ID: 985604597

View in Genome Browser
Species Human (GRCh38)
Location 5:851663-851685
Sequence ATGTGACACCAGGCGGATGC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 77
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 70}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985604590_985604597 -6 Left 985604590 5:851646-851668 CCTCCCTGGTCCTCTAAATGTGA 0: 1
1: 0
2: 1
3: 8
4: 186
Right 985604597 5:851663-851685 ATGTGACACCAGGCGGATGCGGG 0: 1
1: 0
2: 0
3: 6
4: 70
985604592_985604597 -10 Left 985604592 5:851650-851672 CCTGGTCCTCTAAATGTGACACC 0: 1
1: 0
2: 1
3: 5
4: 90
Right 985604597 5:851663-851685 ATGTGACACCAGGCGGATGCGGG 0: 1
1: 0
2: 0
3: 6
4: 70
985604591_985604597 -9 Left 985604591 5:851649-851671 CCCTGGTCCTCTAAATGTGACAC 0: 1
1: 0
2: 0
3: 5
4: 118
Right 985604597 5:851663-851685 ATGTGACACCAGGCGGATGCGGG 0: 1
1: 0
2: 0
3: 6
4: 70
985604585_985604597 30 Left 985604585 5:851610-851632 CCATGATACAGTGGCTCTGCGCT 0: 1
1: 0
2: 0
3: 6
4: 77
Right 985604597 5:851663-851685 ATGTGACACCAGGCGGATGCGGG 0: 1
1: 0
2: 0
3: 6
4: 70
985604589_985604597 6 Left 985604589 5:851634-851656 CCTTTGGTGGCTCCTCCCTGGTC 0: 1
1: 0
2: 1
3: 27
4: 216
Right 985604597 5:851663-851685 ATGTGACACCAGGCGGATGCGGG 0: 1
1: 0
2: 0
3: 6
4: 70

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985604597 Original CRISPR ATGTGACACCAGGCGGATGC GGG Intronic
901175038 1:7292942-7292964 ATGTCACACCAGGCAGAGGTTGG + Intronic
905360460 1:37415962-37415984 ATGAGTCACCATGCGGATGCTGG - Intergenic
906209265 1:44003091-44003113 ATGTCACACAAGGTGGCTGCTGG - Intronic
907860578 1:58349019-58349041 ATGGGACAGCAGGCGGAGGCAGG - Intronic
911694344 1:100871703-100871725 ATGTCTCACCTGGTGGATGCAGG + Intergenic
915606728 1:156956706-156956728 ATGGGACAGCAGGCAGAAGCTGG + Intronic
917565576 1:176208713-176208735 AGGTGACACCAGTCGGAAACTGG + Intergenic
921621722 1:217332890-217332912 GAGTGACATCAGGTGGATGCAGG + Intergenic
922209250 1:223474918-223474940 ATGTGACCCCAGGCTTCTGCTGG - Intergenic
1062947504 10:1472610-1472632 TTGTGAGACCAGGAGGCTGCTGG - Intronic
1063135942 10:3216341-3216363 ATGTGAGACCCAGGGGATGCAGG + Intergenic
1063941159 10:11130994-11131016 ATGTAACAACAGTTGGATGCTGG - Intronic
1066413429 10:35196129-35196151 ATTTCTCACCAGGCGCATGCAGG - Intronic
1069070307 10:63985246-63985268 ATCAGAAGCCAGGCGGATGCTGG + Intergenic
1069955094 10:72045006-72045028 CTGTGGCCCCAGGCGGATCCCGG - Intergenic
1075679365 10:124321525-124321547 AGGTGAGACCCGGCGGATGCAGG + Intergenic
1076181329 10:128411207-128411229 AGGTGACACCAGGCACATCCAGG - Intergenic
1078666538 11:13330506-13330528 ATGTGGCTGCAGGCCGATGCTGG - Intronic
1083638410 11:64132584-64132606 ATCTGCCACCAGGAAGATGCAGG + Intronic
1083723148 11:64613516-64613538 AAGTGGCACCAGGAGGCTGCTGG - Intronic
1085252471 11:75152770-75152792 ATGGCCCACCAGGCAGATGCTGG - Intronic
1085269563 11:75262284-75262306 ATGTGACACCAGGCCTAGGAGGG + Intergenic
1088714150 11:112534112-112534134 AAGTGACCCCAGGTGGAGGCTGG + Intergenic
1096257778 12:50073494-50073516 ATGTGACTCCAGGCAGAGTCCGG - Intronic
1102245129 12:111351072-111351094 ATGTGACAACAGCCAGATGAGGG + Intergenic
1102616259 12:114157226-114157248 ATGTCAGACCAGGAGGATGTTGG + Intergenic
1105287215 13:19014191-19014213 ATGTGAAACCATGTGGATGGAGG - Intergenic
1107819541 13:44273717-44273739 ATGTGACACCAGTCAGGTGTTGG - Intergenic
1110682334 13:78330224-78330246 ATGTGACATCAGTTTGATGCTGG - Intergenic
1122749424 14:103921634-103921656 CTGCGACACCAGGCGGCCGCCGG - Intronic
1126870125 15:52978514-52978536 ATGTGGAACCTGGCGGCTGCTGG + Intergenic
1129116176 15:73366717-73366739 ATGAGAGACCAAGCAGATGCTGG + Intronic
1138861805 16:60767045-60767067 ATGTGATATAAGGCAGATGCAGG + Intergenic
1141716905 16:85732103-85732125 ATGTGCCACAAGGCAGAGGCTGG + Intronic
1151832860 17:76565740-76565762 ATGTGCCACCAGGAGGATTTGGG + Exonic
1152553052 17:81039381-81039403 ATGGGACACCAAGCGAACGCTGG - Intronic
1153416113 18:4847698-4847720 TTGTGACAGAAGGAGGATGCTGG + Intergenic
1156519031 18:37705968-37705990 GTGAGACACCAGCAGGATGCTGG + Intergenic
1162341647 19:10094860-10094882 CAGTGACACCAGTAGGATGCTGG - Exonic
1167254160 19:48417344-48417366 AGGTGACAGCAGACAGATGCAGG + Intronic
928912354 2:36434946-36434968 ATGTGTCACCAGGCGAGTGAAGG - Intronic
931007567 2:57869454-57869476 ATGTGAGACCACTCGGTTGCAGG + Intergenic
931434698 2:62236316-62236338 ATGTGACAGCAGGGGGCTGTCGG - Intergenic
933028974 2:77301654-77301676 ATGAGACACCAGAGGAATGCAGG + Intronic
933813422 2:86047677-86047699 ATGTGACATGATGCGGATGTTGG - Intronic
946023822 2:216659927-216659949 CAGTGACAGCAGGGGGATGCTGG + Intronic
1172386053 20:34534944-34534966 ATGGGACACCAGCTGGAGGCTGG - Intronic
1172917026 20:38450813-38450835 AAGTCACACCAGGAGGAGGCGGG - Intergenic
1173299882 20:41793123-41793145 ATGAAAAACCAGGCGGGTGCTGG + Intergenic
1174590426 20:51640573-51640595 ACTTTACACCAGGCGGATCCAGG - Intronic
1179080961 21:38170333-38170355 CTGAGACAACAGGTGGATGCTGG + Intronic
1184242195 22:43217114-43217136 AGGTGACACCTGGCGGATGGGGG - Intronic
957118395 3:76057178-76057200 ATCTGATACTAGGCGTATGCGGG + Intronic
966331320 3:178818077-178818099 ATGGGGCACCTGGTGGATGCAGG - Intronic
968467855 4:761870-761892 CAGTGACACCATGGGGATGCAGG + Intronic
970511894 4:16789183-16789205 ATCAGACACCAGGCAGATGCTGG + Intronic
971381053 4:26098010-26098032 ATGTGAATCCAGGGGGATGGAGG + Intergenic
972810580 4:42581620-42581642 ACATGACACCAAGCTGATGCAGG - Exonic
973710778 4:53628505-53628527 ATGTGACAAAAGGGGAATGCTGG + Intronic
981011504 4:139929979-139930001 ATGGGAAAGCAGGTGGATGCAGG - Intronic
985604597 5:851663-851685 ATGTGACACCAGGCGGATGCGGG + Intronic
987097736 5:14565157-14565179 GTGTGACACCAGGCAGACCCAGG - Intergenic
1008108579 6:47467479-47467501 ATGTGAGACAAGGCAGATGATGG + Intergenic
1015292891 6:131558627-131558649 ATGAAACACCAGGCAGATGTCGG + Intergenic
1019732970 7:2637701-2637723 ATGTGACAGCGGGTGGATGGTGG + Intronic
1020355851 7:7274807-7274829 ATGTGACACCAGTGAGATGCAGG + Intergenic
1026306081 7:69143081-69143103 ATGTGAGACCACCCCGATGCAGG - Intergenic
1032191865 7:129770225-129770247 CTGTGACCTCAGGGGGATGCAGG + Intergenic
1034227800 7:149497119-149497141 AGGTGCCACCAGGCCGCTGCGGG + Intronic
1038269561 8:26064261-26064283 AGGTGACACCAGATGGATGATGG + Intergenic
1049354217 8:142179677-142179699 ATGTGTCACCAGGGGCCTGCTGG - Intergenic
1049638354 8:143701688-143701710 ATGGGACAGCATGCGGTTGCTGG - Intronic
1049719889 8:144110941-144110963 GTGGGACACCAGGCAGAGGCGGG - Exonic
1059784346 9:117564281-117564303 CTGTGACACCATGTGGAAGCGGG + Intergenic
1062620081 9:137416707-137416729 AGGTGGCACCAGGCGGTTCCAGG + Intronic
1185505057 X:627173-627195 ATTTTACAGCAGGCGGCTGCAGG - Intronic
1192001516 X:67156863-67156885 ATGAGACACCAGGCTAATGGAGG - Intergenic