127819350-127819372 TCCTTTCTTAGGCCACCTTTGGG + Intronic
1061300170 9:129699767-129699789 TTCTTTCCTTGGGCACCTTCAGG + Intronic
1061787931 9:133041983-133042005 GCCTTTCCTGGATCACCGTCAGG + Intronic
1062607511 9:137354814-137354836 GCCTCACCACGGCCTCCTTCTGG + Intronic
1062747270 9:138221308-138221330 ACCTTTCCTCGGGCAGCCTCGGG - Intergenic
1186186914 X:7029682-7029704 GCATTTCACAGGCCACCTTCTGG + Intergenic
1187341486 X:18425464-18425486 GCCTTTACCCCGCCCCCTTCTGG - Intergenic
1188325859 X:28800110-28800132 TCCTTGCCTCTTCCACCTTCTGG + Intronic
1195927522 X:110040706-110040728 CCCTTTGCTCAGCCACCCTCTGG + Intronic
1196860532 X:120023351-120023373 GGCTTTCTTAGGCCTCCTTCTGG - Intergenic