ID: 985612232

View in Genome Browser
Species Human (GRCh38)
Location 5:896701-896723
Sequence ATTTTCCAGCTGAATGAAGA TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 446
Summary {0: 1, 1: 0, 2: 2, 3: 53, 4: 390}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985612228_985612232 25 Left 985612228 5:896653-896675 CCCTCATTTTAGCCCATCGATTT 0: 1
1: 0
2: 1
3: 9
4: 242
Right 985612232 5:896701-896723 ATTTTCCAGCTGAATGAAGATGG 0: 1
1: 0
2: 2
3: 53
4: 390
985612229_985612232 24 Left 985612229 5:896654-896676 CCTCATTTTAGCCCATCGATTTG 0: 1
1: 0
2: 0
3: 4
4: 89
Right 985612232 5:896701-896723 ATTTTCCAGCTGAATGAAGATGG 0: 1
1: 0
2: 2
3: 53
4: 390
985612230_985612232 13 Left 985612230 5:896665-896687 CCCATCGATTTGAGTGCATGCAC 0: 1
1: 0
2: 0
3: 4
4: 42
Right 985612232 5:896701-896723 ATTTTCCAGCTGAATGAAGATGG 0: 1
1: 0
2: 2
3: 53
4: 390
985612231_985612232 12 Left 985612231 5:896666-896688 CCATCGATTTGAGTGCATGCACT 0: 1
1: 0
2: 0
3: 9
4: 58
Right 985612232 5:896701-896723 ATTTTCCAGCTGAATGAAGATGG 0: 1
1: 0
2: 2
3: 53
4: 390

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985612232 Original CRISPR ATTTTCCAGCTGAATGAAGA TGG Exonic
900709798 1:4106578-4106600 ATTTCCCAGCTGACTGAATTCGG - Intergenic
900721275 1:4177410-4177432 AGTTTCCAGCTTTAGGAAGAGGG - Intergenic
902114470 1:14109708-14109730 AATTTGCAGCTGCATCAAGAAGG + Intergenic
902444170 1:16451602-16451624 ATTTCCCTGATGAATGAAGTGGG + Intronic
903815285 1:26060284-26060306 ATCCTCCAGCTGAGTGATGATGG + Exonic
904885862 1:33737923-33737945 ATTTTCCAGCTGGAAAAAAAAGG - Intronic
906163531 1:43668903-43668925 ATTTTCCAGATGATTGAACAAGG + Intronic
906446750 1:45906026-45906048 ATTTCCCAGATGAATAATGATGG + Intronic
907768739 1:57438566-57438588 ATTTTCCAGCAAAATAAAGAAGG + Intronic
907813169 1:57892536-57892558 ATTTACCAGCTGAGTGAACCTGG - Intronic
908132579 1:61088827-61088849 CTTTTTCACCTGAATGAAGGTGG - Intronic
908394316 1:63711618-63711640 ATTTTCCAGCGAAATGGAAAGGG + Intergenic
908416630 1:63919306-63919328 ATTTTACAGCTGAAGAAAGAGGG - Intronic
908469117 1:64424842-64424864 ATTTGCCAGCTGTATGACCATGG - Intergenic
908768011 1:67571542-67571564 ATTTGCCAGCTGAAGGAGAAGGG + Intergenic
909434831 1:75628994-75629016 ATCTTCCAGCTGGGTGAAAAAGG + Intergenic
909440356 1:75689586-75689608 ATCTTCTAGCTGAAGAAAGAGGG + Intergenic
909748626 1:79131232-79131254 CATTTTCAGCTGAATGAAAATGG + Intergenic
910171673 1:84384733-84384755 ATTTTCCATCTCACTGAATATGG + Intronic
911167717 1:94739404-94739426 ACTTTCAAGCTGAATGATCAGGG + Intergenic
911361289 1:96880277-96880299 ATTTTTCAGATAAATGAAAATGG + Intergenic
911444841 1:97978746-97978768 AATTTACAGCTGAATGGAGTGGG - Intergenic
912544535 1:110441308-110441330 CCTTTCCAGCTAAATGATGAGGG + Intergenic
912681887 1:111734050-111734072 ATTCTCCAGCTCAGTGAATAGGG + Intronic
912869472 1:113290857-113290879 ATTTTCCAGCCGAATGAGGCAGG - Intergenic
913943393 1:125131905-125131927 ATATTCCAGCTTCATGAATATGG - Intergenic
913955830 1:143291840-143291862 ATATTCCAGCTTCATGAATATGG + Intergenic
914075975 1:144350256-144350278 ATATTCCAGCTTCATGAATATGG - Intergenic
914103203 1:144616240-144616262 ATATTCCAGCTTCATGAATATGG + Intergenic
915091694 1:153430567-153430589 ATCTTACAGCTGAAGGAAAAAGG + Intergenic
915882953 1:159692304-159692326 ATTTTCCAGTTGTATGAGGCAGG + Intergenic
916489761 1:165291415-165291437 ATGTTCCAGCTGACTGAATTTGG + Intronic
916622503 1:166515728-166515750 ATTTTTCTGCTGATTGAAGAAGG + Intergenic
917312711 1:173693396-173693418 GTTTTCCATCTGGATGAATAGGG - Intergenic
917603747 1:176603752-176603774 ATAATCCAGATGAGTGAAGATGG - Intronic
918753950 1:188311829-188311851 ATTTCCCAGGTAAATGCAGAGGG + Intergenic
918764036 1:188455582-188455604 TTATTCCAGGTGAATGGAGATGG - Intergenic
920721118 1:208387894-208387916 ATTTTACAGGTGAAAGAAAAGGG + Intergenic
921008759 1:211119943-211119965 AATTTGATGCTGAATGAAGATGG - Intronic
922126932 1:222736846-222736868 ATTTTCTAGATAAATGAAAATGG + Intergenic
922595994 1:226813281-226813303 ATCTTCCAACTTTATGAAGATGG - Intergenic
924154688 1:241163851-241163873 ATTTTGCAGCAGACTGAAGCTGG + Intronic
924535197 1:244929684-244929706 ATTTTCCAGGTGCAAAAAGAAGG - Intergenic
1063647663 10:7901769-7901791 ACTTTACAGCTGAATGACTAAGG + Intronic
1065562474 10:26977758-26977780 TTTTTCCAGCTGCCTGCAGAAGG + Intergenic
1065815675 10:29480495-29480517 TTTTTCCAGCTGAAAGAGGCTGG - Intronic
1065958897 10:30717545-30717567 ATTGTCTAGCTGGAAGAAGAAGG - Intergenic
1066393199 10:34995331-34995353 TTTTTCCAGATGAAAGAGGACGG - Intergenic
1066592633 10:37012189-37012211 ATTATTCAGCTGAATGATAAAGG + Intergenic
1066778933 10:38920888-38920910 ATATTCCAGCTTCATGAATATGG - Intergenic
1067035614 10:42914281-42914303 AATTTCCAGCTGGAAAAAGATGG + Intergenic
1068882585 10:62066002-62066024 ATTTTCCAGCTGATTGAGGCTGG + Intronic
1070268905 10:74932721-74932743 ATGTACCACCTGAATGAGGATGG + Intronic
1072244226 10:93527134-93527156 ATTTTACAGCACAGTGAAGAGGG - Intronic
1072481239 10:95810619-95810641 ATTTTGTACCTGAGTGAAGAAGG - Intronic
1072700296 10:97636085-97636107 ATTTACCAGCTGAATGACCATGG + Intronic
1075258417 10:120943486-120943508 CTTTTCCAGCTCCATGTAGAGGG - Intergenic
1075678047 10:124310267-124310289 ATTCTCCAGCAAAATGAAGAAGG + Intergenic
1076025516 10:127108879-127108901 ATTTACCAGCTGAATTATCATGG - Intronic
1076403313 10:130197177-130197199 ATTTTCCAGCTCAATTGAGTAGG + Intergenic
1077898987 11:6474782-6474804 ACTTTCTAGCTGAGTGATGAGGG - Intronic
1078806104 11:14706262-14706284 AATATCAAGTTGAATGAAGAAGG + Intronic
1078903276 11:15661336-15661358 CTTTTCTAGAAGAATGAAGAAGG + Intergenic
1079365990 11:19810468-19810490 ACTTTTCAGCTGAAAGAACAAGG + Intronic
1079492661 11:21006662-21006684 TTTTTGCAGCTGGCTGAAGAGGG + Intronic
1079872741 11:25820910-25820932 AATTTCAAGCTGCATGAAAATGG + Intergenic
1079941486 11:26685991-26686013 ATTTTCCAGATGAAGGAACTAGG - Intronic
1080282952 11:30579786-30579808 ATTTCCCAGCTGAATGTAAAGGG + Intronic
1081819662 11:45979526-45979548 ATTTCCCACCTGTCTGAAGAAGG - Intronic
1086269981 11:85051116-85051138 ATTCTTCAGGTAAATGAAGAGGG + Intronic
1086853982 11:91844457-91844479 ATTTTCCAGCTACAGGTAGATGG - Intergenic
1086925371 11:92634472-92634494 ATTGTCCAGCTGAGTGAAGATGG - Intronic
1087570349 11:99919432-99919454 ATGTAGTAGCTGAATGAAGAGGG - Intronic
1088116749 11:106321145-106321167 ATTGTGGAGCTGACTGAAGATGG - Intergenic
1088224948 11:107609686-107609708 CTTTTCCAGCTGAGAGAAAAGGG - Intronic
1089093050 11:115894398-115894420 ATTTTGCAGCTGAAGGCAGTGGG - Intergenic
1089740016 11:120575991-120576013 ATCTTCCAGCTGCATGCAGCAGG - Intronic
1091441987 12:518104-518126 TCTTTCCAGCTGAATTATGAGGG + Intronic
1092824662 12:12387247-12387269 ATTTGCCAGCTGAAGGAATCGGG + Intronic
1096975356 12:55696655-55696677 CTCTTCCAGCTGAATGGAGGAGG - Intronic
1097652297 12:62315942-62315964 ATGTTCTAGCTAAATGAAGAGGG - Intronic
1098028826 12:66233642-66233664 TTTTTCCAGCTGTATGAAATGGG - Intronic
1098345709 12:69501090-69501112 CTTTTCAAGCTGAATTGAGATGG + Intronic
1098407288 12:70139948-70139970 ATTTTTAAGCTGAATGACGATGG + Intergenic
1099270218 12:80499325-80499347 ATTTTCCACCTGGATGAAAATGG + Intronic
1099726043 12:86429518-86429540 ATTTTCCATCTGGGTGAATAAGG + Intronic
1099738313 12:86599653-86599675 ATTTTACAGCTGAAAAAAAATGG + Intronic
1100090836 12:90968474-90968496 ATTTTCCAAATGAATAAAAAAGG + Intronic
1100755439 12:97746217-97746239 ATTTTCCACTTGAATCATGATGG - Intergenic
1101307760 12:103546681-103546703 ATTTTCCAACTGAATGACAGGGG + Intergenic
1104098425 12:125583121-125583143 GTTGTCCAGCTGAGAGAAGATGG + Intronic
1104175821 12:126331713-126331735 ATTGTCCAGCTGAGAGATGATGG + Intergenic
1104711855 12:130992879-130992901 AGTTTCCAGGTGAAGGCAGAGGG + Intronic
1105232650 13:18512671-18512693 ATATTCCAGCTTCATGAATATGG - Intergenic
1106320030 13:28628897-28628919 ACTTTCCAGTAAAATGAAGAAGG - Intergenic
1106694676 13:32160479-32160501 ATTTTCCAACAGAATGCAGAAGG + Intronic
1107059659 13:36145271-36145293 ATTTTACAGAAGAATGAACATGG + Intergenic
1109243097 13:59916045-59916067 ATTTTCCAGTTGAATGATTTGGG + Intronic
1109325132 13:60858384-60858406 ATTTTCCAGCTATAAGAAAAGGG - Intergenic
1110151404 13:72259256-72259278 ATTATTCAGTTGAATAAAGAGGG + Intergenic
1110605676 13:77429561-77429583 CTTTACCAGCAGCATGAAGAAGG - Intergenic
1110692023 13:78442068-78442090 CTGCTCCAGCTGAATGAGGATGG + Intergenic
1111213119 13:85106683-85106705 ATTTTCCATCTAAATGAAGCAGG - Intergenic
1111344491 13:86933096-86933118 GTTTTCCAGGTGAATGAGGTTGG - Intergenic
1112298421 13:98209338-98209360 AGTTTCCAGGTGAAGAAAGAGGG + Intronic
1112298875 13:98212396-98212418 AGTTTCCAGGTGAAGAAAGAGGG + Intronic
1112971859 13:105271281-105271303 ATTTTTCAGCTACATGAAAACGG + Intergenic
1113333681 13:109357298-109357320 ATATTCTTTCTGAATGAAGAAGG + Intergenic
1113418348 13:110149752-110149774 ATTTTCCTGTGGAATAAAGATGG - Exonic
1114330820 14:21635106-21635128 ATTTGCCAGATGAAGGAAGAGGG + Intergenic
1115633583 14:35268984-35269006 ATCTTCCAGCTAAAAAAAGAAGG - Intronic
1116249949 14:42468870-42468892 ATATTCCACCTTAATAAAGAAGG + Intergenic
1117087344 14:52215190-52215212 TTTTTCCAAATGAAAGAAGAAGG + Intergenic
1118272570 14:64357336-64357358 TTTTCCCAGTTGAATGAATATGG + Intergenic
1120146053 14:80979844-80979866 TTTTTCCACCTGAATGGAAATGG + Intronic
1120170745 14:81245589-81245611 GTTTTCCAGTTTTATGAAGAAGG + Intergenic
1120601039 14:86510082-86510104 AGTTTCCAGGTGGATGAACATGG + Intergenic
1122650138 14:103221530-103221552 ATTTCCCTGCTGACTGAAGACGG + Intergenic
1202938335 14_KI270725v1_random:115366-115388 ATATTCCAGCTTCATGAATATGG + Intergenic
1123394864 15:19922527-19922549 ATATTCCAGCTTCATGAATATGG - Intergenic
1124078964 15:26473859-26473881 ATTTTGCATATGAGTGAAGAGGG + Intergenic
1124882683 15:33656854-33656876 GTTTTCCTGCTGGAGGAAGAAGG - Intronic
1125350851 15:38766128-38766150 TTCTGCCAGCTAAATGAAGATGG - Intergenic
1126262333 15:46708428-46708450 ATTTGTAAGCAGAATGAAGATGG - Intergenic
1126506458 15:49409429-49409451 ATTTTCCAGATGAAGAAACAAGG - Intronic
1127195583 15:56582320-56582342 ATTTTCCTGCTGAGTGTAAAAGG - Intergenic
1128700483 15:69800495-69800517 ATTTTCCAGCAGGTTGAAAATGG - Intergenic
1129589944 15:76905949-76905971 GTTTCCCAGCTGGATGAAAAGGG - Intergenic
1129904857 15:79179292-79179314 ATTTTACAGCTGAGGGAACAAGG - Intergenic
1130337085 15:82965783-82965805 ATTTTCCAGCAGATAAAAGAGGG + Intronic
1130402763 15:83572922-83572944 AATTTCCAGCTGAAAGAACATGG - Intronic
1131746100 15:95449374-95449396 CTGCTCCAGGTGAATGAAGAGGG - Intergenic
1131756854 15:95573897-95573919 ATTTTCCAACTAAATGAATGAGG + Intergenic
1134297712 16:12961604-12961626 GTTTTTCAGCTGAAGAAAGAAGG + Intronic
1135043991 16:19139711-19139733 GTTTTCCAGCTGTGTGAAGTTGG - Intronic
1135484964 16:22856262-22856284 ATTTTCCAGCAGACGGAAGAAGG + Intronic
1135824739 16:25716742-25716764 ATTTTACAGATAAATAAAGAAGG + Intronic
1135974540 16:27099312-27099334 ATTTGCCAGGTGAAGGAAGTAGG + Intergenic
1136658044 16:31725018-31725040 ATTATTCAGCATAATGAAGAAGG - Intronic
1136700958 16:32140943-32140965 ATATTCCAGCTTCATGAATATGG - Intergenic
1136766699 16:32786515-32786537 ATATTCCAGCTTCATGAATATGG + Intergenic
1136770394 16:32834201-32834223 ATATTCCAGCTTCATGAATATGG + Intergenic
1136801398 16:33083863-33083885 ATATTCCAGCTTCATGAATATGG - Intergenic
1136900207 16:34027784-34027806 ATATTCCAGCTTCATGAACATGG - Intergenic
1136936517 16:34472093-34472115 ATATTCCAGCTTCATGAATATGG + Intergenic
1136955540 16:34780869-34780891 ATATTCCAGCTTCATGAATATGG - Intergenic
1136963302 16:34876477-34876499 ATATTCCAGCTTCATGAATATGG - Intergenic
1137087999 16:36152795-36152817 ATATTCCAGCTTCATGAATATGG - Intergenic
1137092449 16:36210954-36210976 ATATTCCAGCTTCATGAATATGG - Intergenic
1137220756 16:46448611-46448633 ATATTCCAGCTTCATGAATATGG + Intergenic
1137833239 16:51564694-51564716 ATTTTCTAGCTGAAGGATGTTGG - Intergenic
1138002737 16:53298834-53298856 ATCTTCCAGCAGAATGAAGGTGG + Intronic
1138067255 16:53955157-53955179 AGTATCCAGTTGCATGAAGATGG + Intronic
1138424093 16:56918994-56919016 AGTTTCCAGCTCACTGAAGAAGG + Intergenic
1140603979 16:76512215-76512237 ATTTTCAATCTGAATGAAATTGG + Intronic
1140949088 16:79798496-79798518 TTTTTCCAGGGCAATGAAGAAGG - Intergenic
1141043408 16:80691545-80691567 GTTTTCCAGCAGAATGGATATGG - Intronic
1203069092 16_KI270728v1_random:1048767-1048789 ATATTCCAGCTTCATGAATATGG + Intergenic
1203072815 16_KI270728v1_random:1096308-1096330 ATATTCCAGCTTCATGAATATGG + Intergenic
1142599249 17:1045350-1045372 ATTGTCCTGCTGTAAGAAGATGG - Intronic
1142599251 17:1045376-1045398 ATTGTCCTGCTGTAAGAAGACGG - Intronic
1142599253 17:1045402-1045424 ATTGTCCTGCTGTAAGAAGACGG - Intronic
1142599255 17:1045428-1045450 ATTGTCCTGCTGTAAGAAGACGG - Intronic
1142599257 17:1045454-1045476 ATTGTCCTGCTGTAAGAAGACGG - Intronic
1145708234 17:26941568-26941590 ATATTCCAGCTTCATGAATATGG - Intergenic
1146235185 17:31153437-31153459 AATTTGCAGATGAATGAAAAAGG - Intronic
1148750247 17:49941412-49941434 ATTTTCCAGCTGGAGGAAATGGG + Intergenic
1149702244 17:58664947-58664969 GTTTTCCAGGTAGATGAAGAAGG + Intronic
1149746329 17:59102615-59102637 ATTCTACAGCTGAAGAAAGAAGG + Intronic
1150106156 17:62464223-62464245 CTTGTCCAGGTGAATGGAGAAGG + Intronic
1150378932 17:64705386-64705408 CTTTTCAAACTGAATGAAAAGGG + Intergenic
1150981132 17:70142835-70142857 ACTTTCCAGCTGAATTCAGATGG - Intergenic
1150996825 17:70328317-70328339 TTTCCCCAGCTGAATGAAAATGG + Intergenic
1151137007 17:71956550-71956572 ATTTTCCAGATGAATTAACATGG - Intergenic
1151158463 17:72144254-72144276 ATTTTCCAGCTGACAGGAGATGG - Intergenic
1152487687 17:80605201-80605223 AGTTTTCAGCTGGGTGAAGAAGG + Intronic
1203182998 17_KI270729v1_random:82475-82497 ATATTCCAGCTTCATGAATATGG - Intergenic
1153358030 18:4159706-4159728 ATTTTCCAGTTAATTGAAAAGGG + Intronic
1154520667 18:15226013-15226035 ATATTCCAGCTTCATGAATATGG + Intergenic
1155738622 18:29256566-29256588 ATTTTTCAGCTGCATGTAAAAGG - Intergenic
1156953001 18:42927543-42927565 AATTCACAGGTGAATGAAGACGG - Intronic
1157605963 18:48926142-48926164 ATTCTCCACCTGAAGGCAGAGGG + Intronic
1158381112 18:56931301-56931323 AGATTCTATCTGAATGAAGAAGG - Intronic
1159160767 18:64641422-64641444 ATTTTCCAGCTAAATGACACTGG - Intergenic
1159193765 18:65084565-65084587 ACTTTCTATCTGAATGAAAATGG - Intergenic
1159266840 18:66092123-66092145 ATTTTTCAGCAGAATGGATAGGG - Intergenic
1159755554 18:72359610-72359632 CATTTTCAGCTGAATGAAGTGGG - Intergenic
1159791856 18:72791628-72791650 ATTTACCAGCTGGAAGAAAAGGG + Intronic
1168321467 19:55512842-55512864 ACATCCCAGCTGAATGGAGAAGG + Intronic
1202671117 1_KI270709v1_random:53024-53046 ATATTCCAGCTTTATGAATACGG - Intergenic
1202681471 1_KI270712v1_random:7778-7800 ATATTCCAGCTTCATGAATATGG - Intergenic
925011686 2:490229-490251 ATTTTCCAACTGAACACAGAAGG - Intergenic
925260711 2:2526114-2526136 ATTTTCAGGTTGCATGAAGAAGG - Intergenic
925946558 2:8869448-8869470 ATTTTCCAGTTGATTGGAAAAGG - Intronic
926206196 2:10835671-10835693 ATTTGGCAGCTGAGTGAAGGTGG - Intronic
926932632 2:18055643-18055665 AGTTTCCAGATGAATGAGGATGG - Intronic
927335640 2:21920682-21920704 ATTTTACAGATGAATAAACAAGG - Intergenic
927586199 2:24308005-24308027 AATTTCTTGCTGAGTGAAGAGGG + Intronic
927614455 2:24577647-24577669 AGTTTCCAGCTGACTCAAAAAGG - Intronic
929352502 2:40975263-40975285 ATTTTCCTGCTGAATGAGCACGG + Intergenic
930507172 2:52297866-52297888 ATTATTCAGCTTAATGAAAAGGG + Intergenic
930638255 2:53829229-53829251 ATTTTCCAGGTAAAAGATGATGG + Intergenic
930774081 2:55155440-55155462 ACTATCCAGCTAAATGAACAAGG - Intergenic
931235561 2:60409966-60409988 ATTTTCCAGATGAAGAAGGAAGG + Intergenic
931261856 2:60626975-60626997 ATTTACCTGATGAATGAAGAGGG + Intergenic
933382866 2:81572231-81572253 AATGTCCAGCTGAAGGAAGATGG - Intergenic
933385548 2:81606358-81606380 ATTTACCAACTGACTGGAGATGG - Intergenic
934250297 2:90347229-90347251 ATATTCCAGCTTCATGAATATGG + Intergenic
934259268 2:91456187-91456209 ATATTCCAGCTTCATGAATATGG - Intergenic
934542609 2:95188558-95188580 ATTTTCCAGTTGAATGGAGGTGG + Intergenic
934858737 2:97745981-97746003 ATTATCCAGCTGAAACAAGAGGG + Intergenic
934955726 2:98616744-98616766 ATTTTCTAGCTGCATGACCATGG - Intronic
935352606 2:102166509-102166531 GTTTTCCAACTGATTTAAGAGGG + Intronic
935875612 2:107503779-107503801 ATAATGCAGCTGACTGAAGAGGG - Intergenic
936629223 2:114183015-114183037 ATTTTCCCAAAGAATGAAGAAGG + Intergenic
938504675 2:131866654-131866676 ATATTCCAGCTCAATCAAGCAGG - Intergenic
938520019 2:132059786-132059808 ATATTCCAGCTTCATGAATATGG + Intergenic
939538424 2:143462247-143462269 AATTCCCAGCAGAATGGAGATGG - Intronic
939552633 2:143634661-143634683 ATATTAAAGCAGAATGAAGATGG - Intronic
939981431 2:148786424-148786446 ATATTCCAGCTGAATGCAAAAGG + Exonic
940126681 2:150333816-150333838 ATGTTCCAGCTTAAGGAAGAGGG + Intergenic
940807193 2:158201017-158201039 ATTTCCCACCTGAAGGAACAGGG - Intronic
941008767 2:160274328-160274350 TTTTTCCAGCTGTATGAAATGGG - Exonic
941589438 2:167401260-167401282 GTTATCCTGCTGAAGGAAGAGGG - Intergenic
942182538 2:173394165-173394187 CCTTTCCATCTGAAAGAAGAAGG - Intergenic
943004122 2:182368718-182368740 ATTTTCCAGCTGAGTGAACTTGG + Intronic
943858668 2:192831682-192831704 ATATTCCAACTCAAGGAAGAAGG - Intergenic
943895408 2:193351608-193351630 ATTATCCAGCAGAAAGGAGAAGG + Intergenic
944283077 2:197920866-197920888 ATTTCCCAGCTCAATGAGAAAGG + Intronic
944652864 2:201849089-201849111 ATTTTCTAGCTAAATGAACATGG + Intronic
945212211 2:207395271-207395293 ATCTGCCAGCTGGATGTAGAAGG + Intergenic
945849323 2:214986416-214986438 ATTTCCCAGATGGAGGAAGATGG - Intronic
945954478 2:216073226-216073248 TTTTTCCTGCTGGAAGAAGAGGG - Intronic
946145589 2:217728456-217728478 TTTTTCCTGCTGTTTGAAGAAGG + Intronic
946536439 2:220634913-220634935 ATTTTCCAGTTGAGGAAAGAAGG - Intergenic
946657488 2:221963993-221964015 ATTTTTCAGCTGCATGTAAAAGG + Intergenic
946934636 2:224707486-224707508 CCTTTCCATCTGAATAAAGAAGG - Intergenic
948315373 2:237024567-237024589 ATTCTCCAGCCAACTGAAGATGG - Intergenic
948406360 2:237723041-237723063 TTTTTCTAGCTAAATGAAGAAGG - Intronic
1169104351 20:2981654-2981676 TTTTTCCAGCTGAGTCTAGATGG + Intronic
1170074190 20:12401778-12401800 ATCTTCCAGCAGAAAGAATAGGG - Intergenic
1170119773 20:12899345-12899367 ATTATTCAGCTTTATGAAGAAGG - Intergenic
1170170245 20:13402934-13402956 ATTTTCCTTTTGAAAGAAGAAGG - Intronic
1170877329 20:20262507-20262529 ATTTTCCAGGGGAAAGAAAAAGG + Intronic
1172755723 20:37282888-37282910 CTTTTCCAGTTGAATAACGATGG - Intergenic
1172986516 20:38995820-38995842 GTTTTCCAGATGGATGAAGGTGG + Intronic
1173266997 20:41493135-41493157 ATATTCCAGTTGAGTGAAGAAGG + Intronic
1173376202 20:42485595-42485617 ATTCTCCAGCTGAAAAAAAAAGG - Intronic
1173421275 20:42903336-42903358 ATTTTGCAGCAGAAAGATGATGG - Intronic
1173470083 20:43316698-43316720 ATTTTCCGGCTGAGTAATGAAGG + Intergenic
1174158615 20:48534298-48534320 ATTTTTAAACTGAAAGAAGATGG - Intergenic
1174513825 20:51076029-51076051 ATTTTCCAGATGGAGAAAGAGGG + Intergenic
1174725765 20:52860029-52860051 AATTTGCAGCTGAGTAAAGAAGG + Intergenic
1175751070 20:61498301-61498323 ATTTTCCAGTTAATTGAAAAAGG + Intronic
1176584981 21:8573771-8573793 ATATTCCAGCTTCATGAATATGG - Intergenic
1176776626 21:13140980-13141002 ATATTCCAGCTTCATGAATATGG - Intergenic
1180267790 22:10550673-10550695 ATATTCCAGCTTCATGAATATGG - Intergenic
1180524589 22:16244063-16244085 ATATTCCAGCTTCATGAATATGG - Intergenic
1181330162 22:22084494-22084516 TCTTCCCATCTGAATGAAGAGGG - Intergenic
1182128546 22:27834175-27834197 ATTTTACAGGTGAAAGAAAATGG + Intergenic
1184546014 22:45168791-45168813 CTTTTCCAGCAGAATAAAAATGG + Intronic
1184946057 22:47804946-47804968 ATTTGCCAGCTGGATGCAGAGGG + Intergenic
1203236819 22_KI270732v1_random:10964-10986 ATATTCCAGCTTCATGAATATGG - Intergenic
1203290930 22_KI270735v1_random:38952-38974 ATATTCCAGCTTCATGAATATGG + Intergenic
1203323778 22_KI270737v1_random:96773-96795 ATATTCCAGCTTCATGAATATGG + Intergenic
949516899 3:4815492-4815514 ATTTTACAGATGAAGAAAGAAGG - Intronic
952852924 3:37743973-37743995 GTCATCCAGCTGAATGAAGTTGG - Exonic
953262571 3:41354029-41354051 ATTTGCCAGCTGCATGCAGAGGG - Intronic
955032935 3:55238216-55238238 ATTCTACAGCTGAATAAACAAGG + Intergenic
955837900 3:63077814-63077836 GTTTTCTAGCTGAGAGAAGATGG - Intergenic
956922198 3:73941514-73941536 ATTTTCCAGTTGAATATTGAAGG + Intergenic
956922815 3:73948567-73948589 ATCTTCCAGGTGAAAGATGATGG - Intergenic
957111859 3:75972054-75972076 ATTTTCCATTTCCATGAAGATGG - Intronic
957292837 3:78299092-78299114 AAATTTCAGCTGAATGAAAAGGG - Intergenic
957758773 3:84527084-84527106 TTTATAAAGCTGAATGAAGAGGG + Intergenic
958590099 3:96146085-96146107 ATTTTAAAGTTGAATGCAGAAGG - Intergenic
959052214 3:101535310-101535332 ATTTTTAAGCTGAATAATGATGG + Intergenic
959476155 3:106814647-106814669 GTTTTACAGTTGAATGAGGAAGG - Intergenic
959505299 3:107150648-107150670 TTTTTCCAGATCAATGATGATGG - Intergenic
959850535 3:111081687-111081709 ATTTTCTAGCTGAATCTTGAAGG + Intronic
959929157 3:111959630-111959652 ATGTTTCAGGTGAATGTAGAAGG - Intronic
960424902 3:117494271-117494293 ATTTTACATTTGAATGAAGTGGG + Intergenic
960521673 3:118662334-118662356 ATTTTCCATCTGAAGAAATAGGG - Intergenic
961525158 3:127492111-127492133 ACTTCCCTGCTGAATGAAAAGGG + Intergenic
962467327 3:135672942-135672964 ATCTTCCAGCAGAATTCAGAGGG + Intergenic
963478718 3:145840228-145840250 ATTTTCCAGATGAATTGAGAAGG - Intergenic
964997069 3:162895074-162895096 CTATTCCAGATGATTGAAGAAGG + Intergenic
965905847 3:173705039-173705061 ATTGTAGATCTGAATGAAGATGG - Intronic
965975787 3:174620141-174620163 ATTTTCCAAATGAAAGAGGATGG - Intronic
966796219 3:183716532-183716554 AAATTACAGCTGAATGAGGAGGG - Intronic
967264670 3:187679912-187679934 ACTTTACAGCAGCATGAAGAGGG - Intergenic
967954103 3:194864126-194864148 ATTTTACAGCTAAATCAAGTTGG - Intergenic
969257243 4:6010801-6010823 ATTTTCCAGGGGAAGGACGATGG - Intergenic
973287084 4:48430722-48430744 ATTCAACAGCTGACTGAAGATGG + Intergenic
973821019 4:54661432-54661454 CTCTTCCAGCTGATTAAAGAAGG + Intronic
974218620 4:58934743-58934765 ATATTGCAGCTGAAAGAGGATGG - Intergenic
975180702 4:71340621-71340643 AATATCCAGCTGAAAGTAGAAGG + Intronic
976995481 4:91427095-91427117 GTTTTCCATTTGAATGAAGATGG - Intronic
977283135 4:95067502-95067524 ATTTTCCATCAAAATGAAAATGG + Intronic
977501446 4:97843962-97843984 AATTTCCAACTGAATGAAATTGG + Intronic
977993600 4:103475680-103475702 AATTGTCAGCTGAATCAAGAAGG - Intergenic
978070758 4:104465144-104465166 ATTTTCCAGCTGAGAGAAGGAGG - Intergenic
978320328 4:107486361-107486383 ATTTTTGAGGTGAATGAAAATGG + Intergenic
978796781 4:112715772-112715794 TTTTTCCTACTGAATGAGGAAGG + Intergenic
979585241 4:122407894-122407916 GTTGTCCAGCTGAAAGAAAAAGG - Exonic
980021198 4:127712234-127712256 ATTTTACTGCTGAATGAACCTGG - Intronic
980748345 4:137052748-137052770 GTTTTCCAGATGAAAGAAAAAGG - Intergenic
984096406 4:175440496-175440518 ATTGCCCAGTTGAATGATGATGG + Intergenic
985239955 4:187919614-187919636 ATTTTCCAGGTGAAAGAGAATGG + Intergenic
985612232 5:896701-896723 ATTTTCCAGCTGAATGAAGATGG + Exonic
985993634 5:3584218-3584240 ATTGTGCAGCAGAATGTAGAAGG + Intergenic
986635519 5:9818586-9818608 GTTTGCCTGCTGTATGAAGAGGG - Intergenic
987191315 5:15481278-15481300 ATTTTCCAGCTGAACAAGGAGGG - Intergenic
987579317 5:19768524-19768546 ACTTTCCAGCTGAGTGTTGAAGG + Intronic
988490171 5:31699313-31699335 ATTTTTGAGCTGAATGTTGAAGG + Intronic
988942326 5:36158998-36159020 ATTCACCATTTGAATGAAGAGGG + Intronic
989450399 5:41580467-41580489 ATTCACCAGATGAATAAAGAAGG - Intergenic
990016857 5:51073722-51073744 ATTTACCAGCAGCATGAAAACGG - Intergenic
990674684 5:58170258-58170280 ATTTTTCAGTTGTATGAAAAGGG - Intergenic
992944892 5:81800326-81800348 ATTTTGTAGCTGAAAGCAGATGG + Intergenic
993766435 5:91864225-91864247 CTTTTCCAGGTCAAAGAAGATGG - Intergenic
994525027 5:100895690-100895712 ATCTTCCAGCACAATGTAGAAGG - Exonic
996490068 5:124084270-124084292 ATTTGCCAGCTTAATGCAAATGG + Intergenic
997267323 5:132502440-132502462 ATTGTCCTGGTGAATCAAGATGG - Intergenic
997992378 5:138555790-138555812 ATTTTTCAGCTGCATGTAAAAGG - Exonic
998031461 5:138873289-138873311 AATTACCCGCTGAGTGAAGATGG + Exonic
999959819 5:156742499-156742521 ATTATCCAGGTGGAAGAAGATGG - Intronic
1001194495 5:169659536-169659558 TTTACTCAGCTGAATGAAGAGGG + Intronic
1001360199 5:171076503-171076525 ATTTTCCACTTAAATGAACAAGG + Intronic
1001732322 5:173969457-173969479 ATGTGCCAGCTGACTGCAGAAGG - Intergenic
1001929877 5:175665300-175665322 ATTTTCCAGGTGGCTGGAGAGGG + Intronic
1002084247 5:176761561-176761583 ATTTCCCAGATGACTAAAGAAGG - Intergenic
1003663199 6:8084375-8084397 CTTTGCCAGCAGAATGAATAAGG - Intronic
1004492781 6:16131861-16131883 ATTTTGTTTCTGAATGAAGATGG + Intronic
1004726049 6:18312246-18312268 ATTTGGGAGCTGAATGAACAGGG + Intergenic
1005339109 6:24826816-24826838 ATTTTTCAGTTGAATGTACATGG - Intronic
1005830490 6:29667286-29667308 ACTTCCCATCTGAATGAGGAGGG - Intronic
1005894561 6:30166847-30166869 AATTTCCAGTTGAATAGAGAGGG - Intronic
1006061220 6:31421306-31421328 AATTTCCTGCTGAAAGGAGAGGG + Intergenic
1006766473 6:36510861-36510883 ATTTTCCAGATGAGATAAGATGG - Intronic
1007177132 6:39904611-39904633 ATTCTCCAGGTGAATGGGGAAGG + Exonic
1007967735 6:46017466-46017488 ATTTCCTAGCTGAATGACTAGGG - Intronic
1009426245 6:63516797-63516819 ATATTCTAGCTGTAGGAAGAAGG - Intergenic
1009728451 6:67565301-67565323 ATTTTCCATATAAATGAAGTAGG - Intergenic
1009952534 6:70413632-70413654 GTTGTCCAGCTGCAAGAAGACGG - Exonic
1010121875 6:72385971-72385993 TTAGTCCTGCTGAATGAAGATGG - Intronic
1011285808 6:85721397-85721419 ATCTTCCAGCTCCATGAAAAGGG + Intergenic
1011541855 6:88439255-88439277 ACTTTTCAACTTAATGAAGAAGG + Intergenic
1014968615 6:127787314-127787336 GTTTTCCAGCTAAAGGAAGAAGG - Intronic
1015335094 6:132027795-132027817 ATCTTCCAGCTGCAGGAGGATGG + Intergenic
1015711516 6:136146621-136146643 TTTTTCCACCTGAATTAGGAGGG - Intronic
1016519624 6:144931977-144931999 ATTTTCCTGCTGAAACAAAATGG - Intergenic
1016835688 6:148474462-148474484 ATTTTGCAGCTGCATTCAGAAGG - Intronic
1018583138 6:165325104-165325126 ATCTTCCAGTTAATTGAAGAAGG - Intergenic
1019887324 7:3916781-3916803 ACCTTCCAGCTGATAGAAGAGGG + Intronic
1020567641 7:9817843-9817865 ATTTTCCAGCTGGCTCAAGTGGG + Intergenic
1020765469 7:12314323-12314345 ATTGCTCAGGTGAATGAAGATGG - Intergenic
1020809726 7:12836245-12836267 TTATTCTAGCTGTATGAAGAAGG + Intergenic
1021031686 7:15745017-15745039 ATTTTCTAGCTGAGTGACCATGG + Intergenic
1021242907 7:18226659-18226681 ATATTTCAGCTGAAGGAATAGGG + Intronic
1022309136 7:29178773-29178795 ATTTTTCATATGAATGCAGATGG - Intronic
1023604601 7:41918039-41918061 ATTTTCATGATGATTGAAGACGG - Intergenic
1023815816 7:43949250-43949272 ATATTCCTTCTGAATTAAGATGG + Intronic
1024309544 7:47957137-47957159 ATTTTACAGCTTTATGAAGAAGG - Intronic
1024721401 7:52140879-52140901 ATTTTACAACAGAAAGAAGATGG - Intergenic
1024806116 7:53142830-53142852 ATATTCCAGCTTCATGAATATGG + Intergenic
1025479930 7:60969696-60969718 ATATTCCAGCTTCATGAATATGG - Intergenic
1025483507 7:61016645-61016667 ATATTCCAGCTTCATGAATATGG - Intergenic
1025488988 7:61088139-61088161 ATATTCCAGCTTCATGAATATGG + Intergenic
1025552030 7:62262637-62262659 ATATTCCAGCTTCATGAATATGG + Intergenic
1025557837 7:62331761-62331783 ATATTCCAGCTTCATGAATATGG + Intergenic
1025564844 7:62421022-62421044 ATATTCCAGCTTCATGAATATGG - Intergenic
1025886040 7:65593793-65593815 ATATTCCAGCTTCATGAATATGG + Intergenic
1026995921 7:74616539-74616561 ATTTTCTAGCTTAATGAAAATGG - Intergenic
1027514332 7:79123380-79123402 ATTTACCAGCTGCATGAACTTGG + Intronic
1027715946 7:81669743-81669765 ATCCTACAGCTGAAAGAAGAAGG - Intergenic
1028158552 7:87460021-87460043 TTTTTCCAGATGAAATAAGATGG + Intronic
1028265505 7:88719074-88719096 ATTTACCAGCTGAATGACCCTGG - Intergenic
1029887889 7:103892170-103892192 AATTTCCAACTGATTAAAGAAGG - Intronic
1029945228 7:104525963-104525985 CTCTCCCAACTGAATGAAGAAGG + Intronic
1029982141 7:104888814-104888836 GTTTTCCAGGCGAAGGAAGAGGG + Intronic
1030197783 7:106869105-106869127 ATTGTCCAGAAGAATGGAGATGG - Exonic
1030805041 7:113906869-113906891 ATTTACCAGATGAATGATGTAGG + Intronic
1031378664 7:121058948-121058970 ATTTTAGAGCTTAATGAAAATGG + Intronic
1031641444 7:124169550-124169572 GTTGTACAGCTGCATGAAGACGG + Intergenic
1032035223 7:128516811-128516833 CTTGTCCAGGTGAATGGAGAAGG + Intergenic
1032191166 7:129766782-129766804 GCTTTCCAGCAGAAAGAAGATGG - Intergenic
1033322122 7:140349444-140349466 ATGCTGCAGCTGCATGAAGATGG + Intronic
1033583009 7:142753535-142753557 ATTTTCCAGGTGAATGAGAAGGG - Intronic
1033584556 7:142764457-142764479 ATTTTCCAGGTGAATGAGGAGGG - Intergenic
1033586036 7:142775012-142775034 ATTTTCCAGGCGAATGAGAAGGG - Intergenic
1033705853 7:143884469-143884491 ATTTTTCAGCTAAATGAAGCGGG + Intronic
1033918550 7:146358564-146358586 ATATTCCAGCTGGATTATGAAGG + Intronic
1036059280 8:5296779-5296801 ATTCTGCAGGTGAATGAAAAAGG + Intergenic
1037349577 8:17936395-17936417 ATTTTCCAGTTGGATAAAGTGGG + Intronic
1037797558 8:22009497-22009519 ATTTTCCAGTTGAATTAATTTGG - Intergenic
1038070940 8:24012448-24012470 ATTTTGCAGCAGCATGGAGATGG - Intergenic
1039016084 8:33150498-33150520 ATTTTCCTGATGATTGCAGATGG + Intergenic
1043093363 8:75932312-75932334 AATTTCCATCAGAATGAATAAGG - Intergenic
1043229293 8:77780467-77780489 ATTTTTCAGTTGAATCACGAAGG - Intergenic
1044836176 8:96297729-96297751 TATTTCCAGCTGTATGAAGGTGG - Intronic
1045892089 8:107169307-107169329 ATTTTCCAGCTGGATGGGAAGGG + Intergenic
1046548547 8:115682919-115682941 ATGTTCCAGTGGAATGATGAGGG + Intronic
1047386358 8:124413298-124413320 ATTTTCCTGCTTATTGATGAAGG - Intergenic
1047634870 8:126750317-126750339 ATTTTCCAGCTGAAAAAGCAGGG + Intergenic
1047886327 8:129253960-129253982 CTTGTCCAGCTTAAGGAAGAGGG - Intergenic
1048080584 8:131122247-131122269 ACTTCCCAGTTGAATGAAGTTGG - Intergenic
1049297877 8:141852829-141852851 ATCTTCCTGCTGCATGAAGATGG + Intergenic
1051728900 9:20117869-20117891 ATTTTACAGATGAAGAAAGAGGG + Intergenic
1052755792 9:32539343-32539365 ATTTGGCAGCTGAATGAGGGGGG + Intergenic
1052901776 9:33799673-33799695 ATTTTCCAGGTGAATGAGAAGGG - Intergenic
1053597951 9:39582971-39582993 ATTTTCCAACTGGATTAAAAAGG + Intergenic
1053699304 9:40672620-40672642 ATATTCCAGCTTCATGAATATGG + Intergenic
1053855974 9:42339980-42340002 ATTTTCCAACTGGATTAAAAAGG + Intergenic
1053945318 9:43302853-43302875 ATATTCCAGCTTCATGAATATGG + Intergenic
1054310593 9:63472021-63472043 ATATTCCAGCTTCATGAATATGG + Intergenic
1054409381 9:64796172-64796194 ATATTCCAGCTTCATGAATATGG + Intergenic
1054442548 9:65279986-65280008 ATATTCCAGCTTCATGAATATGG + Intergenic
1054487733 9:65741516-65741538 ATATTCCAGCTTCATGAATATGG - Intergenic
1055031751 9:71777361-71777383 ATTTTCCAGCTCAATAAAGCTGG + Intronic
1056878429 9:90362941-90362963 AATTTCCAGCTGATTGAATAAGG - Intergenic
1057965609 9:99499759-99499781 CTTTGACAGCTGAAAGAAGAAGG + Intergenic
1058192036 9:101929797-101929819 ATTTGCCAGCTGGGTGAGGAGGG + Intergenic
1059754358 9:117278533-117278555 ATTTCTCTCCTGAATGAAGAGGG - Intronic
1060185379 9:121560982-121561004 ATTTTCCAGCTGGATGACCCTGG - Intergenic
1060428581 9:123527207-123527229 ATAATCCAGCAGAAAGAAGATGG - Intronic
1203580848 Un_KI270746v1:2292-2314 ATATTCCAGCTTCATGAATATGG - Intergenic
1203588453 Un_KI270747v1:31431-31453 ATATTCCAGCTTCATGAATATGG + Intergenic
1203614886 Un_KI270749v1:51289-51311 ATATTCCAGCTTCATGAATATGG - Intergenic
1185528789 X:800613-800635 CTTTTCCAGCTGCATGACAAAGG - Intergenic
1185700029 X:2223811-2223833 ATTTTCCAGCTACAAGATGATGG - Intronic
1187167684 X:16820011-16820033 ATTTACCAGCTCAATGAAAAAGG - Intronic
1187347566 X:18480557-18480579 ATGTTCCACCTTATTGAAGATGG + Intronic
1188365774 X:29313022-29313044 ATTTATCAGCAGCATGAAGAAGG + Intronic
1189699914 X:43707804-43707826 ATTTTCCAGATGATTAAAGAAGG + Intronic
1191219045 X:57965903-57965925 ATCTTCCTGGTGAATGATGAAGG - Intergenic
1192917831 X:75673018-75673040 CCTTTGCAGCTGAATAAAGATGG - Intergenic
1195523956 X:105864379-105864401 AATTTCCAGCTCAAACAAGAGGG - Intronic
1196170634 X:112584539-112584561 CTTTTTCAGCTGCATGAAAATGG - Intergenic
1196178876 X:112668929-112668951 AGTTTCCAGCAGAGTGAGGAGGG - Intronic
1196950166 X:120868989-120869011 CTTTTCCACCTCACTGAAGAAGG + Intergenic
1197313608 X:124936507-124936529 GTTTATCAGCTCAATGAAGACGG + Intronic
1197324239 X:125072172-125072194 ATTTTCATGCTGAAACAAGAAGG + Intergenic
1197635629 X:128911866-128911888 AATTTACAACAGAATGAAGAGGG + Intergenic
1199981161 X:152921193-152921215 ATACTCCAGCTGAATGAGGGAGG + Intronic
1200395177 X:155981832-155981854 ATTTTTAAGCTGAATGATGATGG + Intergenic