ID: 985610257

View in Genome Browser
Species Human (GRCh38)
Location 5:883937-883959
Sequence CCTTGCCGCCTGGGAGGAAC CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 197
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 186}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985610251_985610257 3 Left 985610251 5:883911-883933 CCTCTCTCGGTGGCCACAGAGCA 0: 1
1: 0
2: 0
3: 22
4: 164
Right 985610257 5:883937-883959 CCTTGCCGCCTGGGAGGAACCGG 0: 1
1: 0
2: 1
3: 9
4: 186
985610248_985610257 14 Left 985610248 5:883900-883922 CCACGTGGCACCCTCTCTCGGTG 0: 1
1: 0
2: 0
3: 6
4: 88
Right 985610257 5:883937-883959 CCTTGCCGCCTGGGAGGAACCGG 0: 1
1: 0
2: 1
3: 9
4: 186
985610252_985610257 -10 Left 985610252 5:883924-883946 CCACAGAGCACTACCTTGCCGCC 0: 1
1: 0
2: 1
3: 10
4: 113
Right 985610257 5:883937-883959 CCTTGCCGCCTGGGAGGAACCGG 0: 1
1: 0
2: 1
3: 9
4: 186
985610250_985610257 4 Left 985610250 5:883910-883932 CCCTCTCTCGGTGGCCACAGAGC 0: 1
1: 0
2: 3
3: 15
4: 167
Right 985610257 5:883937-883959 CCTTGCCGCCTGGGAGGAACCGG 0: 1
1: 0
2: 1
3: 9
4: 186

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985610257 Original CRISPR CCTTGCCGCCTGGGAGGAAC CGG Exonic
900697451 1:4021107-4021129 CCTTGCAGCCTGGGAGCAGGGGG + Intergenic
903741390 1:25560562-25560584 CCGTGCTGCCTGGGTGGAAATGG - Intronic
904266832 1:29323187-29323209 CCTTGCAGCCTGTGGGCAACTGG + Intronic
906603237 1:47147626-47147648 CCTGGGGGCCTGGGAGGAAGAGG + Intronic
907535526 1:55151967-55151989 CCTTGCTGCCTGGCAGGAAAGGG + Intronic
917330644 1:173876955-173876977 GTTTGCAGCCTAGGAGGAACGGG - Intronic
918256319 1:182751960-182751982 CCGCGGCGCCTGTGAGGAACTGG - Intergenic
919746703 1:201013470-201013492 CCATGCCCCCAGGGAGGAAAAGG - Intronic
920374210 1:205498545-205498567 CCTGGCTGCCTGTTAGGAACTGG - Intergenic
921279809 1:213555276-213555298 CCTTGCTGCCAGGGAGGGAGTGG - Intergenic
922456617 1:225778361-225778383 CCTTACCGCCTAGGCGGTACAGG - Intronic
922475977 1:225907273-225907295 CCTTGCCGCCTGTCTGGAATCGG - Intronic
922503263 1:226111730-226111752 ATTGGCCACCTGGGAGGAACAGG - Intergenic
1066500943 10:35994111-35994133 CCTTGCTGGCTGGGAGGAGAAGG - Intergenic
1068229763 10:54156834-54156856 CCTTTCCAAATGGGAGGAACTGG + Intronic
1069381791 10:67849411-67849433 GCTTCCCGGCAGGGAGGAACAGG - Intergenic
1072627046 10:97119290-97119312 ACTTCCCACCTGGGAGGATCGGG - Intronic
1074939762 10:118223268-118223290 CCTTGCAGCCTGGTGGGAATGGG - Intergenic
1075170458 10:120108966-120108988 CCTTTAGGACTGGGAGGAACAGG + Intergenic
1075406715 10:122200278-122200300 CCTTCCAGCCTGGGATGAACGGG - Intronic
1076948727 10:133667510-133667532 CATCGCCGCCCGGGAGGAGCTGG + Exonic
1076949711 10:133670809-133670831 CATCGCCGCCCGGGAGGAGCTGG + Intronic
1076950695 10:133674108-133674130 CATCGCCGCCCGGGAGGAGCTGG + Intergenic
1076951685 10:133677418-133677440 CATCGCCGCCCGGGAGGAGCTGG + Intergenic
1076952674 10:133680728-133680750 CATCGCCGCCCGGGAGGAGCTGG + Intergenic
1076953658 10:133684027-133684049 CATCGCCGCCCGGGAGGAGCTGG + Intergenic
1076955631 10:133743689-133743711 CATCGCCGCCCGGGAGGAGCTGG + Intergenic
1076956621 10:133746999-133747021 CATCGCCGCCCGGGAGGAGCTGG + Intergenic
1076957608 10:133750308-133750330 CATCGCCGCCCGGGAGGAGCTGG + Intergenic
1076958593 10:133753607-133753629 CATCGCCGCCCGGGAGGAGCTGG + Intergenic
1076959582 10:133756917-133756939 CATCGCCGCCCGGGAGGAGCTGG + Intergenic
1076960566 10:133760216-133760238 CATCGCCGCCCGGGAGGAGCTGG + Intergenic
1077298722 11:1837711-1837733 CCGGGCCGCCTGGGAAGACCGGG + Intergenic
1077416685 11:2427244-2427266 CCTTCCCACCTGGGAGGAGGAGG + Intergenic
1077490979 11:2860865-2860887 CCCTGCCCCTTGGGAGGAGCTGG + Intergenic
1078436310 11:11328539-11328561 CCTTGTCCCCTGTTAGGAACAGG - Intronic
1081688756 11:45060899-45060921 GTTTGCAGCCTGGGAGCAACAGG - Intergenic
1081773387 11:45663207-45663229 CCTGGCCCCCAGGGAGGACCTGG + Intronic
1084642117 11:70432201-70432223 CCTTGCAGCTTGTCAGGAACCGG + Intronic
1089561087 11:119343572-119343594 CCCTGCCGGTGGGGAGGAACTGG + Intronic
1089771956 11:120809312-120809334 CTCTGCTGCCTGGGAGGAAGAGG + Intronic
1090208230 11:124897253-124897275 CCATGCCTCCTGGGAGGGAAAGG + Exonic
1091283716 11:134396695-134396717 CCTTGCAGCCTGGAAGGGCCAGG + Intronic
1091372724 11:135074068-135074090 CCTTGCCCACTGGGAGGCACAGG + Intergenic
1092455351 12:8637904-8637926 CCTGGCCTCCTGGGAGGAACAGG - Intronic
1093974019 12:25401271-25401293 CCATTCCGAATGGGAGGAACTGG - Intergenic
1095096207 12:38150728-38150750 CCCTGCCTCCTGGGAGGCATGGG + Intergenic
1096154874 12:49336306-49336328 CCTTGGCGCCTGGCGGGAAGGGG + Exonic
1096597799 12:52707934-52707956 CCTTGCCTCGAGGGAGCAACTGG + Intergenic
1097233450 12:57525571-57525593 CATTGCCCCTTGGGAGGAAACGG - Exonic
1097711443 12:62921668-62921690 CCCTGCTGCCTGGGAGGTTCAGG + Intronic
1098063946 12:66592171-66592193 CCTTGACACCAGGGAGGAGCTGG - Intronic
1103122529 12:118392797-118392819 CCTTTCCGTCTGTGGGGAACGGG + Intronic
1104728502 12:131092555-131092577 AGTGGCCGCCTGGGAGGAAGTGG - Intronic
1105344586 13:19561105-19561127 CCTTGTGGCCTGGGAGGCAGTGG + Intergenic
1105535452 13:21260468-21260490 CCTTGTGGCCTGGGAGGCAGTGG - Intergenic
1106795141 13:33197751-33197773 GATTACCTCCTGGGAGGAACAGG - Intronic
1107805923 13:44153890-44153912 CCCTGAGGCCTGGGAGGAAGGGG - Intronic
1107951191 13:45463887-45463909 CCTTGACTCCAGGGAGGAGCAGG + Intergenic
1108577111 13:51800068-51800090 CCTTGCCTACTTGGAGAAACGGG + Intronic
1109221342 13:59643872-59643894 CCTTGCCTCCTGGGAAGGATGGG + Intergenic
1109951271 13:69504155-69504177 CCTTCCCAGCTGGGATGAACAGG + Intergenic
1111066704 13:83103034-83103056 CCTTGCCATCTGTGAGGTACTGG - Intergenic
1113715683 13:112505147-112505169 CCTTACCGCCTGTGAGAAAGAGG + Intronic
1114487531 14:23071769-23071791 CCCTGCCCCCTGGGAAGACCAGG - Intronic
1114675853 14:24440036-24440058 CCTGGAAGCCTGTGAGGAACAGG + Exonic
1119706628 14:76787039-76787061 CTGTGAGGCCTGGGAGGAACAGG - Intergenic
1121045058 14:90781806-90781828 CCTTGCTGACTGGGAGGAAGGGG - Intronic
1122008430 14:98725746-98725768 CCTTGCTGCCCGGGAGGACTGGG + Intergenic
1122513719 14:102291077-102291099 ACTTGCCTTCTGGGAGAAACTGG + Intronic
1202859581 14_GL000225v1_random:72847-72869 CATTGCCGCCAGGGAAGAGCTGG - Intergenic
1125200702 15:37098842-37098864 CCCTGCCCCCGGGGAGGCACTGG - Intronic
1126723729 15:51609575-51609597 CTTTGTAGCCTGGGAGCAACAGG + Intronic
1129688271 15:77698617-77698639 CATTCCCGCCTTGGAGGAAGAGG - Intronic
1130163604 15:81427819-81427841 CATTGCCGTCTGGAAGGCACAGG + Intergenic
1132670774 16:1101520-1101542 CCTTCCAGTCTGGGAGGGACAGG + Intergenic
1133070561 16:3244026-3244048 CCTGGGTTCCTGGGAGGAACGGG - Intronic
1134079767 16:11316635-11316657 CCTCACCGCCTGGGAACAACAGG + Intronic
1137044568 16:35643353-35643375 CCTTGCCATCTGTGAGGATCTGG - Intergenic
1138415374 16:56868441-56868463 CCTTGGGGTCTGGGAAGAACAGG - Intronic
1140218642 16:73028024-73028046 CCTGGCGGCCTGGGAGGAGGTGG - Intronic
1141135343 16:81461175-81461197 CCCTGCCACATGGGAGGAAGTGG - Intronic
1142080873 16:88148168-88148190 CATTGATGCGTGGGAGGAACTGG - Intergenic
1142899571 17:3003801-3003823 CCTGGCCGCCTGGTTGGAATGGG + Intronic
1143480309 17:7224307-7224329 CCTGCCCGCCTGAGAGGAAGAGG - Exonic
1143538908 17:7558149-7558171 CCTTCCTGGCTGGGAGGAGCAGG + Intronic
1143719205 17:8798467-8798489 CCTTGCTTCCTGGGGGGAAAGGG - Exonic
1146034059 17:29390718-29390740 CGTCGCCGCCTCGGGGGAACCGG - Exonic
1147138432 17:38448162-38448184 CCTCCCTGCTTGGGAGGAACTGG + Intronic
1147280509 17:39356604-39356626 CCTAGCCGCCTGGGAGGCCAAGG - Intronic
1147554378 17:41467101-41467123 ACTGGCTGCCTGGCAGGAACTGG + Exonic
1150902814 17:69300391-69300413 ACTAGCTGCCTGTGAGGAACTGG - Intronic
1151854521 17:76711132-76711154 CCTGACCACCTGGGAGGCACAGG + Intergenic
1152250367 17:79209337-79209359 CCCTGCCCCCTGGGAGGTCCCGG - Intronic
1156913339 18:42437330-42437352 CCCTGCAGCCTAGGAAGAACAGG + Intergenic
1157280804 18:46345220-46345242 CCTTTCCTCCTGGCAGGAAGAGG - Intronic
1157425428 18:47580544-47580566 CCTTGCCCCCTGAGAGGGCCAGG + Intergenic
1158302587 18:56068248-56068270 CCTTGCCCACTGGGAGAAAAGGG - Intergenic
1160805278 19:989842-989864 CCTTGCCCCCTGAGATGAAGTGG - Exonic
1161301806 19:3546368-3546390 CTTTGCCGCCTGGGTGGCGCTGG - Exonic
1161377981 19:3950003-3950025 CCTCCCTGCCTGGGAGGCACTGG + Intergenic
1161409447 19:4108724-4108746 CCTTTCTGCATGGGAGGAAGGGG + Intronic
1162566092 19:11446496-11446518 GCTTCCCGCCTGGCAGGACCCGG + Intronic
1163614740 19:18320076-18320098 CATTGCAGCCTGGGAGGGCCTGG - Intronic
1163639942 19:18456493-18456515 CCTTGGCACCAGGGAGGAGCAGG + Intronic
1164739739 19:30567180-30567202 CCTGGCGGGCTGGCAGGAACTGG - Intronic
1168712790 19:58511485-58511507 CCATGCCGCCTGGCAGGCCCGGG + Exonic
926823970 2:16883819-16883841 CCTTGCGTACTGGGAGGAATAGG - Intergenic
927813063 2:26190943-26190965 CCTGGCCTCTTGGGAGGAACAGG + Exonic
928024787 2:27730530-27730552 CCTTGATGTCTGGGGGGAACTGG - Intergenic
930934494 2:56931129-56931151 CTTTGCTGTCTGGGAGGAAGAGG + Intergenic
931286261 2:60834556-60834578 CCTGGCCCCCTGGGAGGGAGGGG + Intergenic
935935087 2:108173764-108173786 CCATGCCGCCTGGGATGAAGGGG - Intergenic
939951786 2:148483801-148483823 CATTGACAGCTGGGAGGAACAGG - Intronic
947373592 2:229473167-229473189 CTTTCCAGCCTGGGAGGAATTGG + Intronic
948243538 2:236458626-236458648 CCTTGCTGGCTGGGAGCACCTGG - Intronic
1170849781 20:19994285-19994307 CTATGCAGCCTGGGAGGAAGAGG + Intronic
1172856373 20:38006557-38006579 GCTTGCCGCATTGGGGGAACTGG - Intronic
1174532891 20:51227993-51228015 CATTCTCCCCTGGGAGGAACAGG + Intergenic
1174771782 20:53307190-53307212 AGTTGCAGCCTGGGAGGAGCAGG - Intronic
1175889611 20:62310434-62310456 CCCCGCTGCCTGGGAAGAACAGG + Exonic
1175904148 20:62371580-62371602 CCTTGCCACTTGGGAAGAAAAGG - Intergenic
1176100473 20:63362200-63362222 CCTTGCAGCCTTGGAGGGAGGGG - Intronic
1176169945 20:63692247-63692269 CCTTGGCTTCTGGGAAGAACTGG + Intronic
1178634894 21:34293667-34293689 GCTTGCAGCCTAGGAGGAAAAGG - Intergenic
1180199467 21:46215815-46215837 CCTTGGGGCCTGGGAGCACCTGG + Intronic
1180248447 21:46563854-46563876 CCTTCACGCCGGGGAGGATCTGG - Exonic
1181486925 22:23237377-23237399 CCTGGCCGATTGGGAGTAACAGG + Intronic
1181672879 22:24433950-24433972 CCAGGCCGCCTGGGAGGGCCAGG - Intronic
1183676319 22:39300727-39300749 CCATGAGGCCTGGGAGGAGCGGG + Intergenic
1184521982 22:45000058-45000080 CTTTGCCGCCTTGGAGGCTCTGG - Intronic
953291489 3:41668495-41668517 GTTTGCAGCCTGGGAGCAACAGG + Intronic
955396105 3:58558812-58558834 CCTTGCCTTCTGGGAGGCTCAGG + Intergenic
957328124 3:78723280-78723302 GTTTGCGGCCTAGGAGGAACTGG + Intronic
964603530 3:158531233-158531255 CCTTGCCACCTGTGAGTAAAAGG - Intronic
964753524 3:160074371-160074393 CCTTGCAGTCTGGATGGAACAGG - Intergenic
966809356 3:183829543-183829565 CCTTGCCGCCTGAGAGCCCCAGG - Exonic
967194756 3:187016722-187016744 CATTGCCTCCTGGGAGGCAGGGG - Intronic
967873161 3:194249041-194249063 CCCTTCCGCCTGGATGGAACAGG - Intergenic
968507391 4:977170-977192 CCTCGCAGCCTCGGAGGAGCCGG + Intronic
968608004 4:1544653-1544675 CCTCGCAGCCTCGGAGGAGCCGG + Intergenic
975040074 4:69735549-69735571 CCTTCGGGCCTGGGAGAAACAGG - Intronic
976199849 4:82567137-82567159 CTTTTCCGTCTTGGAGGAACCGG + Intergenic
981433987 4:144698450-144698472 CTTTGCAGCCTAGGAGCAACGGG + Intronic
982615896 4:157637093-157637115 CCGTGCCGTCCGGGAGGAAGTGG - Intergenic
983256206 4:165403754-165403776 CCTGGCCTCCTGACAGGAACAGG + Intronic
983626793 4:169809685-169809707 GCTTGACTCTTGGGAGGAACTGG - Intergenic
985446191 4:190022284-190022306 CATCGCCGCCCGGGAGGAGCTGG - Intergenic
985452181 4:190068294-190068316 CATCGCCGCCCGGGAGGAGCTGG + Intergenic
985453165 4:190071591-190071613 CATCGCCGCCCGGGAGGAGCTGG + Exonic
985454155 4:190074884-190074906 CATCGCCGCCCGGGAGGAGCTGG + Exonic
985455143 4:190078177-190078199 CATCGCCGCCCGGGAGGAGCTGG + Exonic
985456131 4:190081477-190081499 CATCGCCGCCCGGGAGGAGCTGG + Exonic
985457115 4:190084771-190084793 CATCGCCGCCCGGGAGGAGCTGG + Intergenic
985458102 4:190088064-190088086 CATCGCCGCCCGGGAGGAGCTGG + Exonic
985459091 4:190091364-190091386 CATCGCCGCCCGGGAGGAGCTGG + Exonic
985463344 4:190174133-190174155 CATCGCCGCCCGGGAGGAGCTGG + Exonic
985610257 5:883937-883959 CCTTGCCGCCTGGGAGGAACCGG + Exonic
985933958 5:3080294-3080316 CACTGGGGCCTGGGAGGAACTGG + Intergenic
988064670 5:26218903-26218925 ACCTGCCGCCTGGAAGGAAAGGG + Intergenic
991022937 5:61999600-61999622 CCTGGCTGCCTGGCAGGATCTGG - Intergenic
991964682 5:72079372-72079394 CCTTGCCCTCTGGAAGGGACAGG - Intergenic
996574114 5:124963295-124963317 CCTTGACCCCTGGGAGCGACAGG - Intergenic
999148718 5:149412826-149412848 CCCTGCCTCCTTGGAGGGACAGG - Intergenic
999274647 5:150321358-150321380 CCTTGCCTCTTGGGAGGAGCTGG + Intronic
999901248 5:156089024-156089046 CCTTGTCCCCTGGATGGAACAGG + Intronic
1003399389 6:5779182-5779204 ACCTGCCACCTGGGAGGAACCGG + Intergenic
1004690522 6:17988379-17988401 CCTCGCTGCCAGGGCGGAACTGG + Intergenic
1006370394 6:33640578-33640600 CCCTGCAGCCTGGGAGGGGCGGG - Intronic
1018616489 6:165691729-165691751 CATGGCCACCTGGGAGGAACAGG - Intronic
1019310322 7:357293-357315 GCTTGCCTCCTGAGAGGCACGGG + Intergenic
1022584551 7:31594176-31594198 GTTTGCAGCCTGGGAGGAATAGG + Intronic
1024504521 7:50150382-50150404 ACTTGCCCCCAGGGAGGAAAGGG - Intronic
1025010740 7:55395953-55395975 CTTTGCAGCCTAGGAGCAACAGG - Intronic
1026773839 7:73218899-73218921 CCTGGCCTGCTGGGAGGCACAGG + Intergenic
1027014696 7:74772289-74772311 CCTGGCCTGCTGGGAGGCACAGG + Intergenic
1027073335 7:75173666-75173688 CCTGGCCTGCTGGGAGGCACAGG - Intergenic
1029437948 7:100573187-100573209 CCAGGCCACCTGGGGGGAACGGG + Exonic
1029443587 7:100601132-100601154 CCTTGGGGGCTGGGAGGGACAGG + Intergenic
1029525084 7:101089178-101089200 CCTTGCCTCCAGGAATGAACCGG - Exonic
1032578709 7:133082697-133082719 CTTTGCAGCCTGGGAGCAATAGG - Intergenic
1033219006 7:139515555-139515577 TCCTTCCGCATGGGAGGAACAGG + Intergenic
1034468278 7:151242504-151242526 CATTGCCTCCTGGGAGCTACGGG - Exonic
1036674771 8:10821419-10821441 CCTGCCCTCCTGGCAGGAACAGG - Intronic
1038571564 8:28667052-28667074 CCTTGCCGCCCCAGAGGATCTGG - Intronic
1044713360 8:95077784-95077806 CCTTGCACCCTTGGAGGGACAGG - Intronic
1049416831 8:142499183-142499205 CCTCCCCGCCAGTGAGGAACAGG - Intronic
1049814486 8:144591802-144591824 CCTCCCTGCCTGGAAGGAACAGG + Intronic
1051587840 9:18746047-18746069 CCTTGCTCCCTGGGGGCAACGGG - Intronic
1055000984 9:71448151-71448173 CTTTGCCTCCTGGGAAGATCTGG - Intergenic
1061653424 9:132069212-132069234 ACTTGCCGTCTGGGAGCCACTGG - Intronic
1062382244 9:136292057-136292079 CCAGGCCGCCTGGAAGGAAGAGG - Intronic
1190032079 X:46983561-46983583 CCTTTCTTCCTGGGAAGAACAGG - Intronic
1190963973 X:55280281-55280303 CATTGCGACCTGGGAGGAGCCGG - Intronic
1194014779 X:88605533-88605555 TCTTGACCCCTGGGAGTAACAGG - Intergenic
1194703304 X:97142561-97142583 CCATGGCTCCTGTGAGGAACAGG + Intronic
1196874443 X:120144625-120144647 CCTTGCCGGCCGGCAGGAGCAGG + Intergenic