ID: 985606779

View in Genome Browser
Species Human (GRCh38)
Location 5:862154-862176
Sequence CTGATCCTGCAGGACTTAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 221
Summary {0: 1, 1: 0, 2: 0, 3: 21, 4: 199}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985606779_985606794 25 Left 985606779 5:862154-862176 CCCTCTAAGTCCTGCAGGATCAG 0: 1
1: 0
2: 0
3: 21
4: 199
Right 985606794 5:862202-862224 GCAGCCCAAGGGGCAGCGGGAGG 0: 1
1: 0
2: 6
3: 43
4: 483
985606779_985606789 14 Left 985606779 5:862154-862176 CCCTCTAAGTCCTGCAGGATCAG 0: 1
1: 0
2: 0
3: 21
4: 199
Right 985606789 5:862191-862213 CCCGTATCTGCGCAGCCCAAGGG No data
985606779_985606791 15 Left 985606779 5:862154-862176 CCCTCTAAGTCCTGCAGGATCAG 0: 1
1: 0
2: 0
3: 21
4: 199
Right 985606791 5:862192-862214 CCGTATCTGCGCAGCCCAAGGGG No data
985606779_985606793 22 Left 985606779 5:862154-862176 CCCTCTAAGTCCTGCAGGATCAG 0: 1
1: 0
2: 0
3: 21
4: 199
Right 985606793 5:862199-862221 TGCGCAGCCCAAGGGGCAGCGGG 0: 1
1: 0
2: 2
3: 26
4: 200
985606779_985606792 21 Left 985606779 5:862154-862176 CCCTCTAAGTCCTGCAGGATCAG 0: 1
1: 0
2: 0
3: 21
4: 199
Right 985606792 5:862198-862220 CTGCGCAGCCCAAGGGGCAGCGG 0: 1
1: 1
2: 1
3: 27
4: 296
985606779_985606787 13 Left 985606779 5:862154-862176 CCCTCTAAGTCCTGCAGGATCAG 0: 1
1: 0
2: 0
3: 21
4: 199
Right 985606787 5:862190-862212 CCCCGTATCTGCGCAGCCCAAGG 0: 1
1: 0
2: 0
3: 8
4: 118
985606779_985606784 -10 Left 985606779 5:862154-862176 CCCTCTAAGTCCTGCAGGATCAG 0: 1
1: 0
2: 0
3: 21
4: 199
Right 985606784 5:862167-862189 GCAGGATCAGCTGACCAGGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985606779 Original CRISPR CTGATCCTGCAGGACTTAGA GGG (reversed) Intronic
900017317 1:161403-161425 GTGATCCTGTTGGACTTTGATGG - Intergenic
900047576 1:519999-520021 GTGATCCTGTTGGACTTTGATGG - Intergenic
900069789 1:761867-761889 GTGATCCTGTTGGACTTTGATGG - Intergenic
901089657 1:6632842-6632864 CTGGCCCTGCAGGCCTGAGAAGG + Exonic
901932422 1:12603960-12603982 CTGAGCCTGTAGGACTTGGATGG + Intronic
902085184 1:13854693-13854715 CTGCTCCTGCATGAGTGAGATGG + Intergenic
903574125 1:24327517-24327539 CTGAACCTGCAGCACATAGAAGG - Intronic
904438358 1:30513902-30513924 ATGATGCAGCTGGACTTAGAGGG - Intergenic
905498692 1:38418615-38418637 CTGATGCTGCAGGGCTGGGAGGG + Intergenic
905654396 1:39676783-39676805 CCGATCATGCAGGACCTGGAGGG + Intergenic
906701324 1:47860221-47860243 CTGAGCCTTCAGGAATTTGAAGG - Intronic
906769349 1:48470955-48470977 CTGTGCCTGCAGGACTAAAACGG + Intronic
907707465 1:56845282-56845304 CTGGTCCTGCAGTTCTAAGAGGG + Intergenic
909725537 1:78830368-78830390 CTGACCGAGCAGGACTTTGAAGG - Intergenic
910170474 1:84371795-84371817 CTGATTCTGTAGGACTGAGGTGG - Intronic
910586745 1:88889162-88889184 CTGATCCAGGGAGACTTAGATGG + Intronic
913686391 1:121236030-121236052 GTGATCCTGTTGGACTTGGATGG + Intronic
914038242 1:144023667-144023689 GTGATCCTGTTGGACTTGGATGG + Intergenic
914151213 1:145044240-145044262 GTGATCCTGTTGGACTTGGATGG - Intronic
917734365 1:177907122-177907144 GTGCTCCTGCAGGGCTGAGATGG - Intergenic
919687840 1:200500827-200500849 CTGCTCCTGCGTGACTGAGAGGG + Intergenic
920473713 1:206254584-206254606 GTGATCCTGTTGGACTTGGATGG + Intronic
921772766 1:219061598-219061620 CTGATTCTACAGGAATTAAAAGG + Intergenic
922105162 1:222507336-222507358 GTGATCCTGTTGGACTTTGATGG - Intergenic
922265476 1:223979855-223979877 GTGATCCTGTTGGACTTTGATGG - Intergenic
924347334 1:243084857-243084879 GTGATCCTGTTGGACTTTGATGG - Intergenic
1063207769 10:3850877-3850899 CTGATCGTGGAGGACTGAGAGGG + Intergenic
1063671084 10:8100706-8100728 CTCCTCTTGCAGGACCTAGAGGG + Intergenic
1063774751 10:9250001-9250023 CTGATCCTGCAGAAATTCAAAGG + Intergenic
1064547409 10:16464722-16464744 CTGATACTGGAGGAATGAGAAGG - Intronic
1064938924 10:20711565-20711587 CTAAGCCTGCAGGAGTTGGAGGG - Intergenic
1065390729 10:25177894-25177916 AGGATCCTGCAGGAATTAGGAGG - Intronic
1069956238 10:72053726-72053748 CCTATCCTGCAGCAGTTAGAGGG - Intergenic
1070058983 10:72963587-72963609 CTGATTCTGCAGAAATTCGAAGG - Intergenic
1071259583 10:83908060-83908082 CTGATGCTGCAGGCCAAAGAGGG - Intergenic
1072742728 10:97919671-97919693 CTGATTCAGCAGGTCTTAGGGGG - Intronic
1073039001 10:100586630-100586652 CTGATCCTTCAGGACATAGCAGG - Intergenic
1073118635 10:101107968-101107990 CTGGTCATGCAGGACTTTGCTGG - Intronic
1074964241 10:118474560-118474582 CTGATCCTGTAGGTCTTGGGTGG + Intergenic
1075685809 10:124364507-124364529 CTGCTGCTGCAGGAGGTAGATGG - Intergenic
1076297459 10:129397664-129397686 CGGATCCTGCAGGACTTTGTGGG - Intergenic
1076973918 11:156631-156653 GTGATCCTGTTGGACTTTGATGG - Intergenic
1078110084 11:8385352-8385374 CAGGTCCTGCAGGATTTAGGGGG - Intergenic
1080488850 11:32740506-32740528 CTGATACTGCAGAAATTTGAAGG - Intronic
1081925050 11:46819387-46819409 CAGATCATGCAGGACTATGAAGG + Intronic
1089298459 11:117483624-117483646 CTGACCCAGCAAGACTTAAATGG + Intronic
1090138026 11:124220293-124220315 CTGATCCTGCAGGTCTGAGTGGG - Intergenic
1090721459 11:129477964-129477986 CTGATAAAGCAGCACTTAGAAGG - Intergenic
1090947128 11:131440569-131440591 CTGATTCTGTAGGTCTTGGATGG + Intronic
1093617503 12:21244792-21244814 CTGATACTGCAGGAATTCCAAGG + Intergenic
1097301726 12:58026294-58026316 CTGATTCAGCAGGACTGGGATGG + Intergenic
1099051282 12:77784272-77784294 CTGATCCTGCTGGGCCTAGCTGG + Intergenic
1099842306 12:87981449-87981471 CTGATTCAGCAGGTCTGAGATGG + Intronic
1100037431 12:90269916-90269938 CTAATCCTGAAGGCCTGAGAAGG + Intergenic
1101798769 12:108002320-108002342 CTGATCCTGTAGGACCTTGAGGG - Intergenic
1105710235 13:23001000-23001022 CTGATCCTGGAAGAGTCAGAAGG - Intergenic
1106602368 13:31199269-31199291 CTGTTCCCGCAGGACTGCGAAGG - Intergenic
1109755590 13:66755351-66755373 CTGAACCTGCAGGACATAGTTGG + Intronic
1114294564 14:21317360-21317382 CTAATCCGGCAGGCCTGAGAAGG + Intronic
1115223315 14:31078772-31078794 GTGATTATGCAGGACTTGGACGG + Intronic
1117247683 14:53902034-53902056 CTGATTCTGCAGGTCTTGGGTGG - Intergenic
1120656210 14:87192853-87192875 CTGATTCATCAGGAATTAGAAGG - Intergenic
1121450626 14:94004838-94004860 CTGATCCTGCAGGAAAGAGAAGG - Intergenic
1128548829 15:68584760-68584782 CTGAGCCTGCAGGGCCTACAGGG - Intronic
1131306524 15:91248749-91248771 CTGATCCAGCAGGCCTGAGATGG - Intronic
1132155429 15:99492541-99492563 CGGATCCTCCAGGACTGAGGAGG + Intergenic
1132299021 15:100765169-100765191 CTCATCCTGCAGGGTTTAGAGGG - Intergenic
1134343152 16:13363925-13363947 CTGATCCAGCAGGTCTGGGAGGG - Intergenic
1135154382 16:20039936-20039958 CTGATACTGCATGACTTCTAAGG + Intronic
1135688938 16:24520916-24520938 CTGATTCAGCAGGTCTTTGAGGG - Intergenic
1138019707 16:53467146-53467168 CTGATACTGGAGGACTTGGAAGG + Exonic
1139320377 16:66109573-66109595 CTGATCTTGCAGGAGGAAGAGGG - Intergenic
1140354659 16:74295319-74295341 CTGATTCTGTAGGTCTGAGATGG - Intergenic
1141183951 16:81773903-81773925 CCCATCATGCAGGACTTTGATGG + Intronic
1142446345 16:90141054-90141076 GTGATCCTGTTGGACTTTGATGG + Intergenic
1142461160 17:94409-94431 GTGATCCTGTTGGACTTTGATGG - Intergenic
1145019254 17:19416760-19416782 CTGCTCCAGCAGGACTAAGGTGG + Exonic
1148947614 17:51278248-51278270 CTGATTCTGTAGGTCTTAGGTGG + Intronic
1149165206 17:53743019-53743041 CTGATCCAGCAGGATATGGATGG + Intergenic
1150316004 17:64169504-64169526 CTCAACATGCAGGAATTAGATGG + Intronic
1151338872 17:73456997-73457019 CTGATCCAGCAGGTCTTGGGGGG - Intronic
1152406751 17:80102171-80102193 CTGCTCCTGCAGGACGCACATGG + Intergenic
1152853190 17:82649157-82649179 CAGCTCCTGCAGGACGCAGAGGG + Intergenic
1154464807 18:14632938-14632960 CAGTGCCTGTAGGACTTAGAGGG - Intergenic
1156481052 18:37436684-37436706 CTGTTCCTGCAGCCCTTTGAAGG + Intronic
1160650861 19:226776-226798 GTGATCCTGTTGGACTTTGATGG - Intergenic
1160797063 19:950467-950489 CTGCTGCTGCAGGAGTGAGAGGG + Intronic
1163389952 19:17024760-17024782 CTCATCCTGCTGGTCTCAGAAGG + Intronic
1166479764 19:43161303-43161325 CTGATCCTGCATCACTAGGAAGG - Intronic
1167069282 19:47210633-47210655 CTGATCCTGCAGCAGTTAGTCGG + Intronic
1167722174 19:51186304-51186326 CTGGCCCTCCAGGACTGAGAGGG - Intergenic
927491675 2:23525284-23525306 CTGAGCCTGCGGGACTGGGAGGG + Intronic
928307216 2:30180019-30180041 CTGATACTCCAGGTCTTAGTGGG + Intergenic
929908605 2:46068965-46068987 CTGATTCTGCAGGTCTAAGTTGG - Intronic
929982254 2:46692464-46692486 CAGATCATGCAGAACTTTGAAGG - Intergenic
931598469 2:63976754-63976776 CTGATCCTGCAGACATTAAAAGG - Intronic
932406101 2:71513434-71513456 CTCCTCCTGCAGGACTTGGCGGG + Intronic
935641860 2:105298510-105298532 CATATCCTACAGGACTTTGAAGG - Exonic
939155922 2:138524341-138524363 CTGAACCTCCAGGCCTGAGATGG + Intronic
941888348 2:170552792-170552814 CTAAGCCTGCAGGCCTTTGATGG - Intronic
941935219 2:170976396-170976418 TTGAGCCTGTAGTACTTAGAAGG + Intergenic
943427602 2:187755585-187755607 CTGATACTGCAGAACTTCAAAGG - Intergenic
944557840 2:200905675-200905697 CCTATCCTGTAGGACTTAAAAGG + Intergenic
944952261 2:204765260-204765282 CTGATTCAGCAGGTCTTGGATGG - Intronic
945848730 2:214980263-214980285 CTGATCCTGTAGGTCTGGGATGG - Intronic
948628653 2:239286504-239286526 CTGACTCTGCAGGACTGGGAAGG + Intronic
1169414775 20:5406570-5406592 CTCTTCCTTCTGGACTTAGATGG + Intergenic
1170635141 20:18097912-18097934 CTGATCCAGCTGGACTTTGCCGG + Intergenic
1173559552 20:43993150-43993172 CGGATCATGCAGGACTTTGCAGG + Intronic
1177626604 21:23670308-23670330 CCAATCATGCAGGTCTTAGAGGG + Intergenic
1180799559 22:18625486-18625508 CTGACCCTGCAGGGCTGAGCGGG - Intergenic
1181222157 22:21369780-21369802 CTGACCCTGCAGGGCTGAGCGGG + Intergenic
1181458778 22:23074098-23074120 CAGGTCCTGCAGGACTCAGTGGG + Intronic
1183377909 22:37475740-37475762 CTGCACCTGCAGGAGTTGGAGGG + Intronic
1185396725 22:50595542-50595564 GTGATGCTGTAGGACTTACAAGG + Intronic
949369029 3:3314783-3314805 CTGATCCAGCTGGACTTAGTTGG + Intergenic
950401162 3:12769768-12769790 CTGAACCACCAGGAATTAGAGGG - Intergenic
951515199 3:23551514-23551536 CTGTTACTGTAGGACTTACATGG + Intronic
952063920 3:29543804-29543826 CTGATCCTGAAGGAACTATAAGG + Intronic
952212145 3:31238815-31238837 CTGATTCTGCAGGTCTGGGATGG - Intergenic
952500117 3:33953815-33953837 CTGTGCCTGCAGCATTTAGAGGG + Intergenic
952731071 3:36637062-36637084 GTGAACCTGCAGAACTTACACGG + Intergenic
952877931 3:37963112-37963134 CTAATCCTGCAGCACTGTGACGG - Intronic
953598603 3:44340758-44340780 CTGATTCTGCAGGACTCGGATGG + Intronic
954964889 3:54601537-54601559 CTGATCCTGCAGGCTTTGGGTGG - Intronic
955117140 3:56016979-56017001 TTGATCCTGCAGCACTTTGCAGG - Intronic
958141472 3:89568295-89568317 CTGATACTGCAGAAATTAAAAGG + Intergenic
958630909 3:96682219-96682241 CTGATACTGCAGAAATTAAAAGG - Intergenic
963402667 3:144820802-144820824 CTGATCCTGCTGGACTTCTCTGG - Intergenic
963961742 3:151316901-151316923 CTGAACCTGCAGGAATCAGATGG + Exonic
964417624 3:156464360-156464382 ATTATTCAGCAGGACTTAGAAGG + Intronic
965513443 3:169594453-169594475 CTGATTCTGCAGGTCTGAGCTGG - Intronic
966602393 3:181788475-181788497 CTGATACTGGAGGGCTGAGATGG - Intergenic
967745752 3:193052921-193052943 CTCATCCTCCAAGACTGAGAGGG - Intergenic
968366970 3:198193211-198193233 GTGATCCTGTTGGACTTTGATGG + Intergenic
975502028 4:75097315-75097337 CTGATACTGCAGAAATTAAAAGG - Intergenic
975782944 4:77858825-77858847 CTGATCCAGTAGGTCTGAGATGG - Intergenic
976856346 4:89609551-89609573 CTGCTCCTGCAGGACTCAGGAGG + Intergenic
977021832 4:91769547-91769569 CTGATCTTGCAGGACTTCAAAGG + Intergenic
979255380 4:118602819-118602841 GTGATCCTGTTGGACTTTGATGG + Intergenic
979332958 4:119437694-119437716 GTGATCCTGTTGGACTTTGATGG - Intergenic
983595008 4:169456536-169456558 CTGATACTGCAGAAATTAAAAGG + Intronic
985606779 5:862154-862176 CTGATCCTGCAGGACTTAGAGGG - Intronic
987955849 5:24738979-24739001 CTCACCCTGCAGGACTTACTTGG + Intergenic
988090196 5:26529401-26529423 CTCATCCTGTCAGACTTAGACGG - Intergenic
994382685 5:99089996-99090018 CTCATCCTGCAGATCTTGGAAGG - Intergenic
994477039 5:100284193-100284215 CTGATACTGCAGAAATTTGAAGG - Intergenic
994845468 5:104983100-104983122 CTGATGCTGCAGTAATTAAAAGG - Intergenic
995624190 5:114058718-114058740 CAGATCCTGCAGGGCTTTGCAGG + Intergenic
996129751 5:119768245-119768267 CTGATCCTGCAATATTGAGAAGG + Intergenic
997271406 5:132541271-132541293 GTGATCTAGCAGGACTTAGTGGG - Intergenic
998050820 5:139032877-139032899 CAGATCCTGCAGAAATTAAAAGG - Intronic
998290901 5:140913400-140913422 CTGATACTGCAGGAATTCAAAGG - Intronic
999585465 5:153084824-153084846 TTCATCCTGCTTGACTTAGAGGG - Intergenic
999595455 5:153199017-153199039 CTGATCTTGCAAGACTGTGAGGG - Intergenic
1002428734 5:179191096-179191118 CTGAGGCTGCAGGACGCAGAAGG + Intronic
1002726195 5:181298409-181298431 GTGATCCTGTTGGACTTTGATGG + Intergenic
1003123065 6:3333797-3333819 CTGATACAGTAGGACTGAGAAGG - Intronic
1004844645 6:19626311-19626333 CTGAGCTTTCAGGAATTAGAAGG + Intergenic
1005136961 6:22580272-22580294 CTGATCCTGTAGGACCAGGATGG + Intergenic
1006561262 6:34914721-34914743 CAGTTTCTGCAGAACTTAGAAGG + Intronic
1010075937 6:71798292-71798314 CTGTTCTTGCAGGACTAAGGTGG + Intergenic
1010272517 6:73930095-73930117 CTGTTCCTAAAGGACTTAAAAGG - Intergenic
1010639475 6:78306044-78306066 CTGATACTGCAGAAATTAAAAGG - Intergenic
1011801365 6:91019740-91019762 CAGGTCCTGCAGGACTTTGTGGG - Intergenic
1014588853 6:123236036-123236058 CTCATCCTTCAGGAGTGAGATGG + Intronic
1015674591 6:135730521-135730543 CTGATTCTGTAGGTCTGAGATGG + Intergenic
1015849931 6:137560832-137560854 CTGCTCCTGCAGGACCCAGGAGG - Intergenic
1015857557 6:137641265-137641287 CAAATCCTGCAGGGCTTAGATGG - Intergenic
1018777989 6:167036063-167036085 CTGATCCTGCATAAATTTGAGGG - Intronic
1020149048 7:5667518-5667540 CTGCTCCTGCAGGATGGAGAAGG - Intronic
1020588324 7:10101532-10101554 TGGATCCTGCAGGAGTCAGAGGG - Intergenic
1021097166 7:16547553-16547575 CTGAGCCTGCAGGCATAAGAGGG - Intronic
1021155819 7:17208364-17208386 CTGATCCTGAAGGACTCAAAGGG + Intergenic
1021553837 7:21899808-21899830 CTTGTCCTGCAGGCCTTAGTTGG + Intronic
1021570142 7:22056860-22056882 CTGATTCAGCAGGTCTTAGGGGG + Intergenic
1023397472 7:39764663-39764685 GTGATCCTGTTGGACTTTGATGG + Intergenic
1024018450 7:45341718-45341740 CTGATCCTGTGGGTCTTAAAAGG + Intergenic
1024577852 7:50779539-50779561 CTGTTCCTGCCTTACTTAGATGG - Intronic
1024917352 7:54515893-54515915 CTGTTCCTGCAGGACCCAGGAGG - Intergenic
1025135201 7:56405802-56405824 GTGATCCTGTTGGACTTTGATGG - Intergenic
1026440340 7:70438436-70438458 GTGATCCTGCAGGTCTTAAGTGG + Intronic
1027436590 7:78171428-78171450 CTGATGCTGCAGGCCTGGGAGGG + Intronic
1030487526 7:110189091-110189113 CAGATCATGCAGGACTTTGTAGG + Intergenic
1031761373 7:125716666-125716688 CTGGTCCTGCAGGACCCAGGAGG - Intergenic
1033579634 7:142720444-142720466 CTGAGACTGCTGGCCTTAGAAGG - Intergenic
1033833049 7:145276379-145276401 CTGATCCAGCATGACTAAAAGGG + Intergenic
1035908632 8:3541257-3541279 CTGTTCCTGCATTACTTTGAGGG - Intronic
1040030078 8:42815875-42815897 CTGCTCCAGGAGGACTGAGAAGG + Intergenic
1041364044 8:57082948-57082970 CTGCTCCTGCAGGACCTGGGAGG + Intergenic
1041415339 8:57601920-57601942 CTGAGGCTACAAGACTTAGATGG + Intergenic
1043551192 8:81374953-81374975 CAGATCCTGTAGGACTTTGTGGG + Intergenic
1047271794 8:123367464-123367486 TTGATCCAGCAGTACTAAGAGGG - Intronic
1048196140 8:132333232-132333254 TTGTACCTGCAGGACTTAGAGGG - Intronic
1056148073 9:83754715-83754737 CTGATCCTGGAGGGCCTTGAAGG + Intronic
1056476747 9:86960024-86960046 CTTTTCCTCCAGGACCTAGAAGG - Intergenic
1057019952 9:91689320-91689342 ATGATGCTGCAGGGCTGAGAGGG - Intronic
1057119637 9:92559475-92559497 CTGCTCCTGCAGGACCTGGGAGG - Intronic
1059468240 9:114483277-114483299 CTGTTCCTGCAGGATTCTGATGG - Intronic
1061917267 9:133761822-133761844 CAGACCCTGCTGGACTTAGGCGG + Intergenic
1062751326 9:138256055-138256077 GTGATCCTGTTGGACTTTGATGG + Intergenic
1188985585 X:36765889-36765911 CTCATCCTGGAGGACTCAGCAGG - Intergenic
1189077976 X:37938119-37938141 CTGAGCCTGCAGAATTTAAAGGG + Intronic
1189470695 X:41311726-41311748 CTGATACTGCATGACTTCTAAGG + Intergenic
1189858293 X:45246405-45246427 CTGATACTGCAGAAATTAAAAGG - Intergenic
1190853077 X:54265553-54265575 CAGATCCTGTAGGACTTTGCAGG + Intronic
1192069200 X:67918766-67918788 CTGTTCCTGCAGGACCTGGGAGG - Intergenic
1192265023 X:69531941-69531963 CTGAGGATGCAGGAGTTAGAAGG - Exonic
1192990282 X:76445623-76445645 CTGATACTGCAGAAATTCGAGGG - Intergenic
1193302536 X:79907425-79907447 CTGATACTGCAGGAATCAAAAGG + Intergenic
1193887384 X:86999347-86999369 CTGATACTGCAGAAATTCGAAGG + Intergenic
1194857702 X:98954725-98954747 CTGATACTGCAGAAATTCGAAGG - Intergenic
1196003301 X:110809128-110809150 CTGATCCTGTGGGACTGGGAAGG - Intergenic
1196864492 X:120058601-120058623 TTGAGCCTGCAGGCCTTTGAAGG + Intergenic
1196878609 X:120177730-120177752 TTGAGCCTGCAGGCCTTTGAAGG - Intergenic
1197175928 X:123485879-123485901 CTGATCCAGCAGGTCTGGGATGG + Intronic
1197299772 X:124763906-124763928 CTAATTCTCCAGGACATAGAAGG - Intronic
1198022903 X:132676675-132676697 CTGATTCAGCAGGTCTAAGATGG + Intronic
1198795951 X:140394734-140394756 CTGATACTGCAGAAATTCGAAGG + Intergenic
1199599653 X:149534399-149534421 CTGATCCTGCAGCTCCTCGAGGG - Intergenic
1199650980 X:149945811-149945833 CTGATCCTGCAGCTCCTCGAGGG + Intergenic