ID: 985611497

View in Genome Browser
Species Human (GRCh38)
Location 5:892180-892202
Sequence AGGGTGAACCGAAGTGCTGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 110
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 104}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985611497_985611501 -5 Left 985611497 5:892180-892202 CCCCCAGCACTTCGGTTCACCCT 0: 1
1: 0
2: 0
3: 5
4: 104
Right 985611501 5:892198-892220 ACCCTCGCCTGACTTCCTGCAGG 0: 1
1: 0
2: 0
3: 12
4: 182
985611497_985611508 23 Left 985611497 5:892180-892202 CCCCCAGCACTTCGGTTCACCCT 0: 1
1: 0
2: 0
3: 5
4: 104
Right 985611508 5:892226-892248 GTGCTGCCCGCTGACACCCATGG 0: 1
1: 0
2: 1
3: 28
4: 133

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985611497 Original CRISPR AGGGTGAACCGAAGTGCTGG GGG (reversed) Intronic
901627351 1:10631639-10631661 AGGCTGAACCCACCTGCTGGAGG + Intergenic
907097780 1:51797114-51797136 GGCGTGAACCGAAGAGGTGGAGG + Intronic
907769191 1:57442999-57443021 AGGGTTGAGAGAAGTGCTGGTGG - Intronic
922542581 1:226430118-226430140 AGGGAGATCAGAAGTGGTGGTGG + Intergenic
1062997619 10:1881737-1881759 TGGGTGAAACCAAGAGCTGGAGG + Intergenic
1063724269 10:8619869-8619891 CGGGGGAACTGAAGTGCTTGTGG + Intergenic
1071436571 10:85653275-85653297 AGGGTGAGCCAAAATGATGGAGG + Intronic
1072569938 10:96649778-96649800 AGAGTGAACTGACGTCCTGGTGG - Intronic
1072877660 10:99190665-99190687 AGGGCGAACACAATTGCTGGAGG - Intronic
1074898198 10:117794946-117794968 AGGGAGAACTGCAGTGTTGGAGG - Intergenic
1080644246 11:34176556-34176578 AGGTTGAGCCCAAGAGCTGGAGG + Intronic
1081115317 11:39192723-39192745 AGGCTGCACAGGAGTGCTGGTGG + Intergenic
1083403639 11:62441834-62441856 AGGGTGAACTGAGCTCCTGGAGG - Intronic
1085017589 11:73185572-73185594 AGGCTGGATTGAAGTGCTGGAGG - Intergenic
1085185228 11:74570282-74570304 AGCGTGAACCCAAGAGATGGAGG + Intronic
1085521727 11:77143028-77143050 AGAGTGGACTGAAGTGCTTGTGG - Intronic
1091898500 12:4123783-4123805 AGGGTGAATGGGACTGCTGGGGG - Intergenic
1095848292 12:46771777-46771799 AAGGTAAACAGAACTGCTGGGGG - Intronic
1104740014 12:131165266-131165288 AGGGTGGACCGCAGGGCTGTGGG - Intergenic
1104888965 12:132130624-132130646 AGGGTGTACTGAAGAGTTGGCGG + Intronic
1108878968 13:55085826-55085848 AGGGTGAACCTAAGAGTTGTTGG - Intergenic
1112151831 13:96773008-96773030 AGGGTGAGCTGAAGTGGGGGAGG + Intronic
1113467025 13:110520032-110520054 AGGGGGAACCCGTGTGCTGGTGG + Intergenic
1120377478 14:83728812-83728834 ATTGTGATCCCAAGTGCTGGAGG - Intergenic
1120941556 14:89954906-89954928 GGGGTGGAGCCAAGTGCTGGGGG - Intergenic
1121615313 14:95310076-95310098 AATGTGATCCGCAGTGCTGGAGG + Intronic
1122883809 14:104701754-104701776 AGGGTGAGCCGCAGTGTGGGAGG + Exonic
1124504618 15:30262057-30262079 AGGGTGACCCGAGGCCCTGGGGG + Intergenic
1124738934 15:32276578-32276600 AGGGTGACCCGAGGCCCTGGGGG - Intergenic
1126572643 15:50168586-50168608 AGGGTGAACAGAGGAGCAGGGGG + Intronic
1129415671 15:75377075-75377097 ATGGTGAACAAAAATGCTGGTGG + Intronic
1133235225 16:4384533-4384555 GGGGTGAGCCTGAGTGCTGGGGG - Intronic
1138149270 16:54640920-54640942 ATTGTGATCCCAAGTGCTGGAGG + Intergenic
1140602054 16:76488349-76488371 AGGGTGAACTGAAATGCAAGGGG + Intronic
1144223362 17:13120360-13120382 AGGGTGAACTGAATTGCAGTGGG + Intergenic
1146380648 17:32324741-32324763 AGGGTGAACAGCAGCGGTGGTGG + Intronic
1147133195 17:38420611-38420633 GGGGTGACCCTAAGTTCTGGGGG + Intergenic
1149999819 17:61426845-61426867 AGGCTGAACCCAGGAGCTGGAGG - Intergenic
1152740812 17:82017603-82017625 AAGGAGAACAGAAGTGCTTGAGG + Intergenic
1154361766 18:13668884-13668906 ATGGTTAACCGAAATGCTGTTGG + Intronic
1155394038 18:25367733-25367755 AGGGTGAATGGAAGTGCAGGAGG + Intergenic
1156421285 18:36955891-36955913 AGGGTGAGGTGAAGTGGTGGGGG + Intronic
1157002439 18:43542686-43542708 GGGGTGCAGGGAAGTGCTGGGGG - Intergenic
1157340361 18:46772510-46772532 AGGCTGACCCCAAGTGGTGGTGG - Intergenic
1158562342 18:58525454-58525476 AGGGCTACCCGAAGGGCTGGGGG + Intronic
1159224273 18:65511747-65511769 AGGTTGAACCCAGGTGGTGGAGG + Intergenic
1165724299 19:38101854-38101876 TGGGTGCACCGAGGTGCCGGTGG - Intronic
1167409024 19:49334106-49334128 AGGGAGCACCCAGGTGCTGGGGG - Intergenic
1167798933 19:51727802-51727824 AGGGTGAAACAAGGGGCTGGGGG + Intergenic
927289239 2:21388580-21388602 AGGGTGAAGAGCAATGCTGGGGG + Intergenic
929452464 2:42046991-42047013 AGGAGGGACCGAAGTTCTGGTGG + Intergenic
930056299 2:47254671-47254693 AAGAGGAACTGAAGTGCTGGTGG - Intergenic
930486578 2:52018226-52018248 AGGGTGACCAGAGGAGCTGGCGG - Intergenic
932292151 2:70590869-70590891 AGGGTGAAACAAAGTGCTGTTGG + Intergenic
934725199 2:96612461-96612483 AGTGAGAAGCAAAGTGCTGGAGG - Exonic
936528523 2:113258829-113258851 AGGGTTAATCTAAGGGCTGGGGG - Intronic
940316912 2:152335863-152335885 GGGGTGAAGAGGAGTGCTGGGGG - Intronic
941409535 2:165136855-165136877 AGGGGGAAAGGAAATGCTGGTGG - Intronic
944293499 2:198035215-198035237 AGAGTGAACCCATGTGCTGTTGG + Intronic
944726843 2:202480214-202480236 AGCGTGAACCCAAGAGGTGGAGG - Intronic
948336394 2:237210792-237210814 AGGGAGACACGAAGGGCTGGAGG + Intergenic
1169061890 20:2666487-2666509 AGGGTGAAAGGAACTGATGGAGG + Intergenic
1172628174 20:36360652-36360674 AGGGTGAACCAAGGGGCGGGTGG + Intronic
1177806344 21:25878740-25878762 AGAGTGAACCTAAGGGCTGCTGG - Intergenic
1178877316 21:36423029-36423051 AGAGTGAACCGCAGGGGTGGTGG + Intergenic
1180652054 22:17385990-17386012 AGGGTAATCCGCAGTGCTGAAGG - Intronic
1183406258 22:37632072-37632094 AGGGCGCTCCGACGTGCTGGTGG + Exonic
1183425271 22:37735751-37735773 AGGGTGAAGCCACTTGCTGGTGG + Intronic
1184195438 22:42924601-42924623 AGGGTGGACAGCAGTGGTGGCGG - Intronic
1184272574 22:43393206-43393228 AGGGTGAAGCCAAGGGTTGGGGG - Intergenic
952828054 3:37540269-37540291 TGGGTGAACCAATGTGGTGGAGG - Intronic
952878733 3:37969769-37969791 AGGGTGGAGCGAGGGGCTGGAGG - Intronic
955401088 3:58592019-58592041 AGGGTGAACAGAATTGCCTGGGG + Intronic
964312110 3:155404718-155404740 AAGGTGAACTGAAATGCAGGAGG + Intronic
967952790 3:194853565-194853587 AGGGGGAATGGAAGTCCTGGCGG + Intergenic
983806971 4:172005891-172005913 AAGGTGAACCAAAGTGCTGCTGG - Intronic
985611497 5:892180-892202 AGGGTGAACCGAAGTGCTGGGGG - Intronic
988717907 5:33846026-33846048 AGTTTGATCCCAAGTGCTGGAGG - Intronic
992081619 5:73239053-73239075 AGGCTGGAGCGAAGTGATGGAGG + Intergenic
994194351 5:96906009-96906031 AGGCTGAGCAGAAGTGCTTGAGG - Intronic
997467411 5:134097575-134097597 AGGGTGAACCGAGGTGGCCGAGG - Intergenic
1000146137 5:158454949-158454971 AGGGTGAGGCCAACTGCTGGAGG + Intergenic
1003306135 6:4931324-4931346 AGGGTGATATGAAGTGCTGATGG + Intronic
1009970656 6:70622317-70622339 AGTGTTAACCCAGGTGCTGGAGG - Intergenic
1017809904 6:157977240-157977262 AGGGTGGACTGAAGTACTGGAGG - Intergenic
1018461807 6:164005698-164005720 AGGGAGAAAGGAACTGCTGGGGG - Intergenic
1023735485 7:43232308-43232330 AGGGAAAAGCCAAGTGCTGGTGG + Intronic
1033315025 7:140289974-140289996 AGGGTACACAGAAGTGCTGGTGG - Intergenic
1034749820 7:153558233-153558255 TGGGTAAACTGAGGTGCTGGTGG + Intergenic
1035042803 7:155942797-155942819 TGGATGGACAGAAGTGCTGGGGG + Intergenic
1035590415 8:808656-808678 AGGGTGGACGGTAGTGCTGAGGG + Intergenic
1035707639 8:1689367-1689389 AGGGAATACCGATGTGCTGGAGG - Intronic
1036779258 8:11634501-11634523 AGGAAGAACCGTGGTGCTGGAGG - Intergenic
1038491933 8:27977644-27977666 ACAGTGAACACAAGTGCTGGGGG - Intronic
1038585088 8:28781044-28781066 AGGGGGAACCAAAGTACGGGAGG + Intronic
1038992071 8:32878798-32878820 AGGGTGAACTGCAGTGAAGGAGG - Intergenic
1043358453 8:79441337-79441359 AGAGTGAACAGTAGTTCTGGAGG - Intergenic
1045614412 8:103891794-103891816 AGGGTGAATGGAAATGGTGGTGG + Intronic
1046420700 8:113980043-113980065 AGGGTGAATGAAAGGGCTGGGGG + Intergenic
1048229513 8:132623821-132623843 AGGGTGAAGCCAAGGGCTTGTGG - Intronic
1049307017 8:141909390-141909412 TGGGTGAACAGAGCTGCTGGTGG - Intergenic
1049963999 9:762141-762163 AGGGTGGACCCAAGAGCTGTGGG - Intergenic
1051743551 9:20274247-20274269 AGGGGGACCAGGAGTGCTGGGGG + Intergenic
1053348505 9:37395653-37395675 AGGCTGAACCGGTGGGCTGGAGG + Intergenic
1056766563 9:89447785-89447807 AGGGAGCACTGAAGTGGTGGTGG - Intronic
1058475484 9:105328694-105328716 AAGGTCTACAGAAGTGCTGGCGG + Intronic
1060298983 9:122362939-122362961 ATGGAGAAACGCAGTGCTGGTGG + Intergenic
1186497621 X:10024495-10024517 AGGGAGAACCGAATGGCTCGGGG - Intronic
1201388130 Y:13465841-13465863 AGGGTGCACTAAAGAGCTGGTGG - Intronic
1201608529 Y:15814571-15814593 AGCTTGAACCGAGGTGCCGGAGG + Intergenic