ID: 985611377

View in Genome Browser
Species Human (GRCh38)
Location 5:891534-891556
Sequence CTGCGTGGCTGGAGGAGGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 821
Summary {0: 1, 1: 0, 2: 4, 3: 80, 4: 736}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985611377_985611395 27 Left 985611377 5:891534-891556 CCTCCCCTCCTCCAGCCACGCAG 0: 1
1: 0
2: 4
3: 80
4: 736
Right 985611395 5:891584-891606 GGCTCCCCACGGGCTCCTCGTGG 0: 1
1: 0
2: 0
3: 16
4: 163
985611377_985611396 28 Left 985611377 5:891534-891556 CCTCCCCTCCTCCAGCCACGCAG 0: 1
1: 0
2: 4
3: 80
4: 736
Right 985611396 5:891585-891607 GCTCCCCACGGGCTCCTCGTGGG 0: 1
1: 0
2: 0
3: 5
4: 79
985611377_985611387 -1 Left 985611377 5:891534-891556 CCTCCCCTCCTCCAGCCACGCAG 0: 1
1: 0
2: 4
3: 80
4: 736
Right 985611387 5:891556-891578 GGCGCACTCTGCCTGGGTCCTGG 0: 1
1: 0
2: 2
3: 11
4: 168
985611377_985611386 -7 Left 985611377 5:891534-891556 CCTCCCCTCCTCCAGCCACGCAG 0: 1
1: 0
2: 4
3: 80
4: 736
Right 985611386 5:891550-891572 CACGCAGGCGCACTCTGCCTGGG 0: 1
1: 0
2: 0
3: 12
4: 80
985611377_985611389 6 Left 985611377 5:891534-891556 CCTCCCCTCCTCCAGCCACGCAG 0: 1
1: 0
2: 4
3: 80
4: 736
Right 985611389 5:891563-891585 TCTGCCTGGGTCCTGGGACCAGG 0: 1
1: 0
2: 4
3: 53
4: 470
985611377_985611393 17 Left 985611377 5:891534-891556 CCTCCCCTCCTCCAGCCACGCAG 0: 1
1: 0
2: 4
3: 80
4: 736
Right 985611393 5:891574-891596 CCTGGGACCAGGCTCCCCACGGG 0: 1
1: 0
2: 0
3: 23
4: 292
985611377_985611388 0 Left 985611377 5:891534-891556 CCTCCCCTCCTCCAGCCACGCAG 0: 1
1: 0
2: 4
3: 80
4: 736
Right 985611388 5:891557-891579 GCGCACTCTGCCTGGGTCCTGGG 0: 1
1: 0
2: 2
3: 17
4: 187
985611377_985611391 16 Left 985611377 5:891534-891556 CCTCCCCTCCTCCAGCCACGCAG 0: 1
1: 0
2: 4
3: 80
4: 736
Right 985611391 5:891573-891595 TCCTGGGACCAGGCTCCCCACGG 0: 1
1: 0
2: 0
3: 48
4: 327
985611377_985611385 -8 Left 985611377 5:891534-891556 CCTCCCCTCCTCCAGCCACGCAG 0: 1
1: 0
2: 4
3: 80
4: 736
Right 985611385 5:891549-891571 CCACGCAGGCGCACTCTGCCTGG 0: 1
1: 0
2: 1
3: 16
4: 138

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985611377 Original CRISPR CTGCGTGGCTGGAGGAGGGG AGG (reversed) Intronic
900110114 1:1001732-1001754 CTGCGAGGCCGGAGCGGGGGTGG + Intergenic
900129189 1:1080423-1080445 CTGGGTGGGAGGAGGAGGAGGGG + Intergenic
900167257 1:1248694-1248716 CTGGGAGGCTGGAGCAAGGGAGG + Intergenic
900333182 1:2146911-2146933 CTGGTTGGCTGGATGAGGGCTGG - Intronic
900357198 1:2270679-2270701 CAGAGGGGCTGGAGGTGGGGCGG + Intronic
900367631 1:2317760-2317782 CTGCGTGTCAGGGGGAGGGCGGG - Intergenic
900421424 1:2557508-2557530 CATCAGGGCTGGAGGAGGGGCGG + Intronic
900647116 1:3714009-3714031 TGGCATGGCTGGGGGAGGGGTGG - Intronic
900997846 1:6131994-6132016 CTGTGTGGTGGGAGCAGGGGAGG - Intronic
901192684 1:7421961-7421983 CGCCGTGGCTGGGGGAGTGGAGG + Intronic
901839415 1:11944705-11944727 CTGCGGTGCTGGGGGAGGAGGGG - Intronic
901927060 1:12573022-12573044 CTGTGTGCCTGGAGGAGTGAGGG - Intronic
902145892 1:14398855-14398877 CTGAGTGCCTGGATGTGGGGAGG - Intergenic
902513315 1:16977554-16977576 CTGGTGGGCTGGAGGTGGGGCGG - Intronic
902610719 1:17595703-17595725 CCCCGTGCCTGGAGGAGAGGCGG + Intronic
902776197 1:18676480-18676502 ATGAGTGGCTGGGGGAGGGGAGG + Intronic
903293504 1:22329303-22329325 CTGAGTGGCTGGAGTAGAGTGGG - Intergenic
903590783 1:24454338-24454360 CAGCGTGGCTTAAGGAGGGAGGG - Intronic
903852876 1:26318800-26318822 GTGGGTGGCTGGATGTGGGGTGG - Intronic
904035586 1:27557023-27557045 CTGTGTGGCTGGGGGTAGGGTGG - Intronic
904042621 1:27593229-27593251 CTGCCTGCCTGGAGGAGTGGAGG - Intronic
904089667 1:27935926-27935948 CCGCGTGGCTGAAGCAGGGTGGG + Intronic
904251010 1:29224288-29224310 CTGTCTGGCTGGAGGCTGGGAGG + Intronic
904276866 1:29390629-29390651 CAGCCAGGTTGGAGGAGGGGCGG - Intergenic
904455709 1:30646898-30646920 CTGCAGGGCTGTGGGAGGGGAGG + Intergenic
904470261 1:30731686-30731708 CAGCGTGGCTGCAAGTGGGGAGG - Intergenic
904610920 1:31725936-31725958 CAGGGGTGCTGGAGGAGGGGCGG - Intergenic
904690917 1:32292645-32292667 CTCAGAGGCTGGGGGAGGGGAGG - Intronic
904734906 1:32624238-32624260 AAGAGTGGTTGGAGGAGGGGAGG - Intronic
905046545 1:35007809-35007831 CTGTCTGGCTGGGGGATGGGGGG + Intronic
905353409 1:37363268-37363290 CTCAGTGCCTGGAGGAGGAGGGG - Intergenic
905687940 1:39922254-39922276 CTGTGTGTCAGAAGGAGGGGCGG + Intergenic
905906051 1:41619142-41619164 TGGTGTGGCTGGAGGAGTGGGGG - Intronic
906205744 1:43985428-43985450 CTGGGTGGGGGGGGGAGGGGGGG + Intronic
906572786 1:46858702-46858724 CTGGGGGGCAGGAGGATGGGTGG + Intergenic
906598983 1:47107186-47107208 CTGGGGGGCAGGAGGATGGGTGG - Intronic
906661985 1:47589561-47589583 CTGAGTGGCTGGAGACGGTGAGG - Intergenic
906704482 1:47885004-47885026 CTGGGTGGCAGGGGAAGGGGAGG - Intronic
906961856 1:50423619-50423641 CTGCGTGCCTCTGGGAGGGGAGG + Intergenic
907485646 1:54776227-54776249 CTGTGTGGCAGGAGGAGCTGGGG + Intergenic
907666234 1:56435977-56435999 TTGCCAGGCTGGAGGAGGAGGGG - Intergenic
908951333 1:69567073-69567095 GTTCATGGCAGGAGGAGGGGCGG + Intergenic
910092479 1:83481372-83481394 CTGCGTGGCTGGAGCAGAGTAGG - Intergenic
910243663 1:85115691-85115713 CTGGGTGGCAGGGGGAGGTGGGG + Intronic
910253216 1:85220019-85220041 CTGCCTGGCTGAAGGAGCAGTGG + Intergenic
911017159 1:93345819-93345841 CGGCGTGGGTGGGGGAAGGGCGG + Intergenic
911670655 1:100603974-100603996 CAGCAAGGCTGGGGGAGGGGGGG - Intergenic
912386203 1:109272419-109272441 ATGGGAGGGTGGAGGAGGGGAGG + Intronic
912431871 1:109632324-109632346 CTCAGAGGCTGGAAGAGGGGAGG - Intergenic
912667214 1:111593072-111593094 CTGAGTGGGTGGAGGGGGCGGGG + Intronic
912798582 1:112707144-112707166 CCGCGGCGCTGGAGGAGGGCGGG - Intronic
912800828 1:112718932-112718954 ACGCGGGGCTGGAGGAGCGGGGG + Intergenic
913075580 1:115338342-115338364 GTGCGGGGCTGGTGGTGGGGAGG - Intergenic
913592379 1:120341631-120341653 GTGTGTGGCTGGGGGTGGGGTGG - Intergenic
913650979 1:120913514-120913536 GTGTGTGGCTGGGGGTGGGGTGG + Intergenic
914170135 1:145215553-145215575 GTGTGTGGCTGGGGGTGGGGTGG - Intergenic
914431317 1:147622277-147622299 CTGGCTGGCTGTAGGAGGTGGGG - Exonic
914511346 1:148335044-148335066 CTGAGTGGCAGAAGGTGGGGCGG - Intergenic
914525252 1:148459516-148459538 GTGTGTGGCTGGGGGTGGGGTGG - Intergenic
914598424 1:149176314-149176336 GTGTGTGGCTGGGGGTGGGGTGG + Intergenic
914641150 1:149607618-149607640 GTGTGTGGCTGGGGGTGGGGTGG + Intergenic
914718849 1:150272726-150272748 CTGCTTTGGAGGAGGAGGGGAGG + Intronic
915301278 1:154953013-154953035 CTGAGTGGCTAGAGAAGGGATGG - Intronic
915333479 1:155127753-155127775 CTGGGGAGGTGGAGGAGGGGCGG - Exonic
915530949 1:156501595-156501617 CTGTGCGGCGGGAGGTGGGGAGG - Intergenic
915685267 1:157625905-157625927 CTGCTTGGCTGGGGCTGGGGTGG + Intergenic
916123747 1:161551060-161551082 GTGTGTGGCGGGGGGAGGGGTGG - Intergenic
916133633 1:161632423-161632445 GTGTGTGGCAGGGGGAGGGGTGG - Intronic
916394810 1:164374416-164374438 CTGGGGAGCTGGAGTAGGGGTGG - Intergenic
917398390 1:174618734-174618756 CTGCGTTTTTGGAGGAGGAGAGG - Intronic
919678335 1:200409415-200409437 GTCCGGGGCTGGCGGAGGGGGGG + Exonic
919759703 1:201089798-201089820 CTGCCTGGCTGGAGCAGGGCTGG + Intronic
920305101 1:205013747-205013769 CTGGGTGGCATGAGGAGGGAGGG - Intronic
920444553 1:206006030-206006052 CCACGTGGCTGGAGGAAGTGGGG - Intergenic
920705657 1:208248685-208248707 CTAGATGGATGGAGGAGGGGAGG - Intergenic
922196744 1:223365091-223365113 TTGGGTACCTGGAGGAGGGGAGG + Intergenic
922558458 1:226549995-226550017 GTGCCAAGCTGGAGGAGGGGAGG - Intronic
922718150 1:227887460-227887482 CAGCCTTGCTGGGGGAGGGGAGG + Intergenic
922803317 1:228373722-228373744 CCCCGTGCCTGGAGGTGGGGAGG + Intronic
922899322 1:229123888-229123910 CTGAGGGGCTGGAGGCTGGGTGG - Intergenic
923055701 1:230425206-230425228 CGGCGTGGCTGGTGGAGGCAGGG - Intronic
923202534 1:231725996-231726018 CTGCAAGGCTGGAGGAGGAAAGG - Intronic
923372435 1:233327592-233327614 CGGGGCGGCTGGGGGAGGGGCGG + Intergenic
924439469 1:244074267-244074289 CTGGGTGGCTGGCGGCAGGGTGG + Intergenic
924629098 1:245720581-245720603 CTGCTAGTCTGGGGGAGGGGTGG + Intergenic
924825420 1:247533129-247533151 CAGAGTGGCAGGAGCAGGGGTGG - Intronic
1064104544 10:12490038-12490060 CTCCTTGGCTGGAGCAGGGGAGG + Intronic
1064174993 10:13067015-13067037 GTGTGGGGCTTGAGGAGGGGTGG + Intronic
1065390059 10:25174500-25174522 CTGCGTGGGTGGCGTAGGGTGGG - Intergenic
1066067368 10:31772163-31772185 CTGGGAGGCAGGAGGAGGAGAGG - Intergenic
1066379047 10:34885735-34885757 CAGCGTGGGTGTAGGAGGTGGGG + Intergenic
1066997552 10:42578001-42578023 CTCTGTGACTAGAGGAGGGGTGG - Intronic
1067089958 10:43261487-43261509 GTGGGTGGCTGGATGAGGAGTGG - Intronic
1067146057 10:43694732-43694754 CAGAGGGGCTGGAGGAGGGGAGG + Intergenic
1067343014 10:45419500-45419522 CTGCGGGGCTGGGGGAGGGCCGG - Intronic
1067798858 10:49342928-49342950 CTGCCGGGGTGGAGGAGGAGTGG - Intergenic
1067903118 10:50262819-50262841 CAGTGAGGCTGGGGGAGGGGCGG + Intergenic
1069047600 10:63759574-63759596 CACCATGTCTGGAGGAGGGGTGG + Intergenic
1069828142 10:71266645-71266667 CTGGGAGGCTGGGGCAGGGGTGG + Intronic
1069859404 10:71461139-71461161 CTGTGTGGCTGCAGGGGTGGAGG - Intronic
1069882397 10:71601946-71601968 CTGGGTGGGCGGCGGAGGGGGGG + Intronic
1070312033 10:75280968-75280990 CTGCCTGGCTGGAGCAAGGCAGG + Intergenic
1070456986 10:76626976-76626998 CTGCCTGGAAGGAGGTGGGGTGG + Intergenic
1070499969 10:77063352-77063374 CTGGGTTGCTGGGGGAGAGGTGG + Intronic
1070788998 10:79178682-79178704 ATGCGGGGGTGGGGGAGGGGTGG - Intronic
1071852584 10:89589725-89589747 TTCCGTGGGTGGAGGAGTGGAGG + Intronic
1072535451 10:96359394-96359416 CGGGATGTCTGGAGGAGGGGTGG + Intergenic
1073177569 10:101565722-101565744 CTGCATGGCTGGCTGGGGGGTGG - Intergenic
1073185413 10:101612678-101612700 CTGGGATGCTGGGGGAGGGGTGG - Intronic
1074012865 10:109501567-109501589 TTCCGTGGCTGGAGCAGGGAGGG + Intergenic
1074123741 10:110512162-110512184 CTGCGTAGGTGGAGGAAGGAAGG + Intergenic
1074532289 10:114305802-114305824 CGTCGGGGCTGCAGGAGGGGAGG + Intronic
1075288291 10:121205865-121205887 CTGGGTGGCTGCAGGGGGAGAGG + Intergenic
1075658274 10:124175812-124175834 ATGCCAGGCTGGGGGAGGGGAGG - Intergenic
1076074609 10:127523229-127523251 CTGCATGAGTGGTGGAGGGGAGG + Intergenic
1076754188 10:132559505-132559527 CTTCGTGGTTGGCGGAAGGGGGG - Intronic
1076796012 10:132798851-132798873 CTCTGTGGCGGGAGAAGGGGAGG + Intergenic
1076923043 10:133465446-133465468 CCGTGTGGCTGGACGAGGTGGGG + Intergenic
1076988785 11:258139-258161 CTGAGTGGCTGAAGAAGGTGAGG - Intergenic
1077013865 11:391558-391580 CTGCGTGGGTGGAGGGGGTTGGG - Intergenic
1077166015 11:1139243-1139265 CGGGGTGGCTGGGGGAGGCGGGG + Intergenic
1077363210 11:2150230-2150252 GTGCGTGGGTGTTGGAGGGGGGG - Intronic
1077500938 11:2909492-2909514 GGGCGTGGCTTGTGGAGGGGCGG + Intronic
1079591989 11:22192864-22192886 CTGCATGTCCGGAGGAGGTGCGG + Intergenic
1080015896 11:27506643-27506665 CTGTGTCGCTGGAGGGGAGGAGG - Intronic
1081537351 11:44005378-44005400 CTGCCTGGGTGGGGGAGGGGAGG + Intergenic
1082050457 11:47766929-47766951 CTGCGGGCCTGCAGGCGGGGCGG - Intronic
1082063427 11:47879772-47879794 ATGTGTGTCTGGAGGTGGGGAGG - Intergenic
1082092330 11:48100106-48100128 CTCCTTGGGTGGAGGTGGGGTGG + Intronic
1082759262 11:57110943-57110965 CTGTGTGGCTGGAGAAGGGAAGG - Intergenic
1082821176 11:57545791-57545813 CTGTGGGGCTGGAGGGTGGGTGG - Intronic
1083736776 11:64686009-64686031 CTGCGTTGCTGGAGGGGAGAGGG - Intronic
1083749291 11:64752629-64752651 CTGGGCGGCTGGAGGAGGAGGGG - Intronic
1083768815 11:64855099-64855121 CTGCGTGGTGGGGGGAGGGCAGG - Intronic
1083822760 11:65182108-65182130 CTGCGTTCCTGGAGCAGGGGTGG + Intronic
1084121073 11:67069294-67069316 CTGCTTGCCTGGTGGAGGGAGGG - Intronic
1084167672 11:67383579-67383601 CTGCAGGGCTGGAGGTGGAGGGG - Intronic
1084740732 11:71137929-71137951 CTGGGCGGCTGGTGCAGGGGTGG - Intronic
1084775365 11:71371229-71371251 CTGCGTGGTTGGAGAAAGTGAGG - Intergenic
1084884117 11:72192215-72192237 GTGGGTGGCTGTAGTAGGGGAGG + Exonic
1085307799 11:75498083-75498105 GTGGGGGGCTGGTGGAGGGGGGG + Intronic
1086067038 11:82756558-82756580 CTGTGTGGCTGGGGCAGGGTTGG + Intergenic
1086697676 11:89864118-89864140 CGGCGCGGCTGGGGGTGGGGAGG - Intergenic
1088481080 11:110296739-110296761 CTGCGAGCCTGCGGGAGGGGCGG - Intergenic
1089178280 11:116563753-116563775 CTGCGTGGCAGGGGGTCGGGAGG + Intergenic
1089391610 11:118106057-118106079 CTCCGTGGCTGCAGGAAGAGGGG - Intronic
1089430971 11:118424200-118424222 CAGTGTGGCTGGAGGAAGAGTGG - Intronic
1089457721 11:118635065-118635087 CCGCGGGGCCGGGGGAGGGGGGG - Intronic
1089527526 11:119107250-119107272 CTCCCTCGCTGGAGGAGGGCGGG - Exonic
1089650121 11:119907488-119907510 CTGGGTGGCTGGTGGACAGGTGG + Intergenic
1089660180 11:119980617-119980639 GGGTGTGGCTGGAGGAGCGGAGG + Intergenic
1090817941 11:130314930-130314952 CGGCCTGGCTGGGGAAGGGGAGG + Intergenic
1090877256 11:130801727-130801749 CTGGGTGGGTGGAGGAAGGTGGG + Intergenic
1091237974 11:134034299-134034321 CTGCAGAGCTGGAGGAGGGAGGG + Intergenic
1091277543 11:134362686-134362708 GTGTGTGGCAGGTGGAGGGGAGG - Intronic
1091398575 12:169413-169435 CAGCCTGGCTGCAGGAGGGAAGG - Intronic
1091671652 12:2456516-2456538 CAGTGTGGCTGGAGCAGGGCAGG - Intronic
1091973649 12:4809074-4809096 CTGCGGGGGTGGAGGGGGTGTGG + Intronic
1092244670 12:6856898-6856920 GAGAGTGGCTGGAGGAGGGGAGG - Intronic
1092845797 12:12583916-12583938 CAGCCTGTCTGGAGGAAGGGTGG + Intergenic
1092919963 12:13222379-13222401 GGGTGTGGCTGGAGGAGGGTTGG + Intergenic
1093609577 12:21137541-21137563 CAGCGAGGCTGGGGGAGGGGCGG - Intronic
1094424912 12:30307296-30307318 CTCAGTGGCTGGAAGAGGGGCGG + Intergenic
1094429413 12:30350317-30350339 CTGTGTGGGTGGGGGGGGGGCGG + Intergenic
1096546804 12:52345680-52345702 CTGGGCTGCTGGAGGAGGGTGGG + Intergenic
1096783573 12:54004651-54004673 GTCGGTGGCTGGAGGAGGGTAGG + Intronic
1097098768 12:56571309-56571331 CTGCGTGGCTGGAAGAGAAGTGG + Intronic
1097156637 12:57016613-57016635 CAGGGTGGCTGGAGGGGAGGCGG + Intronic
1097259688 12:57711121-57711143 CTGTGGGGCTGGAGCAGGGATGG - Intronic
1097278636 12:57830536-57830558 CTGCTGGAGTGGAGGAGGGGAGG - Intronic
1097688578 12:62713394-62713416 CTGGGCTGCTTGAGGAGGGGAGG + Intronic
1098311934 12:69157191-69157213 CTGCAAGGCTGGAGGAGGGAAGG - Intergenic
1098347723 12:69524063-69524085 CAGCATGGCTGGAGGAGGGCAGG + Intronic
1098924397 12:76333640-76333662 CAGCATGGCTGGGGCAGGGGAGG - Intergenic
1099987756 12:89687519-89687541 CTAGGTGGGTGGAGGTGGGGTGG + Intronic
1100549784 12:95636413-95636435 CTTTGAGGGTGGAGGAGGGGAGG - Intergenic
1101005831 12:100399969-100399991 AAGCCAGGCTGGAGGAGGGGAGG - Intronic
1101966990 12:109288205-109288227 CTGCTGGGCTGGAGGAATGGTGG + Intronic
1102099826 12:110269834-110269856 CTGCATGGATGGGGGATGGGAGG - Intergenic
1102112336 12:110373921-110373943 CTCCCTGGCTGGAGCAGGGGAGG + Exonic
1102212587 12:111138120-111138142 CTGCCAGGCTGGCCGAGGGGAGG + Intronic
1102434111 12:112907232-112907254 CTGCCTGGCCAGGGGAGGGGTGG + Intronic
1102548751 12:113675455-113675477 ATCTGGGGCTGGAGGAGGGGAGG - Intergenic
1102571664 12:113830567-113830589 CTGCGGGGCGGGGGGGGGGGGGG + Intronic
1102952954 12:117042278-117042300 CTGGGGGGCTGGGGGAGGGGAGG - Intronic
1103045085 12:117729484-117729506 CTGCCTGGCAGGATGAGGGCTGG + Intronic
1103563181 12:121803308-121803330 GCGGGTGGCTGGAGGAAGGGGGG + Intronic
1103583483 12:121933932-121933954 CAGAGTGGCTGGGGGAGGGGAGG + Intronic
1103698346 12:122835056-122835078 CTGGGTGGAAGGAGGAGGGAGGG + Intronic
1103937301 12:124483427-124483449 CTGGGTGGCAGGAAGAGGGCAGG - Intronic
1103942334 12:124507914-124507936 CTGCGTGCATGGAGGAGAAGCGG - Intronic
1104756795 12:131274358-131274380 CAGCTTGGCAGGGGGAGGGGAGG - Intergenic
1104880005 12:132064087-132064109 CTGTGTGGCTGTAGGCCGGGGGG - Intronic
1104896239 12:132166394-132166416 CTGGGTGGATGAAGGATGGGTGG - Intergenic
1106134463 13:26963570-26963592 CTTAGTGGCTGGAGGGGGTGGGG + Intergenic
1107157117 13:37181370-37181392 CTGCATGGGTGGAAGAGGAGTGG + Intergenic
1107674219 13:42777738-42777760 CTGCTTGGCTGAATCAGGGGAGG - Intergenic
1107997238 13:45872952-45872974 GTGTGTGACTGGAGGAGGGGAGG - Intergenic
1108482838 13:50892287-50892309 CTATGTGGCTGGAGGGGTGGGGG - Intergenic
1110295243 13:73856523-73856545 GTGCGTGTATGGAGGAGGGAGGG - Intronic
1110425035 13:75357481-75357503 CAGTGTGGCTGGAGTTGGGGAGG - Intronic
1112338894 13:98536867-98536889 CTGGGCGGCTGGAGGACAGGCGG - Intronic
1113981631 13:114281547-114281569 CGCCGCGGCTCGAGGAGGGGCGG + Intergenic
1114334104 14:21670125-21670147 CTGGGAGGCTGGTGGATGGGCGG + Intergenic
1114405693 14:22453927-22453949 GTGTGTGGCTGGAGGAGGGGAGG + Intergenic
1115038022 14:28884436-28884458 CTGCTTGGGAGGATGAGGGGAGG + Intergenic
1115510934 14:34137272-34137294 CTGAGTGGCTGGAGAAGCAGTGG + Intronic
1115773321 14:36688592-36688614 CTGGGCTGCTGGAGGTGGGGCGG - Intronic
1118516441 14:66533536-66533558 CTGAATGGCTGTAGGAGGGATGG + Intronic
1118758632 14:68864130-68864152 CTGTGTGCCTGCAGGAGTGGGGG - Intergenic
1119429356 14:74555748-74555770 GTGGGTGGCTGGATGAGGAGTGG - Intronic
1119470950 14:74898812-74898834 CTGTGGAGCTGGGGGAGGGGAGG - Intronic
1119692924 14:76690946-76690968 CTGCTAGGCTGGAGTAGAGGAGG + Intergenic
1120619899 14:86750712-86750734 CAGCCTGGCTGGGGAAGGGGTGG - Intergenic
1120914843 14:89701796-89701818 CTGCGGGGCCGGAGTGGGGGAGG + Intergenic
1121748103 14:96318747-96318769 CTTCGAGGATGGATGAGGGGAGG - Intronic
1122619810 14:103049287-103049309 CTGCTTGGCTGAAGGAGGGTGGG + Intronic
1122884631 14:104705598-104705620 CTGCATGGATACAGGAGGGGCGG - Intronic
1122887469 14:104716622-104716644 GTGCGTGGCAGGAGCTGGGGCGG - Intronic
1123144996 14:106120672-106120694 CTGCCTTTCTTGAGGAGGGGAGG + Intergenic
1123998486 15:25734989-25735011 CTGCGTGGTGGGAGCGGGGGGGG + Intronic
1124439242 15:29674940-29674962 CAGCGGGGCTGGCGGAGGGGCGG - Intergenic
1124682050 15:31740246-31740268 CTGAGTGCCTGGAGCAGAGGTGG + Intronic
1125711282 15:41788862-41788884 CTGATGGGTTGGAGGAGGGGAGG + Intronic
1125718774 15:41835220-41835242 CTGGGTGAGTGGAGGTGGGGTGG + Exonic
1125720443 15:41842640-41842662 GTGCGGGGCTGGAGGAGGCCTGG + Intronic
1126034902 15:44536967-44536989 CTGCGGGGCTGAGGGAGAGGCGG - Intergenic
1126104960 15:45141422-45141444 AGGGGTGGCTGGAGGAGTGGTGG + Intronic
1126313253 15:47340152-47340174 CTGCGTGGATGGAGCAGAGTAGG + Intronic
1126545879 15:49873720-49873742 CTGCCTGGCTGCAGGAGGTGTGG + Intronic
1127426788 15:58865640-58865662 CTGCGTGCCGGGAGGAGTGAAGG - Intronic
1127931860 15:63602033-63602055 CTGGGTGGGTGGAAGAGGCGAGG + Exonic
1128109309 15:65066909-65066931 CTGGCTGGCTGAAGGAGGGAGGG - Intronic
1128224005 15:65989185-65989207 ATGCTGGGCTGGAGGTGGGGTGG + Intronic
1128454232 15:67823598-67823620 GTGCGCGGCGGGAGGAGCGGCGG - Intronic
1128525004 15:68406356-68406378 CAGTATGGCTGGAGGAGAGGAGG - Intronic
1128877287 15:71212832-71212854 CTGGGTGGCTGGGGGAGCTGAGG + Intronic
1129325981 15:74800534-74800556 CTGCGTGGGAGGAGGTGGGTGGG - Intronic
1129480864 15:75824436-75824458 GTGGGAGACTGGAGGAGGGGAGG + Intergenic
1130953863 15:88613042-88613064 CTGTATGGATGGAGGAGGGTGGG - Intergenic
1131250729 15:90828358-90828380 GTGCGTGGATGGGGGCGGGGCGG + Intergenic
1131873632 15:96783362-96783384 CTGGGCGGGTGGGGGAGGGGTGG - Intergenic
1132157077 15:99503134-99503156 CTGCTTGGGGGGAGGAGGGGTGG + Intergenic
1132314401 15:100879737-100879759 CTGCGGGACCGGAGGAAGGGAGG - Exonic
1132543501 16:522428-522450 CTGCCTGGATGCAGGAGGGCAGG + Exonic
1132644690 16:993546-993568 GTGGGTGGATGGAGGATGGGAGG - Intergenic
1132658428 16:1051087-1051109 GTCCGTCGCTGGAGCAGGGGTGG + Intergenic
1132883752 16:2173458-2173480 CTGAGTAGCAGGAGGAGAGGGGG - Intronic
1132939965 16:2501614-2501636 CTGGGTGGGAGGAGGAGGGTGGG + Exonic
1132953242 16:2576841-2576863 CAGCGTGGCCGGAGGAGGGCAGG + Intronic
1132961110 16:2623327-2623349 CAGCATGGCCGGAGGAGGGCAGG - Intergenic
1133280032 16:4659987-4660009 CGGCCTGGCTGCAGGACGGGAGG - Intronic
1133420492 16:5642611-5642633 CTGGGTGGCTGGGGAAGGGGGGG - Intergenic
1133443139 16:5837183-5837205 CTCCGTGGGAGGAGGAGAGGAGG - Intergenic
1133632187 16:7631623-7631645 CTGGGTGCCTGGAGTGGGGGTGG + Intronic
1133950511 16:10387827-10387849 CCGGGTGGCGGGGGGAGGGGGGG - Intronic
1134112643 16:11524745-11524767 CTGGGTGGCTGGAGGGAGGGAGG - Intergenic
1134128166 16:11630478-11630500 CTGTGTGCCTGGAGCAGGCGGGG - Intronic
1134224404 16:12380388-12380410 GTGGGTGGATGGATGAGGGGTGG - Intronic
1134224415 16:12380415-12380437 CTAGGTGGATGGATGAGGGGTGG - Intronic
1134411359 16:14005036-14005058 CTGCATGACTGGAGGTGGGAAGG + Intergenic
1135993023 16:27228971-27228993 GTGCGTTGCTGGAGGAGAGTGGG - Intronic
1136375538 16:29863094-29863116 CTGCGGGGCTGGCAGAGGCGAGG - Exonic
1136478591 16:30527453-30527475 CCGCGGGGTTGGAGGAGGCGGGG - Intronic
1136513097 16:30751201-30751223 CTGAGCAGCTGGAGGAGGTGCGG + Exonic
1137063381 16:35811967-35811989 CAGCATGGGTGGAGGAAGGGAGG - Intergenic
1137591143 16:49694704-49694726 CTTCCTGGATGGAGGAGGGCAGG - Intronic
1137669200 16:50269510-50269532 CTGCGTGGCTGGGCCAGGGTGGG + Intronic
1138242977 16:55443991-55444013 TTGGGTGGCAGGGGGAGGGGAGG + Intronic
1139749483 16:69100599-69100621 GTGAGTGGCTTGAGCAGGGGAGG - Intergenic
1139914315 16:70418839-70418861 GTGCGTGGGTGGGGGAGGAGAGG - Intronic
1140078650 16:71723998-71724020 CAGCGGGGCTGCGGGAGGGGCGG - Intronic
1140471675 16:75218907-75218929 CTCCCTGGCTGGGGGAGCGGGGG + Intergenic
1141488196 16:84354989-84355011 ATGGGTGGGTGGAGGAGTGGAGG + Intergenic
1141490718 16:84370803-84370825 CAAAGTGGCTGGGGGAGGGGAGG - Intronic
1141648619 16:85380510-85380532 CAGGGTGGCGGGTGGAGGGGGGG - Intergenic
1141666571 16:85468702-85468724 CTGCGTGGCTCCAGGCAGGGAGG - Intergenic
1141679916 16:85537938-85537960 GAGCGTGGCTGGAGCAGGGGTGG + Intergenic
1141904265 16:87013258-87013280 CTGTCTGTCTGGAGGAGCGGAGG - Intergenic
1142005127 16:87686057-87686079 CTCCGTGGCTGGAGGGTGGCTGG + Intronic
1142109378 16:88323177-88323199 CTGCGTGGCAGAAGGCAGGGTGG - Intergenic
1142111476 16:88333824-88333846 CTGCGTGGCAGGGGGTGGGGGGG + Intergenic
1142152203 16:88517548-88517570 GTGAGTGGGTGAAGGAGGGGTGG + Intronic
1142152834 16:88520308-88520330 GTGAGTGGGTGAAGGAGGGGTGG + Intronic
1142232320 16:88905684-88905706 GGGCGGGGCTGAAGGAGGGGCGG + Intronic
1142232334 16:88905715-88905737 GGGCGGGGCTGAAGGAGGGGCGG + Intronic
1142246990 16:88974779-88974801 TCGCCTGGCTGGAGGAGCGGGGG - Intronic
1142252095 16:88996674-88996696 CTGCGGTGCTGGAGGGGTGGGGG + Intergenic
1142323909 16:89401943-89401965 CTGCGGTGCTGGAGGGGTGGGGG - Intronic
1142478607 17:204530-204552 GTGAGTGGGTGGAGGAGTGGGGG - Intergenic
1142698052 17:1644304-1644326 CTGCTGGGCTGGAGGAGAGCTGG + Intronic
1142744162 17:1947492-1947514 CAGCGTGTCGGGAGGAGGGCGGG - Intronic
1142858827 17:2749158-2749180 GTGCGTGGCGGGAGGTGGCGGGG + Intergenic
1142928398 17:3260877-3260899 CAGCGTGGCTGGGGGAAGAGGGG - Intergenic
1143580419 17:7822344-7822366 CTGCGTGGCTGGAGTGGAGTGGG - Intronic
1143679659 17:8467048-8467070 CTGGGTTGTTGGAGGAGGGCAGG - Exonic
1143764268 17:9127264-9127286 GGGCTTGGCTGGAGGAGAGGTGG + Intronic
1144761262 17:17708926-17708948 CTTTGTGCCTGGAGCAGGGGTGG - Intronic
1144831113 17:18131686-18131708 CACCGTGGCTGGAGGAGGGTCGG - Intronic
1145178329 17:20721507-20721529 CTGGCTGGCTGGAGGGAGGGCGG + Intergenic
1146283038 17:31557788-31557810 GTGCGTAGCTGGGGGAGGGATGG - Intergenic
1146519658 17:33516422-33516444 GTGTGTGTATGGAGGAGGGGTGG + Intronic
1146757744 17:35448455-35448477 CGGCGCGGGTGGAGGCGGGGCGG - Intronic
1147175632 17:38654558-38654580 CCGGGAGGCTGGAGGAGTGGAGG + Intergenic
1147250783 17:39151525-39151547 CCCCGGGGCTGGCGGAGGGGCGG + Exonic
1147323408 17:39659143-39659165 ATGGGTGCCTGGAGGAGGGCGGG + Intronic
1147335707 17:39725872-39725894 CTGGCTGCCTGGAGGAGGGTGGG + Intronic
1147387074 17:40089076-40089098 CAGAGAGGCTGGGGGAGGGGAGG - Intronic
1147419345 17:40314438-40314460 TTGGGTGGCAGGAGGAGGTGGGG + Intronic
1147793037 17:43025174-43025196 CCGCCTGGCTGGGGGCGGGGCGG + Intergenic
1147898791 17:43770003-43770025 CTGCGTGGCTGGGGGAGGTGAGG + Intronic
1148142456 17:45338406-45338428 CTCAGTGGCTGGGGGAGGAGTGG - Intergenic
1148186246 17:45646398-45646420 TTCCGAGGCTGCAGGAGGGGTGG + Intergenic
1148534402 17:48427086-48427108 CTGAGAGTTTGGAGGAGGGGAGG - Intronic
1148552453 17:48558597-48558619 CTGGGAGGCTGGAGGACGGAGGG + Intronic
1148792417 17:50180853-50180875 CTGGGTGGGTGGAGGAGGAGAGG - Intergenic
1148852014 17:50560150-50560172 CTGCGGGACTGGGGGAGGGAAGG - Intergenic
1148901397 17:50881006-50881028 TTGGGAGGCTGGGGGAGGGGGGG - Intergenic
1149792136 17:59488616-59488638 ATGCGGTGCTTGAGGAGGGGAGG - Intergenic
1150433748 17:65138959-65138981 ATGCTGGGGTGGAGGAGGGGTGG - Intronic
1150806174 17:68320759-68320781 CTGGGTGGCTGGAAGGGCGGGGG + Intronic
1151419312 17:73986924-73986946 TTGGGTTGCTGGAGGAAGGGAGG + Intergenic
1151539583 17:74758244-74758266 CTGCGTGGGTGGAGGTGATGGGG + Intronic
1151546712 17:74797742-74797764 CAGAGTGACTGGAGGAAGGGGGG + Intronic
1151655688 17:75494985-75495007 CTGCGTGGCTGGGGCTGGAGGGG - Exonic
1151768727 17:76145915-76145937 CTGCGTAGGTGCAGGAGGAGAGG - Intronic
1151886144 17:76924336-76924358 CAGCTTGGCCAGAGGAGGGGTGG - Intronic
1152067875 17:78121449-78121471 CTGGCTGGGTGGAGGAGGAGAGG + Intronic
1152228227 17:79102460-79102482 AAGGGTGGCTGGAGGAGGGCTGG - Intronic
1152286353 17:79415382-79415404 CTCCCTGGGTGGGGGAGGGGAGG - Intronic
1152336183 17:79701222-79701244 GTGGGAGGGTGGAGGAGGGGAGG + Intergenic
1152345583 17:79748608-79748630 CTGTGGGGTTGGAGGAGGGATGG + Intergenic
1152515428 17:80820812-80820834 CTGTGTGGGTGGTGGAGGGCAGG - Intronic
1152576478 17:81143507-81143529 CTGCATGGCTGGGGGAAGTGAGG - Intronic
1152577703 17:81150087-81150109 GTGCGTGGGTGGCTGAGGGGAGG + Intronic
1152753464 17:82077300-82077322 GGGAGTGGCCGGAGGAGGGGTGG + Intergenic
1152757975 17:82094970-82094992 CTGCTTGGCTGGTGGGGGTGGGG + Intronic
1152863614 17:82709690-82709712 CTGCATGGCCGGAGGAGCTGGGG + Intergenic
1153448980 18:5205509-5205531 TGGTGTGGCTGGAGGAGGAGCGG + Intergenic
1153827904 18:8893662-8893684 CTGTGTGGCTGGAGGAGAGGAGG + Intergenic
1154382977 18:13869206-13869228 CTGCGTGGCGGGCGGGCGGGCGG - Intergenic
1155249568 18:23941687-23941709 CTTCATTGCTGGAGGATGGGAGG - Intronic
1155986220 18:32233502-32233524 CAGCGAGGCTGGGGGAGGGGCGG - Intronic
1156223158 18:35074766-35074788 CTGCTCGGCTAGTGGAGGGGTGG - Intronic
1157406722 18:47428025-47428047 CTGCAAAGCTGGAGGAGGAGAGG + Intergenic
1157467262 18:47958014-47958036 CTGCCTGGATGGAGGACCGGAGG - Intergenic
1157493357 18:48138915-48138937 CGGCCTGGGTGGAGGTGGGGTGG + Intronic
1158004142 18:52652734-52652756 GTGTGTGGGTGGAGGAGGAGTGG + Intronic
1158280533 18:55820777-55820799 CTGTGTGGTTGGGGTAGGGGAGG - Intergenic
1158614003 18:58969232-58969254 CTGCTTGGCAGGAGGAGAGCTGG + Intronic
1158768544 18:60485996-60486018 CTGCATGGCTGGTGGTGGGGGGG - Intergenic
1160319242 18:77875051-77875073 GCGGGTGGATGGAGGAGGGGCGG - Intergenic
1160795328 19:942649-942671 CTGCGGGGCAGTGGGAGGGGCGG - Intronic
1160803027 19:979335-979357 CAGCGTGGCTGGAGGTGGACAGG + Intergenic
1160899103 19:1418097-1418119 GTGCGTGGCTGGTGGACTGGAGG + Intronic
1160947677 19:1651279-1651301 CTCCGAGGCTGGGGGTGGGGAGG + Intronic
1160973349 19:1780177-1780199 CTGTCTGGGTGGAGGTGGGGGGG - Exonic
1161022208 19:2015714-2015736 CGGCGTGGGCGGGGGAGGGGAGG + Exonic
1161205550 19:3039384-3039406 CTGTGTGGCTGGAACAGAGGGGG - Intronic
1161281014 19:3445771-3445793 CTGGGAGGATGGAGGAGGTGGGG + Intronic
1161627090 19:5333608-5333630 CTTTGTGGCTGGAGGTGAGGGGG - Intronic
1162029043 19:7909591-7909613 CTGCTGGGCTGGAGGAGCTGGGG - Intronic
1162087845 19:8259362-8259384 CTGTGTGGCTGGAGCAGAGTGGG + Intronic
1162180607 19:8866177-8866199 CCCCATGGCTGCAGGAGGGGAGG + Exonic
1162366470 19:10252474-10252496 CGGGGTGGCTCCAGGAGGGGCGG + Intronic
1162487634 19:10971232-10971254 CAGTGTGGCTGGAGCAGGGAAGG - Intronic
1163021425 19:14482812-14482834 CCGCAGGGCTGGGGGAGGGGGGG + Exonic
1163440197 19:17318959-17318981 CTGGGGGGCAGGAGAAGGGGTGG - Intronic
1163446790 19:17351684-17351706 CCAGGAGGCTGGAGGAGGGGAGG + Exonic
1163527420 19:17830257-17830279 CTCCGTGGGTGGAGGGGGAGGGG + Intronic
1163530757 19:17847664-17847686 CTGCGGGGTTGGGGGTGGGGAGG - Intronic
1163598818 19:18235774-18235796 CAGTGTGGCTGGAGGGTGGGAGG - Intronic
1163758523 19:19120729-19120751 GTGTGGGGGTGGAGGAGGGGCGG - Intronic
1164835919 19:31354999-31355021 ATGCCTGGTTGGAGGAGGGCTGG - Intergenic
1164836277 19:31357171-31357193 CTGGGTGGCGGTAGTAGGGGTGG + Intergenic
1165303187 19:34985692-34985714 CTGCTTGCCAGGAGGAGGTGGGG - Intergenic
1165311284 19:35030668-35030690 CGGCGAGGGGGGAGGAGGGGGGG - Intronic
1165335751 19:35168559-35168581 CTGAGGGGCTGGAGGAGGCAAGG + Intronic
1165739518 19:38197126-38197148 CTGTGAGGCTGGCGGAGGCGGGG - Intronic
1165899391 19:39161758-39161780 CCACGTGGCTGGAGCAGGGTGGG - Intronic
1166198335 19:41220621-41220643 CTGCGTGCCTGGAGGGGAGATGG - Exonic
1166211098 19:41306927-41306949 CTGAGGGGCTGGAGCAGGGTTGG - Exonic
1166258408 19:41621385-41621407 CTGCCTGGAGGGAGGAAGGGAGG - Intronic
1166354374 19:42218231-42218253 CTGCGGGGGTGGTGGTGGGGGGG - Intronic
1167423135 19:49415393-49415415 CTGTGTGGCTGCAGGCAGGGGGG - Intronic
1167638719 19:50668799-50668821 CTGCGAGGCTGGAGGGGCGGCGG - Exonic
1167669412 19:50841230-50841252 CTGGATGGGTGGAGGAGGGTGGG + Intergenic
1167958505 19:53087207-53087229 CTGTGTGACTGGAGCAGAGGGGG + Intronic
1168277029 19:55284255-55284277 CCGCGGAGCTGGGGGAGGGGGGG - Exonic
1168348328 19:55661405-55661427 CTGGGTTGCTGGAGGAGGTTGGG - Intronic
1168414354 19:56159266-56159288 ATGCGTGGGTGGATGAGGGGTGG - Intronic
1168472330 19:56649734-56649756 CAGTGTGGCTGGAGGGTGGGAGG + Intronic
925068950 2:951137-951159 GGGCGTGGAGGGAGGAGGGGCGG - Intronic
925156101 2:1649860-1649882 GTTTGGGGCTGGAGGAGGGGAGG - Intronic
925216957 2:2104786-2104808 CTGCATGGTTGGGGGAGGGCAGG + Intronic
925761426 2:7188322-7188344 CTGGGTGGCAGCAGGAGGAGAGG - Intergenic
926225210 2:10962143-10962165 CTTCGTGGTTGGAGGAGGTGTGG - Intergenic
926253020 2:11166601-11166623 CTGCATGGGTCGAGGTGGGGTGG + Intronic
926731900 2:16041872-16041894 GTGGTTGGCTGGAGGAGGGTGGG + Intergenic
926892552 2:17650533-17650555 CAGAGTGGCTGGTGCAGGGGTGG - Intronic
926964660 2:18396634-18396656 CAGAATGGCTGGAGGAGCGGAGG + Intergenic
927334755 2:21908901-21908923 CAGTGAGGCTGGGGGAGGGGCGG - Intergenic
927636885 2:24823037-24823059 CTGCTGGGCTGGGGAAGGGGAGG - Intronic
927809692 2:26174050-26174072 CTGCTTGGTTGGGGGATGGGCGG + Intronic
928122090 2:28590822-28590844 GTGCATGGTTGGAAGAGGGGAGG + Intronic
928351517 2:30560798-30560820 CTGCATGGCAGGAAGAGAGGTGG + Intronic
928375240 2:30768420-30768442 CTGGGTGGGAGGAGGAGGAGCGG + Intronic
928821841 2:35371039-35371061 ATGTGTGTCTGGAGGAGGGATGG + Intergenic
929099863 2:38301511-38301533 CTGAGAGGATGGGGGAGGGGTGG - Intronic
929226924 2:39520892-39520914 TTACATGGCTGGAGAAGGGGGGG + Intergenic
929453922 2:42053443-42053465 CTCCCTGGGTGGAGGAGGAGTGG - Intronic
929545765 2:42854520-42854542 CTGGGTGGCTGGAGTAGGCTAGG + Intergenic
929603875 2:43221992-43222014 CTGCTTGGGTGGGGAAGGGGAGG - Intergenic
930033540 2:47072229-47072251 CAGGGTGGCTGCAGGCGGGGTGG - Intronic
930070416 2:47361638-47361660 CTGCGTGTCTGAAGGAGGAGAGG - Intronic
930634307 2:53787398-53787420 CTTAGTGTCAGGAGGAGGGGTGG - Intronic
931116938 2:59175091-59175113 CTGCGGGTCTGGAGGAGCAGCGG - Intergenic
931966779 2:67543989-67544011 CTGAGTGGCTGGAATAGTGGGGG + Intergenic
932091233 2:68808110-68808132 CTGAGTGGCTGGAGAAGGTGGGG - Intronic
932421610 2:71604559-71604581 CTGTCTGGCTGCAGGAGGTGTGG + Intronic
932453970 2:71834468-71834490 CTGGGAGACTGGAGGAGGGTGGG + Intergenic
932454464 2:71838843-71838865 CTTTGGGGGTGGAGGAGGGGAGG + Intergenic
932625928 2:73295870-73295892 CTGAGAGGGAGGAGGAGGGGAGG + Intergenic
934518662 2:95005707-95005729 CTGGGTCCCTGGAGGTGGGGTGG + Intergenic
934553927 2:95277664-95277686 CTGGGTGGGTGGAGCAAGGGAGG - Intronic
934649904 2:96084819-96084841 CTGCTGGGCTGGAGGAGGCAAGG + Intergenic
935196486 2:100819793-100819815 CGCCGGGGCTGGGGGAGGGGGGG - Intergenic
935295790 2:101648171-101648193 TTGCTTGGCTTGAAGAGGGGAGG - Intergenic
935687327 2:105695766-105695788 AGGCCTGGCGGGAGGAGGGGAGG + Intergenic
935729045 2:106049754-106049776 TTGGGAGGCTGAAGGAGGGGGGG + Intergenic
935739174 2:106131314-106131336 CAACGAGGCTGGGGGAGGGGCGG + Intronic
935919850 2:108001142-108001164 GTGGGTGGGGGGAGGAGGGGAGG - Intronic
936624965 2:114138949-114138971 CTGCGTAGCTGAAGGAAGGAGGG - Intergenic
936750445 2:115635108-115635130 CTGAGTTCCGGGAGGAGGGGTGG - Intronic
937278634 2:120702500-120702522 CAGCTTTGATGGAGGAGGGGTGG + Intergenic
937477615 2:122229189-122229211 CTGGGAGGGTGGAGGAAGGGAGG + Intergenic
937992536 2:127672612-127672634 CTGAGCGGGTGGAGGAGAGGAGG - Intronic
938099191 2:128486614-128486636 CCGCGTGGCCGGGGGCGGGGTGG + Intergenic
938122308 2:128642591-128642613 CTAAGAGGCTAGAGGAGGGGAGG - Intergenic
938157458 2:128953299-128953321 ATGGGTGGCTGGGGGCGGGGAGG + Intergenic
938222973 2:129587562-129587584 CCGCGCGGCTGGAGAAGGGCGGG + Intergenic
938288825 2:130138817-130138839 CTGTGTGGCTGGCTGAGGGTGGG + Intergenic
938406970 2:131038226-131038248 CTGCAAGGCTGCAGGAGGGAGGG - Intronic
938406992 2:131038317-131038339 CTGCAAGGCTGCAGGAGGGAGGG - Intronic
938407003 2:131038348-131038370 CTGCAAGGCTGCAGGAGGGAGGG - Intronic
938407040 2:131038499-131038521 CTGCAAGGCTGCAGGAGGGAGGG - Intronic
938407049 2:131038530-131038552 CTGCAAGGCTGCAGGAGGGAGGG - Intronic
938408326 2:131044956-131044978 CTGCGTGCATGGGGCAGGGGAGG - Intronic
938467708 2:131534114-131534136 CTGTGTGGCTGGCTGAGGGTGGG - Intergenic
938801939 2:134771697-134771719 GTGTGTGGCTGGAGATGGGGAGG + Intergenic
938982799 2:136542577-136542599 CTGGGTGCCTGGAGGAGCTGAGG + Intergenic
940007421 2:149020646-149020668 CTGCGTGCCTGGAGGCAGAGAGG - Intronic
940165335 2:150764515-150764537 CAGTGTGGCTGGAAGAGGGGAGG - Intergenic
941120464 2:161523829-161523851 CTGTGTGGTTGGAGGATTGGAGG + Intronic
941422528 2:165300671-165300693 CTGAGTGGCTGGAGCAGAGTGGG + Intronic
942482844 2:176407493-176407515 TTGAGAGGCTGGGGGAGGGGCGG - Intergenic
942744664 2:179217984-179218006 TTGCGGGGCTGGGGGAGGGATGG + Intronic
943324938 2:186486466-186486488 CGGCGTGAGTGGGGGAGGGGTGG - Intronic
943767597 2:191678804-191678826 CCACGTGGGTGGGGGAGGGGAGG - Intronic
944154214 2:196593499-196593521 CGGCGCGGCTGGAGGTGAGGAGG - Intronic
944486996 2:200217426-200217448 CTGTGTGCCTGGAGTAGAGGTGG - Intergenic
945907773 2:215614390-215614412 GTGCTTGAATGGAGGAGGGGAGG - Intergenic
946692256 2:222318966-222318988 CCGCGTGGCGGGAGAAGAGGGGG - Intergenic
947865787 2:233397194-233397216 CAGGGTGGCTGGGGGGGGGGGGG + Intronic
948301168 2:236908613-236908635 CTGTGTGGCTGGAGGGAAGGCGG - Intergenic
948429738 2:237911889-237911911 CTTCTTGGCTGGAAGAAGGGGGG - Exonic
948505024 2:238422660-238422682 CTTGGGAGCTGGAGGAGGGGAGG + Intergenic
948671303 2:239570481-239570503 CTGAGTGGCTGATGCAGGGGAGG + Intergenic
948778905 2:240305005-240305027 CCACGTGGCTGGAGGAGGTGAGG - Intergenic
948896393 2:240929901-240929923 CTGCGTGCATGGAGGTGGGAGGG - Intronic
1169001248 20:2169411-2169433 CACTGTGGCTGGAAGAGGGGTGG + Intronic
1169015966 20:2293003-2293025 CAGCTTGGCTGGAGGAGCTGTGG + Intergenic
1170569707 20:17625789-17625811 CTGGATGGCGGGGGGAGGGGAGG - Intronic
1170948068 20:20909856-20909878 CTGCGTACTGGGAGGAGGGGTGG - Intergenic
1171138236 20:22717594-22717616 CAGCGTTGGTTGAGGAGGGGAGG + Intergenic
1171283412 20:23919477-23919499 CTGCTGGACTGGAGGAGGGCTGG - Intergenic
1172025100 20:31943114-31943136 GTGCCAGGCTGGAGGTGGGGAGG - Exonic
1172057534 20:32164947-32164969 CGGAGTGGGTGGGGGAGGGGAGG - Intronic
1172095296 20:32457387-32457409 CAGAGTGGGTGGGGGAGGGGTGG + Intronic
1172123384 20:32611358-32611380 TGGCGAGGCTGGAGGAGGTGGGG - Intergenic
1172387086 20:34541565-34541587 GAGTGTGGCTGGATGAGGGGTGG - Intergenic
1172424313 20:34845021-34845043 CAGCATGGCTGAAGGAGGAGAGG + Exonic
1172447434 20:35000577-35000599 CTGCGGAGCTGGAGGAGCTGCGG + Exonic
1172634516 20:36401053-36401075 GTGGGGGACTGGAGGAGGGGTGG - Intronic
1172774072 20:37397168-37397190 CTGCAGGGCTGGAGAAGCGGAGG - Intronic
1173787304 20:45803505-45803527 CAGTGTGGCTGGAGGTGGAGAGG - Intronic
1174308524 20:49632236-49632258 CAGCGTGGCTGGAGTAGAGGGGG - Intergenic
1174647827 20:52101315-52101337 CTTAGGGGCAGGAGGAGGGGTGG + Intronic
1174767206 20:53265487-53265509 CTGCGGGGCTGGAGGAGGAAAGG - Intronic
1175115550 20:56679388-56679410 TTTCCTGCCTGGAGGAGGGGAGG + Intergenic
1175337667 20:58206739-58206761 GTGGCTGGCTGGGGGAGGGGAGG - Intergenic
1175585090 20:60132884-60132906 CTTCCTACCTGGAGGAGGGGAGG - Intergenic
1175776992 20:61659757-61659779 CTTGGAGGCAGGAGGAGGGGTGG + Intronic
1175798664 20:61788328-61788350 CTGAGGGGCTGGGGGAGGGCTGG + Intronic
1175944092 20:62550786-62550808 CTGCGCTGCTGCAGGAGGGCTGG + Exonic
1176235194 20:64050587-64050609 ATGCGTGGCAGTGGGAGGGGAGG - Intronic
1176276927 20:64277956-64277978 CTGGGTGGTTAGAGCAGGGGTGG + Intronic
1176276950 20:64278040-64278062 CTGGGTGGTTAGAGCAGGGGTGG + Intronic
1176276970 20:64278122-64278144 CTGGGTGGTTAGAGCAGGGGTGG + Intronic
1176309699 21:5143008-5143030 AAAGGTGGCTGGAGGAGGGGAGG + Intronic
1177182000 21:17754263-17754285 GTGTGTGTCTGGAGGAGGTGAGG + Intergenic
1178006689 21:28228464-28228486 TTCCGTAGCTGGAGGAAGGGAGG - Intergenic
1178015619 21:28343093-28343115 CTGCATGGCTGGCAGCGGGGTGG + Intergenic
1178895454 21:36553634-36553656 CTGCTTGGCTGTGGTAGGGGAGG - Intronic
1178903569 21:36616958-36616980 CAGCGAGGCTGGAGTGGGGGGGG + Intergenic
1179787400 21:43737647-43737669 CTGCGGGGCTGGAGAAGGCCAGG + Intronic
1179826281 21:43968217-43968239 CTGCAGGGCTGGGGGTGGGGTGG + Intronic
1179847359 21:44119025-44119047 AAAGGTGGCTGGAGGAGGGGAGG - Intronic
1180225106 21:46387516-46387538 CTGCCTGTCTTGAGGTGGGGTGG + Intronic
1180570641 22:16714874-16714896 TAGCATGGCTGGAGGAGGGGAGG + Intergenic
1180791266 22:18576975-18576997 GTGCGTGGTTGGGGGGGGGGGGG - Intergenic
1180793577 22:18590873-18590895 CTCAGTGGTTGGAGGAGTGGGGG + Intergenic
1181162745 22:20967556-20967578 CCGCGGGGCTGGACGATGGGCGG + Intronic
1181228162 22:21404440-21404462 CTCAGTGGTTGGAGGAGTGGGGG - Intergenic
1181248178 22:21516530-21516552 GTGCGTGGTTGGGGGGGGGGGGG - Intergenic
1181250489 22:21530410-21530432 CTCAGTGGTTGGAGGAGTGGGGG + Intergenic
1181423969 22:22820883-22820905 TTGATAGGCTGGAGGAGGGGTGG - Intronic
1181462803 22:23095313-23095335 CTGAGTGGCTGGAGGGTTGGAGG - Exonic
1181483920 22:23218756-23218778 CTCCGATGCTGGTGGAGGGGAGG + Intronic
1181639647 22:24189868-24189890 CTGGGTGGCAGGAGGTTGGGAGG + Intergenic
1181682863 22:24507936-24507958 TTGGGGGGCTGGAGGAGGTGGGG - Intronic
1182527094 22:30927252-30927274 CTGCTTGGTTGGAGGAGGCCTGG - Intronic
1182627066 22:31655283-31655305 CTGAGTGGCTGGATGAACGGTGG - Intronic
1183623258 22:38986925-38986947 CTGGGTGGCTGGGGACGGGGGGG + Intronic
1183697307 22:39430660-39430682 CTGAGAGGCTGGAGAAGTGGAGG - Exonic
1183732504 22:39626530-39626552 CTGCGTGGCGGGAAAAGGAGAGG + Intronic
1184381233 22:44146058-44146080 GTGCGTGACTGGGGGAAGGGAGG - Intronic
1184653902 22:45931775-45931797 CTGGGAGGCTGGCAGAGGGGAGG - Intronic
1184769669 22:46589861-46589883 CTGAGGGGCTGAGGGAGGGGAGG - Intronic
1184786557 22:46674771-46674793 CTGTGTGGCTGCAGGGGAGGGGG + Intronic
1184857958 22:47156781-47156803 CTGAGGGGCCGGAGAAGGGGAGG - Intronic
1185041372 22:48506165-48506187 GTGCGGGGCTGCAGGAGGAGGGG - Intronic
1185118042 22:48949180-48949202 GAGTGAGGCTGGAGGAGGGGGGG - Intergenic
1185313725 22:50170183-50170205 CTGCGTGGCGGGGGGCGGGGTGG + Intergenic
950419909 3:12892625-12892647 ATGTGTAGCTGGAGGAGGTGAGG - Intergenic
950627511 3:14259079-14259101 CTGCGGGGCTGGTGGAGGCAAGG - Intergenic
951139800 3:19147226-19147248 GGGCGTGGCGGGAGGAGGGAGGG - Intergenic
951162426 3:19441026-19441048 CTGGCAGGCAGGAGGAGGGGAGG + Intronic
951279685 3:20732408-20732430 CTGGGGGGATGGAGGAGGGATGG + Intergenic
952744456 3:36764237-36764259 CTGCGGGGCTGGAGTGGCGGCGG + Intergenic
953344005 3:42160120-42160142 CTATGAGCCTGGAGGAGGGGCGG - Intronic
953503319 3:43459192-43459214 CTTAGTGGCAGGAGGTGGGGTGG - Intronic
954054758 3:48012655-48012677 GTGTGTGGCTGGGGGCGGGGTGG - Intronic
954391859 3:50271739-50271761 CTGGGTGGCTGGAGGGGGTTGGG + Intronic
954422384 3:50425542-50425564 GTGCGAGGCTGGGGGAGGGTAGG - Intronic
954478460 3:50772304-50772326 GTGGGTGGCTGGGTGAGGGGAGG + Intronic
954535256 3:51355037-51355059 CTGGGTGGGAGGAGGAGGGCAGG + Intronic
955360365 3:58268970-58268992 CTGCATGGCTGGAGTAAGTGTGG + Intronic
955832143 3:63015755-63015777 CTGCATGGGTGGGGGAAGGGTGG - Intergenic
956121660 3:65972071-65972093 CTGCCAGGCTGGAGGAAGGTGGG - Intronic
956500580 3:69879340-69879362 CTGCGTGGCAGAGGGAAGGGTGG - Exonic
956857256 3:73287308-73287330 TTGTGGGGCTGGAGGAGAGGAGG + Intergenic
960210914 3:114964676-114964698 GTGCCTGGGTGGAGGAGGCGGGG + Intronic
960715795 3:120573437-120573459 CAGCGAGGCTGGGGAAGGGGCGG + Intergenic
961663165 3:128481063-128481085 AGGAGAGGCTGGAGGAGGGGTGG + Exonic
962106402 3:132395265-132395287 CTGCCAGGATGGGGGAGGGGTGG - Intergenic
962302488 3:134254369-134254391 GTGGGTGGTTGGAGAAGGGGTGG + Intergenic
962751192 3:138435612-138435634 CCGCGGGGCTGGAGGTGGAGTGG + Intronic
963514683 3:146293606-146293628 CAGCGAGGCTGGGGGAGGGGCGG - Intergenic
963514692 3:146293629-146293651 CAGCGAGGCTGGGGGAGGGGCGG - Intergenic
966448045 3:180025552-180025574 CTGCATTGCTGGGAGAGGGGTGG + Intronic
966711942 3:182980511-182980533 CTGCGGAGCCGGAGGAGGAGGGG - Exonic
967569879 3:191016149-191016171 CAGTGAGGCTGGGGGAGGGGCGG - Intergenic
967904130 3:194486892-194486914 CTACGTCGCTGGCGGCGGGGGGG - Intronic
968005907 3:195242634-195242656 ATGGGAGGCTGGAGGAGGTGGGG + Intronic
968043843 3:195612440-195612462 GGGCGGGGCTGGAGGAGGGCTGG + Intergenic
968224841 3:196967139-196967161 CTGCGGGGCGGGAGGAGGGGAGG + Intronic
968285230 3:197504724-197504746 CTGCATGGCCAGAGGAGGCGGGG + Intergenic
968433856 4:575290-575312 CGGCGCGGCAGGCGGAGGGGAGG - Intergenic
968514530 4:1010678-1010700 CTGGGAGGCAGGATGAGGGGAGG + Intronic
968582617 4:1402080-1402102 CAGCGTCGTTGGAGGAGAGGTGG + Intergenic
968749250 4:2378720-2378742 GTGGGTGGATGGAGCAGGGGTGG - Intronic
968953809 4:3708208-3708230 CGCAGTGGCTGGAGGAGGGAGGG - Intergenic
968977563 4:3829954-3829976 AGGTGTGGCTGGAGGTGGGGTGG + Intergenic
969017434 4:4113276-4113298 CAGCCTGGCTGGAGGAGAGTGGG + Intergenic
969149747 4:5159142-5159164 CTGCTTGGCTGGAGCACGGCTGG + Intronic
969252308 4:5976110-5976132 CTGCCTGGCAGGATCAGGGGAGG + Intronic
969314440 4:6373015-6373037 CTGCATTGCAGGAGGAGGTGAGG - Intronic
969344684 4:6563479-6563501 CTGCGGGGCTGGGGGTGAGGCGG + Intronic
969409154 4:7016451-7016473 CCGCGGTGCTGGAGGACGGGAGG + Intronic
970583436 4:17493674-17493696 TGGCGTGGCTGGAGCAGGCGTGG - Intronic
972009423 4:34158395-34158417 CTGCTGGGATGGAGTAGGGGTGG - Intergenic
973855970 4:55010042-55010064 CTGCGTGACTGGATTATGGGAGG - Intergenic
974115241 4:57571135-57571157 CAGCCTGGCTGGCGGGGGGGGGG - Intergenic
975633072 4:76421234-76421256 CTTCGTAGTTGGGGGAGGGGAGG + Intronic
977177504 4:93834862-93834884 CTGCGCAGCTGGGGGAGGAGAGG - Intergenic
977897416 4:102380455-102380477 CAGCGAGGCTGGGGGAGGGGCGG - Intronic
978289542 4:107120780-107120802 CAGCCTGGCTGGGGGTGGGGAGG + Intronic
978619042 4:110621565-110621587 GTGCGGCGCTGGGGGAGGGGAGG - Intronic
979601172 4:122587917-122587939 ATGTGTGGTTGGAGTAGGGGAGG - Intergenic
979631058 4:122903678-122903700 CTGCAAGGCTGGAGGAGGAAGGG + Intronic
979674938 4:123399429-123399451 CTCTGTGGTAGGAGGAGGGGAGG - Intronic
980542048 4:134208194-134208216 CAGCGAGGCTGGGGGAGGGGCGG + Intergenic
981034073 4:140152458-140152480 CGGCGCGGCTAGAGGTGGGGTGG + Intronic
981574537 4:146190878-146190900 CTGCTTGGTTGAAGGATGGGGGG + Intronic
982390459 4:154857942-154857964 CTGGGTGGGTCGAGGAGTGGGGG - Intergenic
982452601 4:155570788-155570810 CACTGTGGCTGGAGGTGGGGAGG + Intergenic
982777385 4:159455753-159455775 CTGGGGGGCGGGGGGAGGGGGGG - Intergenic
983495935 4:168442412-168442434 CAGCGAGGCTGGGGGAGGGGCGG + Intronic
985611377 5:891534-891556 CTGCGTGGCTGGAGGAGGGGAGG - Intronic
985621520 5:958638-958660 CTGTGTGTCTGGTGGAGGGCAGG - Intergenic
986287715 5:6372328-6372350 CCGAGGGGCTGGAGGAGAGGCGG - Exonic
987976439 5:25020691-25020713 GTTTGTGGCTGGAGGTGGGGGGG + Intergenic
988509702 5:31854900-31854922 CGGCGCGGAGGGAGGAGGGGGGG + Intronic
989579184 5:43016312-43016334 CAGTGTGGTTGGAGGCGGGGTGG - Intergenic
990278850 5:54228487-54228509 CTGGGTGGGTGGGGGTGGGGGGG - Intronic
990449100 5:55918794-55918816 CTGGGTGGGTGGTGGGGGGGTGG - Intronic
991612452 5:68463496-68463518 CTGAGTGGATGGCGGAGGGATGG + Intergenic
992080649 5:73232681-73232703 ATGCGGGGCTGGAGGAAGAGTGG - Intergenic
993481717 5:88431965-88431987 CTGCATGGCTGGGGAGGGGGAGG + Intergenic
994399298 5:99259042-99259064 CTGCTGGGATGGAGAAGGGGAGG - Intergenic
996101841 5:119452500-119452522 CTGCGGGACAGGAGGAGGCGGGG - Intronic
996379052 5:122845534-122845556 CAGCGGGGCGGGAGGCGGGGCGG + Exonic
997162062 5:131619314-131619336 CGGCGGGGCTGGAGGGCGGGGGG + Intronic
997250427 5:132384660-132384682 CGGCATGGTTGGAGGAGGAGGGG + Intronic
997566135 5:134887930-134887952 CTGTGGTGCTGGAGGAGCGGAGG + Exonic
997643372 5:135464305-135464327 CAGCATGGCTGGAGCACGGGAGG - Intergenic
998349032 5:141489015-141489037 CTGGGGAGCTGGAGGAGGAGAGG - Intronic
1000209102 5:159095199-159095221 CTGAGGGGGCGGAGGAGGGGTGG - Intronic
1000679985 5:164171622-164171644 CTGGGGGGCTGGAGGTGGGGTGG - Intergenic
1001514502 5:172346026-172346048 CTGGGTGGGTGGAGGTGGGGCGG - Intronic
1001671213 5:173475482-173475504 CTGCGTTCCTGCAGGAGGAGAGG - Intergenic
1002202689 5:177539123-177539145 CAGGCTGGCTGGAGGCGGGGGGG + Exonic
1002209973 5:177592692-177592714 CTGAGAGGCTGGCGGAGAGGAGG - Intronic
1002381375 5:178832080-178832102 CTGCACTGCTGGGGGAGGGGGGG - Intergenic
1002520675 5:179791972-179791994 CTGGGTGGCCCGAGCAGGGGTGG + Intronic
1002872526 6:1179669-1179691 CAGTGTGGCTGGAGCAGGGGAGG - Intergenic
1003115361 6:3280365-3280387 CAGCGGGGCAGGATGAGGGGAGG - Intronic
1004164016 6:13239825-13239847 CTGTGTGTCAGGAGGAGAGGAGG + Intronic
1004319372 6:14620816-14620838 CTGGGAGGCTGGAGGAGCCGTGG - Intergenic
1005089748 6:22043822-22043844 CTGTGCTGATGGAGGAGGGGAGG + Intergenic
1005958827 6:30682604-30682626 CTGCTTGGGTGGGGGTGGGGAGG - Intronic
1006448710 6:34093608-34093630 CTGTGTGGCTGGAGCAGAGCAGG + Intronic
1006470766 6:34227423-34227445 GTGGGTAGCTGGGGGAGGGGAGG - Intergenic
1006500017 6:34452393-34452415 CCCCCTGGATGGAGGAGGGGAGG + Intergenic
1006514760 6:34539602-34539624 CCCCGAGGGTGGAGGAGGGGAGG + Intronic
1006517316 6:34552199-34552221 ATGCGGGGCTGGAGGAGGGTAGG - Intronic
1006793919 6:36720451-36720473 CTGGGCGGCTGGAGGAGGTGCGG + Exonic
1007075299 6:39062352-39062374 CACCTTGGCTGGAGGTGGGGTGG - Intronic
1007363446 6:41374115-41374137 CCGTGTGGCTGGGGGAGGGGTGG + Intergenic
1007400538 6:41600113-41600135 CAGGGTGGATGGAGGAGGGGTGG - Exonic
1007970437 6:46046801-46046823 CTGCATGCCTGGAGGAAGTGTGG + Intronic
1008011617 6:46473999-46474021 CTGAGTGGGTGGTGGAGGAGAGG + Intronic
1010736925 6:79453573-79453595 CTGCTCTGCTGGAGGTGGGGTGG + Intergenic
1010755670 6:79663878-79663900 CAGCCTGGCTGGGGGAGGGGCGG - Intronic
1011099598 6:83708022-83708044 CCGCGCGGCTGGAGGAGGCAAGG - Intronic
1011666801 6:89642128-89642150 CTGGGGGGTTGGGGGAGGGGGGG + Intergenic
1013789976 6:113825621-113825643 TTCAGTGGCTGGAGGAGGTGTGG - Intergenic
1014761719 6:125363934-125363956 GTGGGCGGCTGGAGGAGGGCAGG - Intergenic
1015613906 6:135054919-135054941 GTGCATGGCGGGACGAGGGGAGG + Intronic
1016737357 6:147493886-147493908 CTGAGGAGCGGGAGGAGGGGAGG - Intergenic
1016908444 6:149173865-149173887 CTGCCTGCCTGGGGCAGGGGAGG + Intergenic
1016992203 6:149938163-149938185 CTGTGAGGCTGGAGGGGGTGGGG + Intergenic
1016994759 6:149954103-149954125 CTGTGAGGCTGGAGGGGGTGGGG + Intergenic
1017003847 6:150015333-150015355 CTGTGAGGCTGGAGGGGGTGGGG - Intergenic
1017078082 6:150638418-150638440 CTGAGTGGTAGGGGGAGGGGTGG - Intronic
1017091932 6:150766924-150766946 CAGCATGGCAGGATGAGGGGCGG - Intronic
1017967269 6:159277209-159277231 CTGTGTGGCTGGGAGAAGGGAGG + Intergenic
1018511877 6:164533063-164533085 CTCCGTGGCAAGGGGAGGGGAGG + Intergenic
1018624991 6:165769213-165769235 CTGCGTGGCTGGAACAGCTGAGG + Intronic
1018687982 6:166318413-166318435 CTGCGTGGCAGGGGCAGGTGTGG - Intergenic
1018765645 6:166931264-166931286 CTGCTTCGCTGGTGGAGGTGGGG - Intronic
1019119215 6:169790073-169790095 GTGCTTGACTGGAGGAGGGCTGG + Intergenic
1019154016 6:170026679-170026701 CTACGTGCCTGGAGGGCGGGAGG + Intergenic
1019336246 7:484423-484445 CTGAGCAGGTGGAGGAGGGGAGG - Intergenic
1019377133 7:698891-698913 CTGCGTGGGGAGAGGTGGGGTGG - Intronic
1019492519 7:1321951-1321973 TTGCGTGTCGGGAGGAAGGGAGG + Intergenic
1019503510 7:1377662-1377684 CTGCAGGTCTGGAGGTGGGGAGG - Intergenic
1019985315 7:4651101-4651123 CTGGGTGCATTGAGGAGGGGAGG + Intergenic
1020011858 7:4809571-4809593 CTGCAGGGCTGGAAGTGGGGCGG - Intronic
1020114923 7:5470889-5470911 CTGCGTGGCTGGAGCAGCCTGGG - Intronic
1022494378 7:30843930-30843952 CTGCCTGGCTGGACCAGAGGAGG + Intronic
1022514928 7:30969442-30969464 CTGCAAGGGTGGAGGAGGGCAGG + Intronic
1022539502 7:31122697-31122719 CAGCTTGGCTGGGGGAGGAGTGG - Intergenic
1023060051 7:36318089-36318111 CTGTGTACCTGGAGGAGGGTGGG + Intergenic
1023170342 7:37385340-37385362 CAGTGTGGCTGGAGGGGAGGGGG - Intronic
1023850103 7:44145731-44145753 CTGCGGGGCGGGAGGAGGTAGGG + Intronic
1024016003 7:45315706-45315728 CAGCAAGGCTGGGGGAGGGGCGG + Intergenic
1024208833 7:47186550-47186572 CTCAGTGCCTGGAGGAGAGGAGG - Intergenic
1026735174 7:72944762-72944784 CAGTGTGGCTGCAGGAGTGGTGG + Intronic
1026785515 7:73299691-73299713 CAGTGTGGCTGCAGGAGTGGTGG + Intergenic
1027108557 7:75420245-75420267 CAGTGTGGCTGCAGGAGTGGTGG - Intronic
1027199968 7:76057775-76057797 CTGCATGGGTGGAGCAGGGGAGG - Intronic
1027309341 7:76937867-76937889 CTGCGTGGCTGGAGCAGAGTAGG - Intergenic
1028002987 7:85524699-85524721 CTGTGGGGCTGGGGGAGTGGAGG + Intergenic
1028460470 7:91086322-91086344 CAGCGTGGCTTCTGGAGGGGAGG - Intronic
1028929681 7:96398482-96398504 CTCAGGGGATGGAGGAGGGGTGG + Intergenic
1029159160 7:98539424-98539446 CTGCTTGGCAGGAGTAGGGGCGG - Intergenic
1029164396 7:98576878-98576900 ATGCATGCCTGGATGAGGGGAGG - Intergenic
1029298248 7:99558614-99558636 ATGCCTGGGCGGAGGAGGGGGGG + Intronic
1029441936 7:100591652-100591674 CTTCGTGTCTGGAGGAAGGAAGG - Exonic
1029693446 7:102197763-102197785 CTGCGGGGTGGGAAGAGGGGAGG - Intronic
1030262462 7:107580183-107580205 CTGCGGGGCGTGAGGCGGGGTGG + Intronic
1031001279 7:116418053-116418075 CTGTGTGACGGGAGGAGGAGGGG - Intronic
1032455542 7:132070682-132070704 CAGCCTGGGTGGCGGAGGGGAGG - Intergenic
1033428966 7:141271199-141271221 CTGAGAGGCTGGAGTTGGGGTGG + Intronic
1034138765 7:148797047-148797069 CTGTGAGGCTGAAGGAGGGCTGG + Intronic
1034437400 7:151069738-151069760 CTGGGGGTCTGGGGGAGGGGAGG + Intronic
1034526207 7:151664448-151664470 GGGCTTGGCTGGAGGAGGAGGGG - Intronic
1035039330 7:155916182-155916204 CTGCATGGCTGGAGAAGGGTGGG - Intergenic
1035202686 7:157277296-157277318 ATGAGTGGCTGCAGGAGGTGGGG - Intergenic
1035363405 7:158329038-158329060 CTGGGTGGCGGGAGGAATGGAGG - Intronic
1035372843 7:158390506-158390528 CTGCGAGGCTGGAGAAGGGATGG - Intronic
1035682297 8:1496831-1496853 GTGCGTTGCTGGAGGAGGGTTGG + Intergenic
1035727223 8:1832056-1832078 CTGTGGGGCTGGAGGAGCAGCGG + Intronic
1035767557 8:2119440-2119462 CTGCGTGGCCGGGTGAGGAGGGG + Intronic
1035791258 8:2307550-2307572 CAGCGAGGCTGGGGGTGGGGGGG - Intergenic
1035801547 8:2414155-2414177 CAGCGAGGCTGGGGGTGGGGGGG + Intergenic
1036654724 8:10670847-10670869 CTGCATGGCTTGAGCAGTGGAGG + Intronic
1036831141 8:12020844-12020866 CAGCCTGGCTGGAGGAGAGTGGG + Intergenic
1037947658 8:22999396-22999418 CGGCGTCGCTGCGGGAGGGGCGG + Intronic
1038087582 8:24216870-24216892 ATGCGGGGCTTGAGGAAGGGAGG + Intergenic
1038231526 8:25704974-25704996 CTCAGTGCCTGGAGGAGGAGAGG + Intergenic
1039146344 8:34451442-34451464 CAGCAAGGCTGGAGGAGGGGCGG - Intergenic
1039426408 8:37490018-37490040 CTGCCTGGATGGGGGATGGGAGG - Intergenic
1039453892 8:37695830-37695852 AGGCGTCGGTGGAGGAGGGGAGG + Exonic
1040981790 8:53251813-53251835 CTGCGGGGCTGGAGGGGACGCGG - Intergenic
1041047133 8:53898155-53898177 CTGCCTGACTTGAGGAGTGGTGG + Intronic
1042705709 8:71664134-71664156 CAGTGTGGCTGGAGGAGGGTGGG - Intergenic
1043147530 8:76676823-76676845 GAGTGTAGCTGGAGGAGGGGAGG + Intergenic
1044257546 8:90082929-90082951 ATGGGAGGCTGGAGGAGGCGTGG - Intronic
1044340485 8:91040964-91040986 AGGCATGGCTGGGGGAGGGGAGG + Exonic
1044453906 8:92369765-92369787 CAGCGAGGCTGGGGGAGGGGCGG - Intergenic
1045299555 8:100899479-100899501 GTGCGGGGCTGCGGGAGGGGAGG - Intergenic
1045485923 8:102631144-102631166 CTGTGAGGATGGGGGAGGGGTGG + Intergenic
1045776963 8:105815980-105816002 GTGGGTGGCTGGGGGTGGGGTGG - Intergenic
1046612953 8:116445941-116445963 CAGGGGGACTGGAGGAGGGGTGG - Intergenic
1047749217 8:127867254-127867276 CTGGGAGGGTGGAGGAGGAGGGG + Intergenic
1048980551 8:139701702-139701724 CTGCATGGCAGGAGGCAGGGTGG - Intronic
1049451157 8:142662312-142662334 CTGGGTGGGTGGAGCTGGGGAGG - Intronic
1049465024 8:142747150-142747172 GTGGGTGGGTGGAGGAGGGATGG + Intergenic
1049574856 8:143385277-143385299 CTGCGAGGCTGGGGGAAGGCAGG + Intergenic
1049616048 8:143576166-143576188 CCGCGTGGGTGGAGAAAGGGTGG + Intronic
1049617329 8:143581329-143581351 CTGCAAGGCAGGAGGAGGGGAGG + Intronic
1049624423 8:143613670-143613692 CTGGGAGGCTGGCTGAGGGGTGG - Intronic
1049681529 8:143920716-143920738 GTGTATGGCTGGAGGAGGCGGGG - Exonic
1049747375 8:144268744-144268766 CTGCGTGGCAGAAGATGGGGAGG + Intronic
1049804931 8:144534446-144534468 CTGCGTGGCCGTAGGAGGGCAGG - Intronic
1050463016 9:5893290-5893312 CTGGGTGGCAGGGGCAGGGGAGG + Intronic
1050605810 9:7300072-7300094 CTGAGTGGCTGTAGGAGCTGAGG - Intergenic
1050630076 9:7549486-7549508 CTCCCTGGCTGGGGGAAGGGTGG + Intergenic
1051088596 9:13380450-13380472 CTGGGAGGCTGGAGGCTGGGGGG + Intergenic
1051299034 9:15628461-15628483 CAGCGAGGCTAGGGGAGGGGCGG + Intronic
1052866303 9:33466505-33466527 CTGGGTGACTGGAGCAGAGGTGG + Intronic
1052989172 9:34508646-34508668 CTGCTTGGCTTGAGGAAGGAAGG - Intronic
1053138482 9:35666628-35666650 TTGGGTGGGTGGAAGAGGGGTGG + Intronic
1053265971 9:36713914-36713936 CTGCGTGTCTGCAGGACGGATGG + Intergenic
1054715282 9:68551293-68551315 AGGCGTGGCAGGAGGAGCGGTGG - Intergenic
1054824459 9:69558727-69558749 CTGTGAGGGTGGAGGATGGGAGG - Intronic
1055051406 9:71984928-71984950 GGAGGTGGCTGGAGGAGGGGAGG + Intronic
1055551590 9:77436612-77436634 GAGCGTGGCGAGAGGAGGGGAGG - Intronic
1056730301 9:89160281-89160303 CTGGGTAGGTGGAGGAGTGGAGG - Intronic
1057054102 9:91948838-91948860 CTGCGGGGGTGGAGGAGGGCGGG - Intronic
1057209391 9:93191492-93191514 GAGCGAGGCTGGAGGAGGGGCGG + Intronic
1057231588 9:93324684-93324706 GTGTGTGGATGGAGGAGGGGTGG + Intronic
1058153565 9:101487093-101487115 CTGCGAGGCGGGAGGAGGTGAGG - Intronic
1058504277 9:105653081-105653103 CTGGGTGCCTGGTGGAAGGGTGG - Intergenic
1058612220 9:106789268-106789290 CTGCTTTTCTAGAGGAGGGGCGG + Intergenic
1058625019 9:106925853-106925875 CAGTGTTGCTGGAAGAGGGGTGG - Exonic
1058769561 9:108216962-108216984 CTCAGTGGCTGGAGGGCGGGAGG + Intergenic
1059366455 9:113790138-113790160 AAGTGAGGCTGGAGGAGGGGAGG - Intergenic
1059526352 9:114994090-114994112 CTGTGGTGTTGGAGGAGGGGTGG + Intergenic
1059791522 9:117645939-117645961 CTGTGTGGCTGGGGGTGGTGGGG + Intergenic
1060085168 9:120692682-120692704 CTGAGTGGCTCGAGTAGGGGAGG - Intronic
1060153955 9:121306078-121306100 CGGAGTGGGAGGAGGAGGGGCGG - Intronic
1060749044 9:126156614-126156636 CTGTGTGGCTGATGGAGGTGGGG + Intergenic
1060758235 9:126227922-126227944 TTGCCTGGCAGGGGGAGGGGCGG + Intergenic
1060814318 9:126626773-126626795 CCGCGGGGCTGGGGGTGGGGCGG - Intronic
1060913577 9:127370243-127370265 CTGCGGGGCAGGAACAGGGGAGG - Intronic
1060982685 9:127802856-127802878 CTGATTGGCTGGGGGCGGGGCGG + Exonic
1061204711 9:129156271-129156293 CTGGGTGTCTGGAGCTGGGGCGG + Intergenic
1061297859 9:129686790-129686812 GGGCCTGGGTGGAGGAGGGGCGG - Intronic
1061929791 9:133826635-133826657 CTAGGTGGCTGGGGGAGGGGTGG - Intronic
1061969851 9:134039062-134039084 GTGCTTGGAGGGAGGAGGGGAGG - Intronic
1062020453 9:134316915-134316937 CAGCCTGCCTGGGGGAGGGGTGG + Intergenic
1062042530 9:134410691-134410713 AGGCGTGGCTGGAGCTGGGGGGG + Intronic
1062046167 9:134425530-134425552 CTGCGTGGCGGCAGGGTGGGGGG + Intronic
1062059482 9:134487309-134487331 CTGCCTGCATGGAGCAGGGGAGG - Intergenic
1062154096 9:135036599-135036621 GTGAGTGTCTGGAGGAGGGTGGG + Intergenic
1062187361 9:135225045-135225067 CTGCGGGGCTAGAGCAGGGCCGG - Intergenic
1062284911 9:135768568-135768590 GAGCGTGGGTGGAGCAGGGGAGG - Intronic
1062389422 9:136327986-136328008 CCGGGGGGCTGGAGGCGGGGTGG + Intronic
1062530044 9:136995758-136995780 CTGGGTGGGTGGAGCGGGGGTGG + Intronic
1062617235 9:137403406-137403428 CTGCTGGGCTGGGGGTGGGGAGG - Intronic
1185466346 X:356914-356936 CTGTGTGGCTGGCGAAGGCGTGG - Intronic
1185503974 X:618952-618974 CTGCGTGGCTGGGGGCGTGGGGG + Intergenic
1188149058 X:26649844-26649866 TTGGGAGGCTGGGGGAGGGGGGG + Intergenic
1189207837 X:39257033-39257055 CCAGGTGGCTGGGGGAGGGGTGG - Intergenic
1189275097 X:39779650-39779672 GGGCCTGGCTGGAGGAGGAGCGG - Intergenic
1190545132 X:51517905-51517927 CAGCGAGGCTGGGAGAGGGGCGG - Intergenic
1190546888 X:51537151-51537173 CAGCGCGGCTGGGGGAGGGGTGG - Intergenic
1190792853 X:53716153-53716175 CTGAGTGGGTAGAGGTGGGGAGG - Intergenic
1190803458 X:53813668-53813690 CGGAGTGCCTGGGGGAGGGGAGG - Intergenic
1190894038 X:54597914-54597936 CTGGGGGGATGGTGGAGGGGTGG + Intergenic
1191717001 X:64200604-64200626 CTGAGAGGCTGGGGGAGGAGTGG + Intronic
1192207763 X:69107458-69107480 CTGAGTAGGTGGAGGAGGGCAGG + Intergenic
1192548075 X:72029734-72029756 AAGGGTGGCTGGTGGAGGGGAGG + Intergenic
1193533611 X:82686459-82686481 CTGAGTCCCTGGGGGAGGGGTGG - Intergenic
1195136064 X:101908540-101908562 CTGCAGGGATGGGGGAGGGGTGG - Intronic
1195424880 X:104717563-104717585 CTGAGTTGCCTGAGGAGGGGGGG + Intronic
1195925561 X:110021336-110021358 CTGTGTGGCTGGTGGGGGTGAGG + Intronic
1195930544 X:110070776-110070798 CGGCGTGGTTGGGGGAGAGGGGG - Intronic
1195962261 X:110398053-110398075 ATGCGTGGGAGGAGGAGGGATGG - Intronic
1196061436 X:111411840-111411862 CTGCTTGCCTTGAGGAGGTGGGG - Intronic
1196560014 X:117135002-117135024 GTGCTTGGCTAGAAGAGGGGAGG - Intergenic
1196746966 X:119079739-119079761 CTCCGTGGCTGGGGGATGAGTGG + Exonic
1197202550 X:123760596-123760618 CTGAGTGGCTGGGGGAGGCCTGG + Intergenic
1197972297 X:132127938-132127960 ATGCCTGGCTGGGGGTGGGGGGG - Exonic
1197987317 X:132279514-132279536 CTGCTGGGGTGGGGGAGGGGTGG + Intergenic
1199699365 X:150364553-150364575 CAGCGTGGCTGGGGGACGTGGGG + Intronic
1199852879 X:151737904-151737926 CTGGGTGGCTTGGGGAGGTGTGG - Intergenic
1199873321 X:151915455-151915477 CAGCGTGGATGGGGGTGGGGGGG - Intronic
1199873848 X:151917499-151917521 CAGCGTGGATGGGGGTGGGGGGG - Intronic
1199874026 X:151918174-151918196 CAGCGTGGATGGGGGTGGGGGGG - Intronic
1200137585 X:153882584-153882606 CTGCCTGGCTGGAGGGCAGGGGG + Intronic
1200279234 X:154762813-154762835 CCGCGGGGCGGGAGGAGGCGGGG - Exonic
1200318767 X:155162889-155162911 CAGCGAGGCTGGGGGAGGGGTGG - Intergenic
1201570297 Y:15406542-15406564 CAGCTAGGCTGGGGGAGGGGTGG + Intergenic
1201572224 Y:15426475-15426497 CAGCGAGGCTAGGGGAGGGGTGG + Intergenic
1202055582 Y:20826577-20826599 CAGCGAGGCTGGGGGAGGGGCGG - Intergenic
1202584365 Y:26408553-26408575 CTGCGCGGCTGTTGGAGGGGGGG - Intergenic