ID: 985608427

View in Genome Browser
Species Human (GRCh38)
Location 5:871938-871960
Sequence GCAACTGGTCATATTCCAGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 103
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 93}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985608427_985608431 2 Left 985608427 5:871938-871960 CCACCTGGAATATGACCAGTTGC 0: 1
1: 0
2: 0
3: 9
4: 93
Right 985608431 5:871963-871985 GAGACCAGCTCGAGTCCTGCAGG 0: 1
1: 0
2: 0
3: 6
4: 99
985608427_985608439 29 Left 985608427 5:871938-871960 CCACCTGGAATATGACCAGTTGC 0: 1
1: 0
2: 0
3: 9
4: 93
Right 985608439 5:871990-872012 GGTGTGTGCAGGAGCAAAGGAGG 0: 1
1: 0
2: 2
3: 47
4: 366
985608427_985608435 8 Left 985608427 5:871938-871960 CCACCTGGAATATGACCAGTTGC 0: 1
1: 0
2: 0
3: 9
4: 93
Right 985608435 5:871969-871991 AGCTCGAGTCCTGCAGGGGCAGG 0: 1
1: 0
2: 2
3: 13
4: 175
985608427_985608433 4 Left 985608427 5:871938-871960 CCACCTGGAATATGACCAGTTGC 0: 1
1: 0
2: 0
3: 9
4: 93
Right 985608433 5:871965-871987 GACCAGCTCGAGTCCTGCAGGGG 0: 1
1: 0
2: 0
3: 6
4: 110
985608427_985608432 3 Left 985608427 5:871938-871960 CCACCTGGAATATGACCAGTTGC 0: 1
1: 0
2: 0
3: 9
4: 93
Right 985608432 5:871964-871986 AGACCAGCTCGAGTCCTGCAGGG 0: 1
1: 0
2: 1
3: 7
4: 105
985608427_985608437 18 Left 985608427 5:871938-871960 CCACCTGGAATATGACCAGTTGC 0: 1
1: 0
2: 0
3: 9
4: 93
Right 985608437 5:871979-872001 CTGCAGGGGCAGGTGTGTGCAGG 0: 12
1: 0
2: 5
3: 96
4: 615
985608427_985608438 26 Left 985608427 5:871938-871960 CCACCTGGAATATGACCAGTTGC 0: 1
1: 0
2: 0
3: 9
4: 93
Right 985608438 5:871987-872009 GCAGGTGTGTGCAGGAGCAAAGG 0: 1
1: 0
2: 2
3: 34
4: 383

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985608427 Original CRISPR GCAACTGGTCATATTCCAGG TGG (reversed) Intronic
900809065 1:4787420-4787442 GCAAGTGGTAATTTTCCAGTAGG - Exonic
902737766 1:18412614-18412636 GCAACTGGGCAGGTCCCAGGGGG - Intergenic
909225188 1:73010972-73010994 GCAACTAGTTATTTTCCAGATGG - Intergenic
912014504 1:105016299-105016321 GAATCTGGTAATATTCCTGGAGG + Intergenic
915068863 1:153248780-153248802 ACAAGTGTTCATTTTCCAGGAGG + Intergenic
920153357 1:203927709-203927731 GCAACTGGAGACCTTCCAGGAGG - Intergenic
923462954 1:234222927-234222949 GAAAATGGTGAAATTCCAGGAGG + Intronic
924514056 1:244751632-244751654 GCACCTGGTCATATGTCAGCAGG - Intergenic
924611725 1:245579137-245579159 CCACCTGGTCATAATCCAGAGGG + Intronic
1068534363 10:58224187-58224209 GCTACTAGTCATGTTGCAGGAGG - Intronic
1071111067 10:82157339-82157361 GCTACAAGTCATATTCCAGAAGG + Intronic
1071376999 10:85016444-85016466 GCTTCTTTTCATATTCCAGGGGG - Intergenic
1075019903 10:118944120-118944142 GCAACTGGTGAGATTCCTGTAGG - Intergenic
1077813917 11:5666918-5666940 GGAACTGGTCTTTTTCCAGGAGG + Intronic
1079485600 11:20933168-20933190 GGACTTGGGCATATTCCAGGTGG + Intronic
1081134331 11:39420041-39420063 GCACCTGGTCATATTCCTTGTGG - Intergenic
1092332880 12:7601813-7601835 TGAACTGGTCTTAGTCCAGGAGG - Intergenic
1107778690 13:43875995-43876017 TCAAATGGTCTTATTCCATGTGG - Intronic
1115426398 14:33264958-33264980 GTAACTGGTCATATTTCTTGAGG + Intronic
1118992192 14:70807934-70807956 GGAACTGGTCAAATCTCAGGGGG - Intronic
1121757711 14:96417006-96417028 GGAAATGGTCACATTCCATGAGG - Intronic
1202849735 14_GL000225v1_random:9167-9189 GCAACCGGGCAAAATCCAGGAGG + Intergenic
1124152781 15:27196791-27196813 GCTACTGCCCATATTTCAGGAGG - Intronic
1125967547 15:43886557-43886579 GCACCTGGGCATGTTACAGGTGG - Intronic
1126630166 15:50726453-50726475 GTAACTGGCCATATGCCATGGGG - Intronic
1129074018 15:72976064-72976086 TCAAATGGTCGTAGTCCAGGTGG + Intergenic
1133113641 16:3564104-3564126 GCATCTGGCCAGATCCCAGGGGG - Exonic
1138170710 16:54846760-54846782 ACAATTGGTCATTTTCCAGCTGG + Intergenic
1139667417 16:68467395-68467417 GAAACTGGTCAAATATCAGGAGG - Intergenic
1141923213 16:87150346-87150368 AAAACTGCACATATTCCAGGAGG + Intronic
1146779328 17:35653770-35653792 GAACCTGTTCATATTCCAGCCGG - Intronic
1146797561 17:35793799-35793821 GAACCTGTTCATATTCCAGCTGG + Intronic
1149556557 17:57577442-57577464 CCAACTGGTAATATTTCAGGAGG + Intronic
1149571172 17:57673372-57673394 GCAACTGGTCATAGGGCAGAGGG + Intronic
1151542646 17:74772573-74772595 GCATGTTGTCATATTACAGGAGG - Intronic
1152111898 17:78361182-78361204 GCAGGGGGTCACATTCCAGGGGG - Intergenic
1155232620 18:23789066-23789088 GCATCTGTTCATATACCAGTTGG - Intronic
1157459304 18:47872636-47872658 GCCACTGCTGATCTTCCAGGAGG - Intronic
1157937641 18:51890988-51891010 GCAGCAGTTCAGATTCCAGGAGG + Intergenic
1159619410 18:70620153-70620175 GCAACTGTACACATTCCAGCAGG + Intergenic
1167078626 19:47264475-47264497 GCAAATGGTCAGATGCCAGCAGG + Intronic
1168027188 19:53651115-53651137 GCAAATGGTAATATTGCAGGAGG + Intergenic
932736985 2:74261131-74261153 GAACCAGGTCATATTCAAGGTGG - Intronic
933203914 2:79483150-79483172 TCAACTGGTGATGTTCCAAGTGG - Intronic
934924465 2:98372270-98372292 GCAAATGGTCATCTTCTAAGAGG - Intronic
937566061 2:123290428-123290450 GCATTTTGTCACATTCCAGGAGG - Intergenic
939038364 2:137159610-137159632 GCTACTAGTCATTTTCCAAGAGG + Intronic
941896754 2:170636859-170636881 CCAAATGAACATATTCCAGGAGG - Intronic
942931428 2:181498890-181498912 GCAACAGGTCATAGTTCAGGAGG - Intronic
945694283 2:213083256-213083278 GAAACTGGTCACATAGCAGGAGG + Intronic
1169058208 20:2641256-2641278 GAATCTGGTCCGATTCCAGGGGG - Exonic
1169394074 20:5214433-5214455 GCCACTGGGCATACTCCTGGGGG + Intergenic
1171880514 20:30614877-30614899 GAAACACGTCATATTCTAGGAGG - Intergenic
1173233315 20:41219874-41219896 GCAACTGGTTATGTTCCAGATGG + Intronic
1177277255 21:18928116-18928138 GAAACTGGTCAAAATGCAGGTGG - Intergenic
1181045265 22:20211305-20211327 TCAGCTGGTCAACTTCCAGGAGG - Intergenic
1184331235 22:43829156-43829178 GCAGCTGGCCAGATTCCTGGGGG - Exonic
1184793900 22:46719971-46719993 GCAGCTGGCCATACCCCAGGTGG - Intronic
951564656 3:24001256-24001278 GAAACTGGACATACTCCAGAAGG + Intergenic
952964876 3:38614878-38614900 GCAACTGCCCAAGTTCCAGGAGG - Intronic
962927450 3:140008088-140008110 GCAGGAGTTCATATTCCAGGGGG + Intronic
966401779 3:179554933-179554955 CCAAATGGTCATAATCCAGAAGG - Intergenic
968847758 4:3055831-3055853 GAAAATGGTAATATTGCAGGGGG - Intergenic
968874297 4:3257191-3257213 GCAACTTGCCTAATTCCAGGAGG - Intronic
971858294 4:32071767-32071789 CCAACTGATTACATTCCAGGTGG - Intergenic
976111895 4:81684520-81684542 GCTACTGGCAATGTTCCAGGTGG + Intronic
979342452 4:119542455-119542477 GCAAATGGTCACATTGGAGGTGG - Exonic
985608427 5:871938-871960 GCAACTGGTCATATTCCAGGTGG - Intronic
985770421 5:1806487-1806509 GCAACTGCTCCTAATCCTGGTGG - Intronic
988568684 5:32342720-32342742 GTAAATGGTAATATTACAGGGGG - Intergenic
991290242 5:65026739-65026761 GAGACAGGTCATGTTCCAGGTGG + Intergenic
992078739 5:73215210-73215232 CCCACTGTTCATATTTCAGGAGG + Intergenic
994209804 5:97074600-97074622 GCAAATGGTCACCTTCTAGGTGG - Intergenic
998390679 5:141785291-141785313 GCACCTGGACTAATTCCAGGTGG + Intergenic
1004728319 6:18332708-18332730 TCAAATGCTCATAGTCCAGGAGG - Intergenic
1011524692 6:88251687-88251709 GCAACGGGGCATGTCCCAGGAGG + Intergenic
1017072639 6:150589346-150589368 GAAAGTGGGCATATCCCAGGCGG + Intergenic
1019228909 6:170540887-170540909 GTACCGGGTCATAATCCAGGTGG + Intronic
1020149274 7:5668982-5669004 GCTCCTGCTCATATTCCTGGGGG - Intronic
1023291713 7:38675046-38675068 GCAACTGGCAATATTTCAGGTGG - Intergenic
1024929282 7:54652928-54652950 GATACAGCTCATATTCCAGGTGG + Intergenic
1028725109 7:94077799-94077821 ACAACTGGTGATATTTCAAGAGG + Intergenic
1028747207 7:94340684-94340706 GCAACTGGGCAGTTTTCAGGGGG - Intergenic
1031282670 7:119823582-119823604 TCAACATGTGATATTCCAGGAGG - Intergenic
1031709421 7:125026520-125026542 GCAACTGGCTTTCTTCCAGGAGG + Intergenic
1032867213 7:135938299-135938321 GTAATTGGTTATATTCCAAGGGG - Intronic
1033221902 7:139532490-139532512 GCAACTAGTCAGATTCAAGCAGG + Intronic
1034851645 7:154499388-154499410 GCTCCTGTTCATATTCCACGAGG + Intronic
1035060714 7:156067262-156067284 GCAACTGGACATATGCCTGCGGG + Intergenic
1037734574 8:21555982-21556004 CCAACTTGTCATCTTCCATGTGG - Intergenic
1041352513 8:56962188-56962210 GCAACTGGTCAAATTCGAGAAGG - Exonic
1044862582 8:96537332-96537354 GCAACAGTTCAAATTCCAGCGGG - Intronic
1046504372 8:115117911-115117933 GCAACCAGTCATATTCAAAGAGG - Intergenic
1047529070 8:125658890-125658912 GAACCAGGTCAGATTCCAGGCGG - Intergenic
1048036474 8:130682166-130682188 GCAACTGGCAAAATTCCAGATGG + Intergenic
1057780499 9:98046044-98046066 GTAAATGGTAATATTGCAGGGGG + Intergenic
1058067135 9:100562229-100562251 GGATCTGGTCAAACTCCAGGAGG - Intronic
1060414923 9:123423484-123423506 GCAAGTGGTGAGATTGCAGGTGG - Intronic
1061131881 9:128713068-128713090 GCAACTGTTCACAGCCCAGGAGG - Exonic
1061773772 9:132946833-132946855 TCAACTGCTCACTTTCCAGGGGG + Intronic
1188838582 X:34988079-34988101 GCAACTAGTCATATCTCTGGAGG - Intergenic
1189601165 X:42627996-42628018 GCAAGTGGTAATATGCCTGGTGG + Intergenic
1193129520 X:77904890-77904912 GATACTAGTCATATTCCAGGTGG + Intronic