ID: 985611381

View in Genome Browser
Species Human (GRCh38)
Location 5:891539-891561
Sequence TGCGCCTGCGTGGCTGGAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 258
Summary {0: 1, 1: 0, 2: 0, 3: 20, 4: 237}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985611381_985611388 -5 Left 985611381 5:891539-891561 CCTCCTCCAGCCACGCAGGCGCA 0: 1
1: 0
2: 0
3: 20
4: 237
Right 985611388 5:891557-891579 GCGCACTCTGCCTGGGTCCTGGG 0: 1
1: 0
2: 2
3: 17
4: 187
985611381_985611396 23 Left 985611381 5:891539-891561 CCTCCTCCAGCCACGCAGGCGCA 0: 1
1: 0
2: 0
3: 20
4: 237
Right 985611396 5:891585-891607 GCTCCCCACGGGCTCCTCGTGGG 0: 1
1: 0
2: 0
3: 5
4: 79
985611381_985611389 1 Left 985611381 5:891539-891561 CCTCCTCCAGCCACGCAGGCGCA 0: 1
1: 0
2: 0
3: 20
4: 237
Right 985611389 5:891563-891585 TCTGCCTGGGTCCTGGGACCAGG 0: 1
1: 0
2: 4
3: 53
4: 470
985611381_985611387 -6 Left 985611381 5:891539-891561 CCTCCTCCAGCCACGCAGGCGCA 0: 1
1: 0
2: 0
3: 20
4: 237
Right 985611387 5:891556-891578 GGCGCACTCTGCCTGGGTCCTGG 0: 1
1: 0
2: 2
3: 11
4: 168
985611381_985611393 12 Left 985611381 5:891539-891561 CCTCCTCCAGCCACGCAGGCGCA 0: 1
1: 0
2: 0
3: 20
4: 237
Right 985611393 5:891574-891596 CCTGGGACCAGGCTCCCCACGGG 0: 1
1: 0
2: 0
3: 23
4: 292
985611381_985611391 11 Left 985611381 5:891539-891561 CCTCCTCCAGCCACGCAGGCGCA 0: 1
1: 0
2: 0
3: 20
4: 237
Right 985611391 5:891573-891595 TCCTGGGACCAGGCTCCCCACGG 0: 1
1: 0
2: 0
3: 48
4: 327
985611381_985611395 22 Left 985611381 5:891539-891561 CCTCCTCCAGCCACGCAGGCGCA 0: 1
1: 0
2: 0
3: 20
4: 237
Right 985611395 5:891584-891606 GGCTCCCCACGGGCTCCTCGTGG 0: 1
1: 0
2: 0
3: 16
4: 163

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985611381 Original CRISPR TGCGCCTGCGTGGCTGGAGG AGG (reversed) Intronic
900103136 1:971306-971328 TGCTCCTGGGTGGGTGGGGGTGG - Exonic
900384228 1:2402125-2402147 TGCAGCTGCAAGGCTGGAGGCGG + Intronic
900405078 1:2489440-2489462 TGCCCCTGCCTGTCTGGAGCAGG - Intronic
900469803 1:2848141-2848163 GGCGGCTGCGTGGGTGGAGATGG - Intergenic
900636695 1:3669491-3669513 TGCGCCTCCTTGGCAGGAAGTGG - Intronic
900959270 1:5909033-5909055 TGCTTCTGCGTGGCTGGGGAGGG - Intronic
901230687 1:7640318-7640340 TGCACCTGCGGGGTTGGGGGCGG + Intronic
901499680 1:9644074-9644096 TGGGCATGCGTGGGTGGTGGTGG + Intergenic
902384816 1:16070450-16070472 TGGGCCTTCATGGCTGGAAGGGG - Intronic
902478353 1:16699617-16699639 TCCGCCTGCGGGGATGAAGGTGG + Intergenic
904244972 1:29181454-29181476 TGCGCCTGCGCGGGTGGGGGTGG - Intronic
904261489 1:29290208-29290230 TGGGGCTGCCTGGCTGGAGAAGG - Intronic
904292954 1:29499373-29499395 TGGGGCTGCCTGGCTGGAGAAGG + Intergenic
905441913 1:38001235-38001257 TGGGCCTGAGTGGCAGGAAGGGG - Intronic
906677115 1:47701238-47701260 AGGGCCTGTGGGGCTGGAGGGGG - Intergenic
914746702 1:150506466-150506488 TGCGCGCGCGTGTCTGAAGGGGG - Intronic
916037469 1:160933754-160933776 TGCGTCTGTGTGGAGGGAGGTGG + Intergenic
919923775 1:202181748-202181770 TGGGCCTGCTGTGCTGGAGGCGG + Intergenic
919983248 1:202655725-202655747 TGCGCTTGCGAGGCTGAGGGAGG + Intronic
921425101 1:214992365-214992387 TGAGCCTGGGAGGGTGGAGGTGG - Intergenic
922783262 1:228269828-228269850 GGCCCCTGCGTGGCGGCAGGCGG - Intronic
924715239 1:246566758-246566780 AGAGGCTGCGCGGCTGGAGGAGG - Intronic
1065418993 10:25520953-25520975 GGCGCCAGCGAGGCTGGGGGAGG - Intronic
1065857324 10:29841047-29841069 TGAGCCTGTGTGGCTGGCTGAGG + Intergenic
1066511170 10:36098357-36098379 TGGGACAGGGTGGCTGGAGGGGG - Intergenic
1070112113 10:73496029-73496051 TGCGCGTGCGGGGGTGGGGGCGG + Intergenic
1070911550 10:80123289-80123311 TGCAGCAGCGTGGATGGAGGTGG + Intergenic
1071394295 10:85206356-85206378 GGGACCAGCGTGGCTGGAGGAGG + Intergenic
1077013868 11:391563-391585 AGAGCCTGCGTGGGTGGAGGGGG - Intergenic
1077046871 11:550613-550635 GGGGCCTGTGGGGCTGGAGGTGG - Intronic
1077180179 11:1208718-1208740 AGCGCCTGCGAGGCTGGCAGAGG - Intergenic
1077404915 11:2378480-2378502 GGTGCCAGCGTGGGTGGAGGAGG + Intronic
1079034940 11:17013566-17013588 TGGGCCTGCGGGGTTGGAGTGGG - Intronic
1079873760 11:25831707-25831729 GGCGGCAGCGAGGCTGGAGGAGG + Intergenic
1080036742 11:27719391-27719413 GGGGCCTGGGCGGCTGGAGGCGG - Intronic
1080445423 11:32333590-32333612 CGCTCCTGCGTGGCTGGGGGCGG - Intergenic
1080802229 11:35619056-35619078 GGCGGCGGCGTGGCTGGAGGCGG + Exonic
1083306636 11:61765106-61765128 TGCTCCTGCGTTCCTGGAGCTGG + Intronic
1083654990 11:64225267-64225289 TCTGGCTGCTTGGCTGGAGGGGG + Intronic
1083780848 11:64916569-64916591 TGGGCCTGCGCAGCTGGTGGGGG - Intronic
1084167675 11:67383584-67383606 TGAGTCTGCAGGGCTGGAGGTGG - Intronic
1084187637 11:67483298-67483320 TGCGCATGCGAGGCGGGAGGAGG + Intronic
1084735465 11:71102695-71102717 TGAGCCGGCCTGGCTGGACGTGG - Intronic
1089031165 11:115330869-115330891 TGCTCCTTCTTGGGTGGAGGTGG - Intronic
1089555726 11:119315216-119315238 TGCGCCTGAGCTGGTGGAGGTGG - Exonic
1090235286 11:125142382-125142404 GGCGCCTGTGTGGCTGGAGACGG + Intergenic
1091311871 11:134580581-134580603 TGCGGCTGTGTGGCAGGGGGAGG - Intergenic
1092879318 12:12875711-12875733 TGCGGCTGGGGGCCTGGAGGGGG - Intergenic
1096106244 12:48998331-48998353 TGCGGCTGCGCGGATGGACGGGG + Exonic
1096463705 12:51836868-51836890 TGCGCCTGTGTGAGGGGAGGAGG - Intergenic
1103913637 12:124364978-124365000 TGCGTCTGCGGGTATGGAGGTGG + Intronic
1103930555 12:124448538-124448560 TTCACCAGCGTGGCTGGCGGGGG - Intronic
1104448907 12:128853740-128853762 GGCCCCGGCGCGGCTGGAGGGGG - Intronic
1104899708 12:132182227-132182249 TGCCCCTGGGCGGCAGGAGGGGG + Intergenic
1105742733 13:23345373-23345395 TGCCACTGCTAGGCTGGAGGTGG - Intronic
1107702397 13:43061172-43061194 TGGGCCTGTGAGGCTGGAAGGGG + Intronic
1113739843 13:112703981-112704003 TTCACCTGCGTGTGTGGAGGAGG + Intronic
1113768670 13:112895333-112895355 TGTGCCGGCATGGCTGTAGGAGG + Intronic
1113939865 13:114013057-114013079 GGCATCTGCGTGGCTGTAGGGGG - Intronic
1115203049 14:30874371-30874393 CGAGCCTGCGCTGCTGGAGGAGG + Intergenic
1116849343 14:49893031-49893053 TGCGCCTGCGTGGTCGGGAGGGG + Intergenic
1117186804 14:53247791-53247813 TGAGCCTGCCTGGCAGGAGCTGG - Intergenic
1117280333 14:54234296-54234318 GGCGGCAGCGAGGCTGGAGGAGG + Intergenic
1122264137 14:100538872-100538894 TGAGCCTGCGTAGCTGGGGAAGG + Exonic
1122688847 14:103522246-103522268 TGCGGCTGCGCGGGGGGAGGGGG + Intronic
1122945298 14:105005905-105005927 TGTGCATGCGCAGCTGGAGGGGG - Intronic
1123013210 14:105359214-105359236 AGAGCCTGCGGGGCTGGAGGTGG - Intronic
1124392289 15:29269871-29269893 TGCGCCTGCGCGGCTGCGGCGGG + Intronic
1127608925 15:60618158-60618180 TTCTCCTGTGTTGCTGGAGGTGG + Intronic
1128934623 15:71734729-71734751 TGTGCCTGTGTGGTGGGAGGAGG + Intronic
1129084327 15:73072697-73072719 TGTGCTTGCGTGCATGGAGGTGG + Intronic
1129359017 15:75012827-75012849 TGGGCCAGGGTGGCTGGAGGAGG + Intronic
1129606008 15:77025352-77025374 TGGGACTGCGAGGCTGGTGGAGG + Intronic
1130160012 15:81389366-81389388 AGGGCCTGAGTGACTGGAGGAGG - Intergenic
1131290150 15:91100185-91100207 TGCGCCTGGGCGGCTGGCGGGGG + Intronic
1133139299 16:3732467-3732489 TGCGCCTGACTGGCTGAAGGTGG + Intronic
1134411356 16:14005031-14005053 GGAGCCTGCATGACTGGAGGTGG + Intergenic
1134588730 16:15434808-15434830 TGCGCCTGCGCGGGTGGTCGCGG + Intronic
1136375540 16:29863099-29863121 AGCGCCTGCGGGGCTGGCAGAGG - Exonic
1136505315 16:30699041-30699063 CGCGCGTGCGCGGCTGGAGGCGG - Intronic
1136550292 16:30979327-30979349 TGCGGCGGTGTGGCTGGAGGGGG - Exonic
1138316204 16:56072482-56072504 TGCTAGTGCCTGGCTGGAGGAGG - Intergenic
1139482203 16:67236799-67236821 GGGGCCTGCGGGGCGGGAGGTGG + Intronic
1139969796 16:70766686-70766708 TTCCCTTGCCTGGCTGGAGGTGG + Intronic
1142362119 16:89632403-89632425 TGCCCCTGTGTCGCTGGCGGTGG - Intronic
1142490321 17:274342-274364 CTCGCCTGCCTGGCTGGAGTAGG + Intronic
1142917376 17:3152973-3152995 GGCGGCTGCGAGGCTGGGGGAGG - Intergenic
1142920083 17:3176947-3176969 GGCGGCTGCGAGGCTGGGGGAGG + Intergenic
1143182833 17:4994427-4994449 TGCACCTGCATGACTGGACGGGG + Exonic
1143183244 17:4997079-4997101 TGCGCCTGCGAGGGTGGATGAGG + Intronic
1143389272 17:6550629-6550651 TGAGACTTCATGGCTGGAGGTGG - Intronic
1144831116 17:18131691-18131713 GGAGCCACCGTGGCTGGAGGAGG - Intronic
1146126275 17:30234013-30234035 TGGGGATGCTTGGCTGGAGGGGG - Intronic
1147846358 17:43406836-43406858 TGGGACTGCCTGGCTGGTGGCGG + Intergenic
1151187112 17:72372464-72372486 TGCTCCTGGGTGGCTGGCTGGGG - Intergenic
1151655692 17:75494990-75495012 GGAGCCTGCGTGGCTGGGGCTGG - Exonic
1151916721 17:77123701-77123723 TGGGCCTGGGTGGCTGGGTGTGG - Intronic
1152039227 17:77892319-77892341 GGGGTCTGCTTGGCTGGAGGGGG + Intergenic
1152466656 17:80470459-80470481 TGTGCGTGCGTGGCTGGGGGAGG - Exonic
1152625637 17:81386882-81386904 CGCGCCTGGGTGGCTGCCGGGGG - Intergenic
1153600244 18:6774046-6774068 TGGCCCTGTGCGGCTGGAGGCGG + Intronic
1155519709 18:26656497-26656519 GGCGCCTGGGTGGGCGGAGGCGG + Intronic
1156916162 18:42466151-42466173 TGGGCCTGTGAGGCTGGAAGGGG - Intergenic
1160745717 19:709897-709919 TGCGCCTGTGTGTGTGGGGGGGG + Intronic
1160803026 19:979330-979352 AGGGTCAGCGTGGCTGGAGGTGG + Intergenic
1161238179 19:3208180-3208202 TGCTCCTTCTTGCCTGGAGGAGG + Exonic
1161333671 19:3699972-3699994 GGCGGCTGCTTGGGTGGAGGCGG - Intronic
1162524133 19:11197629-11197651 GGCGCCCGGGCGGCTGGAGGGGG - Intronic
1163512919 19:17746835-17746857 TGAGCCTGGGAGGCTGGTGGAGG + Intergenic
1163527416 19:17830252-17830274 GGAGCCTCCGTGGGTGGAGGGGG + Intronic
1163735723 19:18979238-18979260 TGAGCCTGGGTGGCTGGGAGTGG + Intergenic
1164805657 19:31114535-31114557 TGACCCTGAGTGGCTGGAGAGGG + Intergenic
1166564434 19:43754976-43754998 TGAGCGTGCGTGGATGGAGGCGG + Exonic
1167612447 19:50513972-50513994 TGGGCCTGCGGGAGTGGAGGCGG + Intronic
1167669406 19:50841225-50841247 TGCCCCTGGATGGGTGGAGGAGG + Intergenic
1202712375 1_KI270714v1_random:25448-25470 TCCGCCTGCGGGGATGAAGGTGG + Intergenic
925020247 2:562925-562947 TGGGCCTGCGGGGCTGTGGGGGG + Intergenic
925020260 2:562964-562986 TGGGCCTGCGGGGCTGTCGGGGG + Intergenic
926224469 2:10957206-10957228 TGCAGCAGTGTGGCTGGAGGGGG + Intergenic
926369263 2:12163765-12163787 AGCTACTGCATGGCTGGAGGTGG - Intergenic
926739703 2:16101234-16101256 TGCGAGTTCATGGCTGGAGGAGG - Intergenic
927278429 2:21281769-21281791 TGCTCCTGTGTGTTTGGAGGAGG + Intergenic
927472443 2:23385972-23385994 TGCGCCTGCGCTGCTCCAGGGGG + Intronic
927918214 2:26950123-26950145 TGCGCCTCAGCAGCTGGAGGGGG - Exonic
930033157 2:47070327-47070349 TGCACCTGCGTGGCCGTAAGAGG + Intronic
932776355 2:74530312-74530334 TTCGCGCGCGTGGCTGGCGGTGG + Exonic
934566995 2:95346629-95346651 GGCGCCCGCGGGGCTGGAGAGGG + Intronic
934712871 2:96527320-96527342 AGAGCCTGCGGGGCTGGAGGAGG + Intergenic
937122775 2:119452233-119452255 TGCTCCTGGGTGGCAGGAGGGGG - Intronic
937361471 2:121232847-121232869 TGCTCCTGCCTGGCTGGTGCAGG - Intronic
937896484 2:126980134-126980156 TGCTGGTGCCTGGCTGGAGGTGG - Intergenic
938071690 2:128311765-128311787 TGAGCCTGTGTGGGTGCAGGTGG - Intronic
938296465 2:130182321-130182343 GGCGCCCCCGGGGCTGGAGGCGG + Exonic
938460286 2:131492316-131492338 GGCGCCCCCGGGGCTGGAGGCGG - Exonic
941096628 2:161245013-161245035 GGCCCCTGCGTGGCGGCAGGCGG - Intergenic
942292659 2:174487306-174487328 TGGGGCTCCGAGGCTGGAGGAGG - Intergenic
944893957 2:204145171-204145193 TTTCCCTGCTTGGCTGGAGGAGG + Intergenic
947640724 2:231706567-231706589 GGCGCCCCAGTGGCTGGAGGTGG - Intergenic
947820213 2:233063946-233063968 GGCCCCTGCGTGGCAGGAGAGGG - Intronic
948519919 2:238529649-238529671 TGGGCCTGCGTGGCAGGCAGGGG + Intergenic
948702126 2:239767057-239767079 TGTGCCTGCAGGGCTGGGGGAGG + Intronic
948777498 2:240297265-240297287 TGCTCCTGTGAGCCTGGAGGAGG - Intergenic
1169965275 20:11210668-11210690 TGGGCCTTCTTGGGTGGAGGTGG - Intergenic
1170866420 20:20161861-20161883 TGAGAGGGCGTGGCTGGAGGAGG - Intronic
1171117279 20:22535816-22535838 TGAGCGTGGGAGGCTGGAGGGGG - Intergenic
1171969976 20:31558303-31558325 TGGCAGTGCGTGGCTGGAGGGGG - Intronic
1172479806 20:35264309-35264331 TGAACCTGCCTGGCTAGAGGTGG - Intronic
1173954665 20:47021733-47021755 TGCTCCTGAGTGGCTGCTGGAGG - Intronic
1174076558 20:47941589-47941611 AGCGCCAGCCTGGGTGGAGGGGG + Intergenic
1175939138 20:62529864-62529886 AGCGGCAGGGTGGCTGGAGGAGG - Intergenic
1176232404 20:64039047-64039069 TGCGCCTCGGTGGCGGGGGGCGG + Intronic
1176240768 20:64074917-64074939 TGGGCATGGGTGGGTGGAGGAGG - Intronic
1179717803 21:43298780-43298802 TGCGCCTGCGTGTACGGGGGCGG - Intergenic
1179894690 21:44354929-44354951 TGCACCTGCGAGGCAGGATGAGG - Intronic
1179944135 21:44659129-44659151 TGTGCCTGCTAGGCTGGAGCTGG - Intronic
1180216097 21:46324552-46324574 TGCGCCTGCGTCGGGGGGGGTGG + Intronic
1182527096 22:30927257-30927279 TGTACCTGCTTGGTTGGAGGAGG - Intronic
1185106435 22:48872362-48872384 TTACCCTGCGTTGCTGGAGGAGG - Intergenic
1185271047 22:49929454-49929476 GGCGCCTGCGGGGCTGGGGCTGG + Intergenic
1185392238 22:50568790-50568812 TGCCCCTGCATGGGAGGAGGTGG + Intergenic
953214757 3:40907997-40908019 GGCGGCAGCGAGGCTGGAGGAGG - Intergenic
953755744 3:45644510-45644532 TGCGCCGCCATGGGTGGAGGAGG - Intronic
954391857 3:50271734-50271756 GGAGACTGGGTGGCTGGAGGGGG + Intronic
955669767 3:61391521-61391543 GGCGGCAGCGAGGCTGGAGGAGG + Intergenic
960925932 3:122795038-122795060 TGCGCCTGCGCGGCCCGAGCCGG - Exonic
961354986 3:126331974-126331996 GGCGCCAGCGAGGCTGGGGGAGG + Intergenic
961717079 3:128865089-128865111 TGTGCCTGCGTGGGAGGAGCAGG + Intergenic
961826009 3:129599449-129599471 TGCGCCTGCCTGGCTGTGGAAGG + Intronic
962259896 3:133895629-133895651 TGCGGCTGCGTGTCCGGCGGCGG + Exonic
962274133 3:133999491-133999513 TGCCCCTGGGGGGCTGGGGGAGG - Intronic
963133167 3:141876752-141876774 TGCGGCCGCGGGGATGGAGGCGG - Exonic
966204680 3:177394361-177394383 GGCGGCAGCGAGGCTGGAGGAGG - Intergenic
966604332 3:181807319-181807341 TGGGCCTGGGAGGCTAGAGGGGG - Intergenic
966818559 3:183908083-183908105 TGCGCGTGCGTGGGGAGAGGGGG + Intergenic
968039806 3:195579464-195579486 TGGGGCTGGGTGGCTGGAGAAGG + Exonic
968043841 3:195612435-195612457 TGCGGGGGCGGGGCTGGAGGAGG + Intergenic
968870303 4:3238738-3238760 TGCGCCTGGGTGGCGGGGGTGGG - Intronic
969691575 4:8706903-8706925 GGCCCCGGCGGGGCTGGAGGAGG - Intergenic
971230850 4:24799510-24799532 AGCGCCAGCATGGCTGGAGTCGG - Exonic
973755950 4:54073587-54073609 TGGGGCTGCTTGGCTGGAGCTGG - Intronic
974953292 4:68607163-68607185 TGGGGGTGGGTGGCTGGAGGAGG - Intronic
976815862 4:89148294-89148316 TGCTCCTGGGTGGAAGGAGGTGG - Intergenic
981516872 4:145619342-145619364 TGCGCCTGCGTGGGAGGATCCGG + Exonic
982310862 4:153983784-153983806 GGCGGCAGCGAGGCTGGAGGAGG - Intergenic
982388294 4:154836737-154836759 TGAGACTGCTTGGCTGGAAGGGG - Intergenic
983951708 4:173649815-173649837 TACCCATGCGTTGCTGGAGGGGG - Intergenic
985482906 5:128569-128591 GCTGCCTGCGGGGCTGGAGGTGG + Intergenic
985611381 5:891539-891561 TGCGCCTGCGTGGCTGGAGGAGG - Intronic
986379646 5:7170967-7170989 GGCGGCAGCGAGGCTGGAGGAGG + Intergenic
986892134 5:12321503-12321525 TTCAACTGCATGGCTGGAGGGGG + Intergenic
987203461 5:15600905-15600927 TGAGTCTGTGTGGCTAGAGGTGG - Intronic
991120570 5:63008459-63008481 GGCGCCTGCGGGGCTTGATGGGG + Intergenic
994780244 5:104079946-104079968 GGCGGCAGCGAGGCTGGAGGAGG - Intergenic
997285837 5:132677797-132677819 GGTGCCTGTGTGTCTGGAGGTGG - Intronic
997786487 5:136718352-136718374 TGACCCTGAGTGGCTGGAGAAGG - Intergenic
1000607258 5:163338384-163338406 TGGGCCTGTGAGGCTGGAAGGGG - Intergenic
1002051305 5:176573160-176573182 TCAGCCAGTGTGGCTGGAGGGGG + Intronic
1002947304 6:1775158-1775180 AGCGCATGCATGGCTGAAGGTGG + Intronic
1004412302 6:15392071-15392093 TGTGTGTGCGTGTCTGGAGGTGG + Intronic
1004525547 6:16404125-16404147 TGTGCATGCGGGGCAGGAGGTGG + Intronic
1005482987 6:26272393-26272415 TGCGCCGGTGTACCTGGAGGCGG - Intergenic
1005514111 6:26538322-26538344 TGCGCTTCCGGGGCTGCAGGCGG - Intergenic
1006517318 6:34552204-34552226 GGCGTATGCGGGGCTGGAGGAGG - Intronic
1012472724 6:99589454-99589476 TGCGGCTGAGAAGCTGGAGGAGG + Intergenic
1014612356 6:123560774-123560796 TGGGCCTGTGAGGCTGGAAGGGG - Intronic
1016572617 6:145531960-145531982 TGCGACTGCTTGGCTGGAAGGGG + Intronic
1017021410 6:150143103-150143125 TGCGGCTGCCGGGCCGGAGGTGG + Exonic
1019324666 7:432249-432271 TGCGTCTGGGAAGCTGGAGGTGG + Intergenic
1022102044 7:27174543-27174565 TGCCCCAACGTGGCTGGTGGGGG + Intronic
1023382607 7:39623664-39623686 GGAGCCTGGGCGGCTGGAGGAGG - Exonic
1024131274 7:46355025-46355047 TGCACCTTCGTGGATGCAGGAGG - Intergenic
1024858657 7:53812083-53812105 GGGGTCAGCGTGGCTGGAGGAGG - Intergenic
1026596318 7:71736799-71736821 TGGGCCTGAGTGGGGGGAGGCGG - Intergenic
1026843351 7:73683233-73683255 TGGGCCTGCGTGGCTGTGGAGGG + Exonic
1029115284 7:98233471-98233493 TGGGCCTGGGTGTCGGGAGGCGG - Exonic
1029535268 7:101154321-101154343 AGCGCGGGCGGGGCTGGAGGCGG - Intergenic
1032073946 7:128827476-128827498 TGCCCCTGCCTGGCTTGGGGAGG + Intergenic
1032095786 7:128938017-128938039 TGCGCCTGCGTGGCTGCGCCAGG - Exonic
1032516753 7:132512147-132512169 TGCACCTGCCTGTCTGGAAGGGG - Intronic
1032538884 7:132687159-132687181 TGCACCTGCATGTCTGGAGAAGG - Intronic
1032878381 7:136062574-136062596 TGGTCTTGTGTGGCTGGAGGAGG - Intergenic
1033299954 7:140176712-140176734 GGCGGCTGCGGGGCTGGAGGGGG + Intronic
1035365171 7:158344668-158344690 TGAGGCTGTGTTGCTGGAGGTGG + Intronic
1036943345 8:13071724-13071746 GGGTCCTGCGTGCCTGGAGGAGG - Intergenic
1037825543 8:22158442-22158464 TGCAGCTGAGGGGCTGGAGGAGG + Intronic
1037878603 8:22561737-22561759 TGCTCCTGGGTGGATGGTGGGGG - Intronic
1037890541 8:22621760-22621782 AGGGCCTCAGTGGCTGGAGGTGG + Intronic
1038041555 8:23727786-23727808 AGCTCCTGGGTGGCTGGAGGAGG + Intergenic
1042720355 8:71820679-71820701 GGCGTCAGCGAGGCTGGAGGAGG + Intergenic
1043725173 8:83602119-83602141 GGCGGCAGCATGGCTGGAGGAGG + Intergenic
1045088210 8:98710574-98710596 TGCGGCAGCGAGGCTGGGGGAGG + Intronic
1045490301 8:102663125-102663147 TGGGCCTGCGTGACTGGGGCTGG - Intergenic
1045784825 8:105908739-105908761 TGCTCCTGCAGCGCTGGAGGTGG + Intergenic
1046422690 8:114005881-114005903 GGCGGCCGCGAGGCTGGAGGAGG - Intergenic
1049191713 8:141292027-141292049 TGCTCCTGCGTGCCTGGTGCTGG + Intronic
1049299850 8:141863719-141863741 TGCGGCTGCCTTCCTGGAGGAGG - Intergenic
1049804934 8:144534451-144534473 TGTTCCTGCGTGGCCGTAGGAGG - Intronic
1054886491 9:70204644-70204666 GGCGCCAGCGAGGCTGGGGGAGG - Intronic
1056350231 9:85741924-85741946 TGCGGCGGCGGCGCTGGAGGCGG + Intronic
1057443575 9:95098635-95098657 GGGGCCTGTGGGGCTGGAGGAGG + Intergenic
1057512429 9:95691919-95691941 TCTGCCTGAGAGGCTGGAGGAGG - Intergenic
1061056346 9:128224806-128224828 TGGGCCTGGGTGGCCAGAGGGGG + Intronic
1061083524 9:128386152-128386174 TGTGCCTGTGTGTGTGGAGGCGG - Intronic
1061251947 9:129431553-129431575 AGAGCCTTCGTGGCTGGAGCTGG - Intergenic
1061478514 9:130884845-130884867 TGAGCCTGCTTTGCTGGTGGGGG - Exonic
1062081985 9:134629144-134629166 TGGACATGTGTGGCTGGAGGAGG + Intergenic
1187848505 X:23566366-23566388 TGCGGCAGCGAGGCTGGGGGAGG - Intergenic
1188476476 X:30597956-30597978 TGGGCCTGAGGGGCTGGAGTAGG - Intergenic
1190303792 X:49071374-49071396 TGCCCCTGTGTGGATGGAGTCGG - Exonic
1193346041 X:80405657-80405679 GGCGGCAGCGAGGCTGGAGGAGG + Intronic
1194237254 X:91399539-91399561 GGCACCTGCTTGGGTGGAGGTGG - Intergenic
1195261038 X:103131814-103131836 GGCGGCAGCGAGGCTGGAGGAGG + Intergenic
1196183314 X:112719026-112719048 GGCGGCAGCGAGGCTGGAGGAGG + Intergenic
1196465493 X:115968491-115968513 CCCACCTACGTGGCTGGAGGAGG - Intergenic
1196511775 X:116520198-116520220 GGCGGCAGCGAGGCTGGAGGAGG - Intergenic
1198616494 X:138463604-138463626 AGCACCTGCTTTGCTGGAGGTGG - Intergenic
1200537636 Y:4419066-4419088 GGCGGCAGCGAGGCTGGAGGAGG + Intergenic
1201405308 Y:13643970-13643992 TTAGCCTGCTTGGCTGGAAGTGG - Intergenic