ID: 985613567

View in Genome Browser
Species Human (GRCh38)
Location 5:905395-905417
Sequence AGGAGTGCCCAGGATCCTCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 250
Summary {0: 1, 1: 0, 2: 1, 3: 25, 4: 223}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985613567_985613571 12 Left 985613567 5:905395-905417 CCATGAGGATCCTGGGCACTCCT 0: 1
1: 0
2: 1
3: 25
4: 223
Right 985613571 5:905430-905452 CTTCATATTTCCTTCCCCTCTGG 0: 1
1: 0
2: 1
3: 29
4: 255

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985613567 Original CRISPR AGGAGTGCCCAGGATCCTCA TGG (reversed) Intronic
900158630 1:1213248-1213270 GGGAGGGCCCAGGAGCCTCGGGG - Intronic
900958573 1:5904774-5904796 AGGACTGCCGAGGAACATCATGG - Exonic
901123909 1:6916013-6916035 AGGCATGCCCAGGAGACTCAGGG - Intronic
902913668 1:19621773-19621795 AGGAGAGCCCAGGATGCTGGAGG + Intronic
903957368 1:27034564-27034586 ATTAGGGCCCAGGGTCCTCAGGG + Intergenic
904454352 1:30638427-30638449 AGGTGTGGCCAGCACCCTCAAGG + Intergenic
905180179 1:36160810-36160832 AGCAGAGCCCAGGGTCCTCTGGG + Intronic
905879673 1:41455451-41455473 AGGAGTTTCCAGGATGCTCAGGG - Intergenic
905884461 1:41484363-41484385 AGAGGTGCCCAGGCTCCCCACGG - Intronic
907063016 1:51450188-51450210 AGGAGTGCCCTGGCTCCTGCAGG - Intronic
908405202 1:63807657-63807679 AGGAGTGCCCAGTCTACACAAGG - Intronic
908951809 1:69569407-69569429 AGGAGGACGCAAGATCCTCAAGG - Intronic
909541377 1:76795506-76795528 AGGAGTTCCAAAGACCCTCAGGG + Intergenic
912591477 1:110824915-110824937 AGGAGACCCCATGACCCTCATGG - Intergenic
915333663 1:155128486-155128508 AAGAGTGCACAGAATGCTCAAGG + Intronic
915890546 1:159769312-159769334 TGGAGTGCCCAGGATACGCTAGG - Intergenic
916806637 1:168266761-168266783 AGAAGTGCCCAGCATGCACACGG - Intergenic
921546676 1:216482304-216482326 AGCAGTGCCCTGCAACCTCAGGG + Intergenic
1063366510 10:5494071-5494093 AGGAGGGCCCAGGAGACTAAAGG - Intergenic
1069859131 10:71459620-71459642 AGGTGGGCCCAGGAGCCTCTAGG - Intronic
1069900761 10:71705432-71705454 AGCAGGGCCCGGGACCCTCAGGG + Intronic
1072629973 10:97139098-97139120 AGCAGAGCCCAGGGTCCCCACGG + Intronic
1074373116 10:112916632-112916654 AAGAGTGCCCAGGAACCTGCAGG - Intergenic
1075003400 10:118814023-118814045 AGCAGGGACCAGGTTCCTCAGGG - Intergenic
1075483685 10:122802638-122802660 AGATGAGCCCAGCATCCTCATGG - Intergenic
1075865222 10:125712876-125712898 ACGAGTGCCCAGGGTACTCACGG - Intergenic
1076553526 10:131304858-131304880 GTCAGTCCCCAGGATCCTCACGG - Intronic
1078576025 11:12503472-12503494 AGCAGTTGTCAGGATCCTCATGG + Intronic
1079892375 11:26072558-26072580 AGAAATGCACAGGATCCTGATGG - Intergenic
1081689930 11:45071005-45071027 AGGAGGGCCCTGGATGCCCAGGG - Intergenic
1083141242 11:60723451-60723473 AGGAGTGGCCAAGATGCCCACGG - Intergenic
1083200648 11:61119171-61119193 AGGAGTGCCCAGGAAGCCCTCGG + Intronic
1084691806 11:70731953-70731975 AGGAGTGGCCAGGAGCATCCAGG - Intronic
1084933931 11:72576978-72577000 TGGGGTCTCCAGGATCCTCATGG - Exonic
1085526517 11:77167235-77167257 AGGCTTGCCCAGGGTCCTCTGGG + Intronic
1088022366 11:105135059-105135081 AGAAGTGCCCAAAGTCCTCATGG + Intergenic
1089061060 11:115626500-115626522 AAGAGAGCCCTGAATCCTCATGG + Intergenic
1089330667 11:117686736-117686758 AGGGGTTCTCAGGACCCTCAGGG + Intronic
1090376599 11:126293930-126293952 GGGAGTCCCCAGCTTCCTCATGG - Intronic
1090474282 11:127005238-127005260 AGGTGTGCCCAGGTTCATTAAGG - Intergenic
1091148759 11:133305719-133305741 AGGAGGTCCCAGGATGCTCTGGG - Intronic
1093481892 12:19612547-19612569 AGGAGAGCCCACGACCCTCGTGG - Intronic
1094286572 12:28800918-28800940 AGCAGATCACAGGATCCTCAGGG - Intergenic
1094443636 12:30506612-30506634 AGGAGAGGCCAGGCTCCTCCCGG - Intergenic
1094847025 12:34365808-34365830 AGGGATGCCCAGGATCCACTGGG + Intergenic
1094853324 12:34392045-34392067 AGGGATGCCCAGAATCCTCTGGG - Intergenic
1094854586 12:34397276-34397298 AGGGATGCCCAGGTTCCCCAGGG - Intergenic
1094871283 12:34600523-34600545 AGGGATGCCCAGGATCCTCTGGG - Intergenic
1094872627 12:34606703-34606725 AGATATGCCCAGGATCCCCAGGG - Intergenic
1096618776 12:52849379-52849401 CAGAGTGCCCTGGATTCTCAAGG + Intergenic
1099040247 12:77644443-77644465 AGGAGTGCACAGAATTATCAGGG + Intergenic
1101471347 12:104999721-104999743 AGGAGACCCCAGGACCCCCATGG - Intronic
1101735063 12:107457181-107457203 AGGTTTGCCCAGGATTATCAAGG - Intronic
1102486624 12:113262679-113262701 AGGAATGATCAGGATCCTTAGGG - Intronic
1103452410 12:121038693-121038715 AGGGGTCCCCAGCATCCCCAGGG + Intronic
1103567759 12:121825411-121825433 ATGAGTGCCCTGGATCCCCGTGG - Intronic
1104065832 12:125305049-125305071 AGGAGTGCCCAACCTCCCCAGGG - Intronic
1104756119 12:131270355-131270377 TGGGGTGCCCAGACTCCTCAGGG - Intergenic
1104777657 12:131400670-131400692 TGGGGTGCCCAGACTCCTCAGGG + Intergenic
1105998131 13:25692589-25692611 AGGAGTACCCAGGATTCAAAAGG - Intronic
1107170673 13:37339383-37339405 ATGATTGGCCAGTATCCTCAAGG + Intergenic
1108573995 13:51776424-51776446 TGGAGTCCCAAGGGTCCTCATGG - Intronic
1110187850 13:72695515-72695537 AGGAATGCCCACAATCCTCAGGG - Intergenic
1113906286 13:113820796-113820818 AGGAGCCCCCAGGCTCCTCCCGG + Exonic
1118002415 14:61536111-61536133 AGATGTGGCCAGGATCCACAGGG - Intronic
1118895906 14:69945286-69945308 AGGAGTGCCAAGGAAGCTAATGG + Intronic
1119159713 14:72442784-72442806 AGGAGTGGCCAGGAGGCACACGG - Intronic
1119331243 14:73795595-73795617 AGGAATGCCCAGCAACCTCTTGG - Intergenic
1119645713 14:76346783-76346805 AGGTGTGCCCAGGATCCACCAGG + Intronic
1121597848 14:95179515-95179537 AGGAGTGCCCAGGCTGCGGATGG + Intergenic
1122268831 14:100559209-100559231 AGGGGTGCCCAGGAGCCTCCTGG - Intronic
1123698118 15:22894027-22894049 AGCAGTGCCCAGGAATCTCTGGG - Intronic
1125912833 15:43457071-43457093 AAGATAGCCCAAGATCCTCAGGG + Exonic
1127383834 15:58451667-58451689 AGGACTGATCAGGATCCACATGG + Intronic
1128328145 15:66738437-66738459 AGGAGTGTCAACGATCCTCCAGG + Intronic
1128806788 15:70536909-70536931 AGGTGTGGCCAGGATCTTTAGGG + Intergenic
1129075322 15:72990263-72990285 AGTAGTCCCCATTATCCTCAAGG - Intergenic
1129116038 15:73365955-73365977 AGCTCGGCCCAGGATCCTCAGGG + Intronic
1131116996 15:89801874-89801896 GGGGGTGCCCAGGATGCCCATGG + Intronic
1133447412 16:5874016-5874038 ACCAGGGCCCAGCATCCTCATGG + Intergenic
1133946785 16:10355535-10355557 AGAAGTGCCCAGCATCCTTCGGG - Intronic
1134302043 16:13000632-13000654 AGGGGTCCCCAGGAGCCTGATGG + Intronic
1134561632 16:15215198-15215220 AGCAGGGCCCAGGTTCCCCACGG - Intergenic
1134564362 16:15238239-15238261 CTGAGTGGCCAGGATGCTCAGGG + Intergenic
1134738133 16:16518460-16518482 CTGAGTGGCCAGGATGCTCAGGG - Intergenic
1134922170 16:18126824-18126846 AGCAGGGCCCAGGTTCCCCACGG - Intergenic
1134929367 16:18193703-18193725 CTGAGTGGCCAGGATGCTCAGGG + Intergenic
1136872113 16:33816777-33816799 AGGAATGCCCAGGACCATTAGGG + Intergenic
1137376036 16:47952591-47952613 AGGGGAGGCCAGGGTCCTCAAGG + Intergenic
1138355056 16:56371036-56371058 AGCAGTGCCCAGGGCCCCCAGGG + Intronic
1138414748 16:56865196-56865218 GGGAGGGGCCAGGATCCGCAAGG - Exonic
1142319238 16:89370405-89370427 AGGAGGGCTCAGGATCCTGTAGG - Intronic
1203100059 16_KI270728v1_random:1299291-1299313 AGGAATGCCCAGGACCATTAGGG - Intergenic
1143090774 17:4448124-4448146 AGGAGGGCCCAGGAAGCTCAGGG - Intronic
1143147648 17:4786975-4786997 AGGAGTGTCCCGGATTCTCAAGG - Intergenic
1144623343 17:16832088-16832110 GGGAGTGGCCAGGATCATCCAGG - Intergenic
1145149142 17:20503758-20503780 GGGAGTGGCCAGGATCATCCAGG - Intergenic
1146907087 17:36624733-36624755 AGAAGAGCCCAGGACCCCCAGGG - Intergenic
1148459566 17:47831434-47831456 AGGAGTGGCCCAGGTCCTCACGG - Intronic
1148687734 17:49509926-49509948 AGGAGTGACTAGGGTCATCAAGG + Intronic
1150472113 17:65446303-65446325 AGAAGTGCCCAGGCAGCTCAGGG + Intergenic
1151141088 17:71992938-71992960 AGGAGACCCCATGACCCTCATGG + Intergenic
1152291829 17:79444211-79444233 AGGTTTGCCCAGCACCCTCAGGG + Intronic
1153219958 18:2852927-2852949 AGGAGGGCTCTGGATCCTCCGGG + Intronic
1154400743 18:14034565-14034587 AGGAGACCCCATGACCCTCATGG + Intergenic
1156680115 18:39578241-39578263 AGAAGTTACCAGGATCCACAAGG + Intergenic
1157158181 18:45287905-45287927 AGGACTGTCCAGTATCCTCTGGG - Intronic
1157407311 18:47432968-47432990 AGGGGATGCCAGGATCCTCAGGG + Intergenic
1158867586 18:61652703-61652725 AGGAGTGAGCAGGAGCCCCATGG - Intergenic
1159422960 18:68247154-68247176 TGAAGTGCCCAGCACCCTCAGGG + Intergenic
1161076762 19:2289658-2289680 CAGAGACCCCAGGATCCTCAGGG - Intronic
1161786672 19:6330831-6330853 ATGAGACTCCAGGATCCTCACGG - Intronic
1162096399 19:8312316-8312338 AGGACCTCCCAGGAGCCTCAAGG + Intronic
1163742384 19:19023522-19023544 AGGAATCCCCAGGCTCCTGAGGG - Intronic
1164675556 19:30098111-30098133 AGGAGGGGCCAGCACCCTCAGGG + Intergenic
1165176472 19:33934190-33934212 AGGTGTGTCCAGGAGCCACAGGG + Intergenic
1166948374 19:46411253-46411275 AGGAGAGGCCAGGAACCTCAGGG - Exonic
1167697679 19:51024762-51024784 GGGAGAGACCAGGATCATCAAGG - Exonic
1168363389 19:55762721-55762743 AGGGGTGCCCAGGACGCACAGGG - Exonic
1168364344 19:55772725-55772747 AGGGGTGCCCAGGACGCACAGGG - Exonic
1168364960 19:55778471-55778493 AGGGGTGCCCAGGACGCACAGGG - Intergenic
927639545 2:24838086-24838108 AGGAGTGACGTGGATGCTCAGGG - Intronic
931009088 2:57886904-57886926 TGCACTGCCCAGAATCCTCATGG + Intergenic
933184076 2:79259573-79259595 AGGAACGCCCAGGATCCTGCAGG + Intronic
935152141 2:100447439-100447461 AGGAGAGCCCAGGATCGTGCTGG + Intergenic
938686999 2:133748161-133748183 AGGAGTGTCCGGGATGCTAAAGG - Intergenic
939882523 2:147646491-147646513 AGGACTGCCTGGGGTCCTCAGGG + Intergenic
942726438 2:179013206-179013228 AGGAGTCCCTAGGATTTTCAAGG - Intronic
942811178 2:180002915-180002937 ATGAGTACACTGGATCCTCAAGG + Intronic
943453647 2:188075792-188075814 AGGAGACCCCAGGACCCCCAAGG - Intergenic
945304337 2:208244478-208244500 AGGAGTGCTCAGTATCCTCCAGG - Intronic
946386078 2:219385366-219385388 AGGGGTGGCCAGGATCCTGGAGG + Intronic
947577715 2:231289696-231289718 AGCAGTGCCCAGGCTCCTGCGGG - Intronic
948613720 2:239185161-239185183 AGGAGTGCCCAGTGTCTTCTGGG + Intronic
948710100 2:239820017-239820039 AGGGGTGCCCAGGGTCTGCAGGG + Intergenic
948764766 2:240213657-240213679 AGGAGCCCCCAGGATCCCCCCGG - Intergenic
1170892917 20:20391359-20391381 GGAAGGGCCCAGGATACTCACGG - Intronic
1170900045 20:20453676-20453698 AGCAGTGCACAGTTTCCTCATGG - Intronic
1175935403 20:62511641-62511663 AGGGGTGTCCGGGATCCTCTGGG + Intergenic
1176679878 21:9813713-9813735 AGCAGAACCCCGGATCCTCAGGG - Intergenic
1176680165 21:9815122-9815144 AGCAGAACCCCGGATCCTCAGGG - Intergenic
1176680448 21:9816531-9816553 AGCAGAACCCCGGATCCTCAGGG - Intergenic
1176680731 21:9817940-9817962 AGCAGAACCCCGGATCCTCAGGG - Intergenic
1176681582 21:9822171-9822193 AGCAGAACCCCGGATCCTCAGGG - Intergenic
1176681866 21:9823580-9823602 AGCAGAACCCCGGATCCTCAGGG - Intergenic
1179937738 21:44615876-44615898 AGCAGTGTCCAGAATGCTCAGGG - Intronic
1181048293 22:20226939-20226961 TGGAGTGGCCAGGAACATCATGG - Intergenic
1182297584 22:29318732-29318754 AGGAGTGCCCAGGAGGCCCCTGG - Intronic
1183077681 22:35437105-35437127 AGGAGAGCCCAGCATCCTCCTGG - Intergenic
1183592030 22:38784858-38784880 AAGAGTGCCCAGAAAGCTCAAGG - Intronic
1184187924 22:42877056-42877078 AGGAGTTGCCAGGACCCTCACGG - Intronic
1184444329 22:44538637-44538659 CGGAGTGCCCAGAAGCCTCCGGG - Intergenic
1184841433 22:47054619-47054641 ATGAGTGCCCAGGATTCGAAGGG - Intronic
1185315121 22:50175649-50175671 CAGAGTCCCCAGGACCCTCAGGG + Intronic
953246661 3:41199664-41199686 AGGAGCGCCCAAGCACCTCAGGG - Exonic
953691598 3:45124496-45124518 AGGAGTGCCCAGGATGCCAAGGG + Intronic
954337188 3:49926199-49926221 AAGAGTGCCCAGGAGGCTTAAGG - Intronic
954379199 3:50210739-50210761 AGGAGGGGCCAGGAGCCACAGGG - Intronic
954413845 3:50383300-50383322 GGGAATTCCCAGGGTCCTCAGGG - Intronic
955163431 3:56487449-56487471 GGGAGTGCACAGGATCCTCATGG - Intergenic
955444662 3:58996931-58996953 AGGAGGGGCCAGGCTCCTCCCGG - Intronic
960594847 3:119398837-119398859 AAGAATGCCCTGGAGCCTCATGG + Intronic
961353692 3:126320688-126320710 AGAAGGGCCCAGCATCCACAGGG - Intergenic
962943759 3:140148994-140149016 AGGATTGCCCAGCAGGCTCAAGG - Intronic
963575599 3:147058277-147058299 AGAATTGCCCAGGATCATGATGG - Intergenic
968309661 3:197673108-197673130 AGAAGTGCCCAGGTCCTTCAGGG - Intronic
969494684 4:7519881-7519903 AGGGGAGCCCAGGATCCTGTGGG - Intronic
969523518 4:7692531-7692553 AGGAGTGCCCAGTGTCCCCTTGG - Intronic
971382470 4:26111373-26111395 AGAAATGCCCAGCACCCTCATGG + Intergenic
972956219 4:44395489-44395511 GGGTGTTCCCAGAATCCTCATGG - Intronic
975222720 4:71832220-71832242 AGGAGGGGCCAGGCTCCTCCCGG - Intergenic
976375296 4:84339076-84339098 AGGAGACCTCATGATCCTCATGG - Intergenic
978940382 4:114429271-114429293 AGGAGTGGCCATGATCTCCATGG - Intergenic
985563244 5:602446-602468 AGGAAGGCCCAGGGTCCTCAGGG - Intergenic
985613567 5:905395-905417 AGGAGTGCCCAGGATCCTCATGG - Intronic
989996324 5:50836637-50836659 AGGAGCCCCCAGGATCCTCTTGG - Intronic
992750661 5:79857649-79857671 AGGAGCTCCCAGGATGATCAAGG - Intergenic
993300528 5:86203904-86203926 AGGAGAGCCCAGAAGCCTGATGG - Intergenic
994197506 5:96936217-96936239 ACGACTGCCCACGACCCTCAGGG - Intronic
998149546 5:139748945-139748967 AGAAGTCCCGAGGATCCGCAGGG - Intergenic
998503328 5:142652559-142652581 AGAAGGGCCCAGGAGCCCCATGG + Intronic
999229139 5:150051395-150051417 TGGAGTCCCCAGCATGCTCATGG - Intronic
1000572855 5:162936172-162936194 AGAAAGGCCCAAGATCCTCACGG - Intergenic
1001268687 5:170294512-170294534 AGAAGAACCTAGGATCCTCAAGG - Intronic
1002068884 5:176666737-176666759 AGGCGTGCCCTGGACTCTCACGG + Intergenic
1003633389 6:7808997-7809019 ACATGTGCTCAGGATCCTCAAGG - Intronic
1007704234 6:43781318-43781340 GGAAGTGCCCTGGCTCCTCACGG + Intronic
1009355542 6:62740065-62740087 AGGAGACTCCTGGATCCTCATGG + Intergenic
1010669735 6:78673992-78674014 AGGAGGGGCCAGGCTCCTCCTGG + Intergenic
1011206744 6:84907056-84907078 AGGAGGGCCCAGGGTGCTTAGGG + Intergenic
1011969191 6:93199719-93199741 GGGAGTCCTCGGGATCCTCACGG + Intergenic
1014162422 6:118185584-118185606 AGGAGTGCCTACACTCCTCAGGG - Intronic
1015868671 6:137753811-137753833 GGAAGTGCACAGGATCCTCAGGG + Intergenic
1019020877 6:168916705-168916727 AGGAGTCCCCCAGCTCCTCAGGG - Intergenic
1019333399 7:471343-471365 AGGGGTGCACAGGATCCTGGCGG - Intergenic
1019556198 7:1632750-1632772 AGGACTGCCCAGGGTCCCCACGG - Intergenic
1022505426 7:30906355-30906377 AGTAGGGCCCAGCCTCCTCAGGG + Intergenic
1023302662 7:38790720-38790742 AGAGGAGCCCAGGATCCACAGGG + Intronic
1023456886 7:40349251-40349273 AGGAGTGTGCAGGCTCATCAGGG + Intronic
1026462219 7:70624597-70624619 AGGAGGGCCCAGGGACCTCCTGG + Intronic
1032076272 7:128837602-128837624 AGCAGAGCCCAGGTTACTCAGGG - Intronic
1032500437 7:132395783-132395805 AGGAATGACCAGGATCCCCATGG + Intronic
1033026678 7:137781229-137781251 AGGTGTGGCCAGGAGCCTAAGGG + Intronic
1035604616 8:921610-921632 AGGAGTTTCCAGGGTCCTCCAGG - Intergenic
1038715346 8:29986396-29986418 AGGAGTGCCCAAGATCCTATGGG - Intergenic
1039332963 8:36559446-36559468 AGGGGAGCCCCGGGTCCTCAAGG - Intergenic
1039351901 8:36772466-36772488 AAAAGTGCCCTGGATCCTCTAGG - Intergenic
1039496549 8:37985073-37985095 AAGGGTGCCCAGGTTCCTCAGGG + Intergenic
1039902591 8:41763940-41763962 AGGACTCTGCAGGATCCTCAGGG + Intronic
1041541259 8:58987756-58987778 AGGACTGACCAGGATCCTGCTGG - Intronic
1042097639 8:65234964-65234986 AGCAGTCCCCTGGATGCTCATGG + Intergenic
1043841704 8:85112701-85112723 ACCAGAGCCCAGGAACCTCAGGG + Intronic
1045315751 8:101042019-101042041 AGCAGAGCCCAGGAACGTCAGGG + Intergenic
1045579117 8:103459218-103459240 AGGAGTGCCTAGGAATGTCATGG - Intergenic
1046715059 8:117558264-117558286 AGGAGCCCCCAGAATCCTCAGGG - Intergenic
1046807066 8:118490670-118490692 AGGTGTGACCAGCATCTTCAAGG + Intronic
1047595648 8:126375151-126375173 AGGAGTGCCCCGGAGCTTCAGGG + Intergenic
1048135026 8:131740076-131740098 AGGAGAGCCCAGGAGGCTGAGGG + Intergenic
1048484871 8:134837949-134837971 AGGAGAGCCCACCATCTTCAGGG - Intergenic
1048811513 8:138290995-138291017 ATGAGTGACCAGGAGGCTCAGGG + Intronic
1049423218 8:142525930-142525952 GGGAGACCCCAGGATGCTCAGGG + Intronic
1053174216 9:35910551-35910573 TCAAGGGCCCAGGATCCTCAGGG + Intergenic
1055142826 9:72895704-72895726 AGCAGAGACCAAGATCCTCAAGG + Intergenic
1055338035 9:75252636-75252658 AGGAGACCCCAAGACCCTCAAGG + Intergenic
1055356794 9:75446010-75446032 AGGAGTGTCCTGGCTCATCAAGG + Intergenic
1056889824 9:90480751-90480773 AGGAGAGCCCAGGCTCCTCCCGG - Intergenic
1057412142 9:94826256-94826278 AGGAGTGCACAGCAGCCTCTTGG + Intronic
1057654094 9:96938538-96938560 ACGGCTGCCCAGGACCCTCAGGG + Exonic
1058731724 9:107856808-107856830 AGGAGGGGCCAGGCTCCTCCTGG + Intergenic
1059132086 9:111763748-111763770 AGAAGTGAACAGAATCCTCAGGG + Intronic
1061428339 9:130515390-130515412 AGTGGAGCCGAGGATCCTCAAGG + Intergenic
1061665160 9:132156386-132156408 AGAAGAGCCCAGGCTCCTCCAGG - Intergenic
1203665045 Un_KI270754v1:16247-16269 AGCAGAACCCCGGATCCTCAGGG - Intergenic
1203665889 Un_KI270754v1:20474-20496 AGCAGAACCCCGGATCCTCAGGG - Intergenic
1203666181 Un_KI270754v1:21883-21905 AGCAGAACCCCGGATCCTCAGGG - Intergenic
1203667038 Un_KI270754v1:26113-26135 AGCAGAACCCCGGATCCTCAGGG - Intergenic
1203667330 Un_KI270754v1:27522-27544 AGCAGAACCCCGGATCCTCAGGG - Intergenic
1203668186 Un_KI270754v1:31752-31774 AGCAGAACCCCGGATCCTCAGGG - Intergenic
1203668478 Un_KI270754v1:33161-33183 AGCAGAACCCCGGATCCTCAGGG - Intergenic
1203669044 Un_KI270754v1:35978-36000 AGCAGAACCCCGGATCCTCAGGG - Intergenic
1203669322 Un_KI270754v1:37387-37409 AGCAGAACCCCGGATCCTCAGGG - Intergenic
1186204268 X:7184879-7184901 AGAAGTGCCCAGGGTACTGATGG - Intergenic
1191177276 X:57517346-57517368 AGGAAACCCCAGGATCCTCATGG - Intergenic
1194310637 X:92301530-92301552 AGGAGACCCCATGATCCCCATGG - Intronic
1194519646 X:94902362-94902384 AGGAGAGTCCATGATCCTCAAGG - Intergenic
1194984527 X:100476281-100476303 AGGAGTGCCAAGTATTCTCCTGG + Intergenic
1196261744 X:113590977-113590999 AGGATTTTCCAGGATCATCATGG + Intergenic
1198703305 X:139419949-139419971 AGCAGTGACCCTGATCCTCAGGG + Intergenic
1199639856 X:149849265-149849287 AGGATAGCCGAGGAGCCTCAAGG + Intergenic
1200618918 Y:5415816-5415838 AGGAGACCCCATGATCCCCATGG - Intronic