ID: 985613863

View in Genome Browser
Species Human (GRCh38)
Location 5:907729-907751
Sequence TGCCCGGGGCGGCACAGTGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 124
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 114}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985613863_985613877 27 Left 985613863 5:907729-907751 CCCTCACTGTGCCGCCCCGGGCA 0: 1
1: 0
2: 0
3: 9
4: 114
Right 985613877 5:907779-907801 CCCTGGCATTCAAAGCAGAGGGG 0: 1
1: 0
2: 1
3: 24
4: 219
985613863_985613875 26 Left 985613863 5:907729-907751 CCCTCACTGTGCCGCCCCGGGCA 0: 1
1: 0
2: 0
3: 9
4: 114
Right 985613875 5:907778-907800 ACCCTGGCATTCAAAGCAGAGGG 0: 1
1: 0
2: 0
3: 15
4: 213
985613863_985613874 25 Left 985613863 5:907729-907751 CCCTCACTGTGCCGCCCCGGGCA 0: 1
1: 0
2: 0
3: 9
4: 114
Right 985613874 5:907777-907799 CACCCTGGCATTCAAAGCAGAGG 0: 1
1: 0
2: 1
3: 12
4: 183
985613863_985613872 -4 Left 985613863 5:907729-907751 CCCTCACTGTGCCGCCCCGGGCA 0: 1
1: 0
2: 0
3: 9
4: 114
Right 985613872 5:907748-907770 GGCAGGTCAGGTGTGGTCTCAGG 0: 1
1: 0
2: 3
3: 55
4: 860
985613863_985613873 10 Left 985613863 5:907729-907751 CCCTCACTGTGCCGCCCCGGGCA 0: 1
1: 0
2: 0
3: 9
4: 114
Right 985613873 5:907762-907784 GGTCTCAGGTCTCAGCACCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985613863 Original CRISPR TGCCCGGGGCGGCACAGTGA GGG (reversed) Intronic
900351806 1:2238547-2238569 AGCCCGGGGCCCCAGAGTGAGGG + Intronic
900706198 1:4081924-4081946 TGCCCGTTGGGGCAGAGTGAGGG + Intergenic
902359559 1:15935009-15935031 CACCCAGGGAGGCACAGTGAAGG + Exonic
903275322 1:22217944-22217966 TGCCCGTGGCCGCACTGTGTGGG - Intergenic
904587567 1:31588652-31588674 TGCCCGGGGGGACGCAGTGGAGG - Intergenic
904603885 1:31688687-31688709 AGCCTGGGGCAGCACAGGGACGG + Intronic
907554663 1:55333835-55333857 GGCCTGGGTGGGCACAGTGATGG + Intergenic
910145711 1:84078018-84078040 TGCCCGGGGGCGCGCAGAGAGGG + Intergenic
920845174 1:209587678-209587700 TGCCTGGGGCTGCACAGCTACGG + Intronic
922613473 1:226946474-226946496 TGTCTGGGGCTCCACAGTGAAGG + Intronic
922677466 1:227561506-227561528 TGCCCGGGGCGGGGCGGGGAGGG + Intergenic
1063344478 10:5298293-5298315 TCCCAGGAGCTGCACAGTGAAGG + Intergenic
1069892706 10:71661980-71662002 AGCCCAGGGCTGCACCGTGATGG - Intronic
1070289818 10:75106917-75106939 TGCCCAGGGTCACACAGTGAGGG + Intronic
1074121719 10:110498283-110498305 GGCCCGGGGCGGCGCGGTGTCGG + Exonic
1076312406 10:129517779-129517801 TTCCCGTGGGGTCACAGTGAGGG - Intronic
1078139545 11:8682402-8682424 TGCGCGGGGCGGCTCAGGGCTGG + Exonic
1080238633 11:30100719-30100741 TGCCCTGGGCAGCATTGTGAAGG - Intergenic
1081760849 11:45575575-45575597 TGCCCGGCTCGGCTCAGCGAGGG - Intergenic
1088920487 11:114257144-114257166 TGCCAGGGGTGGCACTGGGAGGG + Intergenic
1092280807 12:7096492-7096514 TGCCCGTGGCCACCCAGTGATGG + Exonic
1097019117 12:56007617-56007639 TGGCCCGGGCGGCCCAGTGCGGG - Intergenic
1101873064 12:108581508-108581530 TGCCCCAGGCGGCACAGCCAGGG + Intergenic
1102182300 12:110921769-110921791 TGCCCAGGGTCACACAGTGATGG + Intergenic
1104162252 12:126191741-126191763 TGGCCGGGTCTGCCCAGTGAGGG - Intergenic
1104265600 12:127229675-127229697 TGTCCAGGGCAGCACAGTGGGGG + Intergenic
1104850583 12:131871671-131871693 TGCCTGGGGAGGATCAGTGAAGG + Intergenic
1105441133 13:20416055-20416077 AGGCCGGGGCGCCGCAGTGACGG - Intronic
1106037022 13:26052134-26052156 TGCCCGGGGTAGGAAAGTGAGGG - Intergenic
1118331172 14:64817178-64817200 TGCCCCGGGCCACACAGTGCAGG + Intronic
1118473266 14:66094297-66094319 TGCCCTGGGAGCCGCAGTGATGG - Intergenic
1122308437 14:100779883-100779905 CGCCCAGAGCGGCACAGTGCAGG - Intergenic
1122938150 14:104969386-104969408 GGCCCAGGCAGGCACAGTGAGGG - Intronic
1122974969 14:105167351-105167373 GGCCCGGGGCGGCTCAGTCAGGG + Intronic
1129167509 15:73787136-73787158 TTCCATGGGCTGCACAGTGAGGG - Intergenic
1129660431 15:77550096-77550118 TGCCCAAGGTTGCACAGTGAGGG + Intergenic
1132478544 16:154245-154267 GGGCGGGGGCGGCTCAGTGAGGG - Intronic
1132583040 16:694079-694101 TGCCCGGGGCGGGGCTGGGAGGG + Exonic
1133300439 16:4779254-4779276 AGGTCGGGGAGGCACAGTGAAGG - Intronic
1134078294 16:11307817-11307839 AGCCAGGTGTGGCACAGTGAGGG + Intronic
1135141156 16:19923279-19923301 GGCCCAGGGCTGCCCAGTGAGGG - Intergenic
1138586944 16:57976684-57976706 TGCCTGGGGAGGGACAGGGAGGG - Intronic
1141317637 16:82977279-82977301 AGCCCTGGGAGGCACAGTGAGGG + Intronic
1141754645 16:85983179-85983201 TGCCTGAGGCCACACAGTGATGG + Intergenic
1142112530 16:88339911-88339933 TTCACGGGGTGGCACAGTGTTGG + Intergenic
1145908572 17:28529547-28529569 TTTCCGGGGAGGCACAGGGAAGG - Intronic
1147980488 17:44271051-44271073 TGCCCCGGGCTGGACAGAGATGG + Intergenic
1149993528 17:61395736-61395758 TCCCCGGAGCAGCACGGTGACGG - Intergenic
1151596311 17:75079882-75079904 TGCCCTGGGCCCCACAGTGGGGG + Intergenic
1152109163 17:78347815-78347837 TGCTGGGGGAGGGACAGTGAGGG - Intergenic
1157604541 18:48917623-48917645 TGCCCGCTGCGGCACATTGAAGG + Intergenic
1159493932 18:69176056-69176078 GGCCCAGGGCAGCACTGTGAAGG - Intergenic
1160449043 18:78949435-78949457 TCCCCGGAGCGGCACTGTGCCGG + Intergenic
1160538948 18:79610212-79610234 TGCCTGGGGTGGCTCAGTGGCGG - Intergenic
1160853449 19:1205750-1205772 TGTCCGCGGCGGCGCAGGGAGGG + Intronic
1162016999 19:7851398-7851420 AGGCCGGGTGGGCACAGTGAGGG - Intronic
1162034590 19:7932199-7932221 TGCCAGGGACAGCACCGTGAGGG + Intronic
1163008914 19:14412745-14412767 TGACCGGGGGCCCACAGTGAGGG + Intronic
1165060345 19:33202067-33202089 TGCCTGGGGCCACACAGTTAGGG - Intronic
1165454689 19:35903793-35903815 TGCCAGGAGCGGCAGAGAGAGGG - Exonic
1166372946 19:42312602-42312624 TGCCCATGGAGGCACAGAGAGGG - Intergenic
1166417549 19:42607083-42607105 TGCACGGGGCCGCACACTCAGGG + Intronic
1167749695 19:51372199-51372221 TGGCCTGGGGGGAACAGTGAGGG + Exonic
925379815 2:3416923-3416945 TGCCCAGCAGGGCACAGTGAAGG - Intronic
936077289 2:109409664-109409686 TGGCCGGGGAGCCCCAGTGAGGG - Intronic
937301186 2:120843363-120843385 TGCCTGGGTAGCCACAGTGATGG - Intronic
938669515 2:133573567-133573589 AGCCCAGGGAGGCACAGTGAGGG + Intergenic
947835247 2:233170386-233170408 TGACCCGGGCTGCAGAGTGATGG - Intronic
1170004019 20:11646557-11646579 TGCCCTGGGGGCCACTGTGATGG + Intergenic
1170367289 20:15611663-15611685 TGCCGAGGGGGTCACAGTGAGGG - Intronic
1170524781 20:17226879-17226901 GGCCCGGGGCGGCCCAGGGCGGG + Intronic
1171411091 20:24949480-24949502 TGCCCGGGTAGGGACAGTGCGGG - Exonic
1172223519 20:33289425-33289447 TGTCTGGGGTGGCACAGGGAAGG + Intronic
1174019980 20:47522344-47522366 TGCCCGCGTCGGCAAAGTGCTGG + Intronic
1179891914 21:44339488-44339510 TCCCCGAGTCGGCCCAGTGAGGG + Intergenic
1180154383 21:45971024-45971046 AGGCTGGGGCTGCACAGTGAGGG - Intergenic
1180853351 22:19032353-19032375 AGCCCCGGGCGGCAGAGGGAGGG + Intergenic
1181219609 22:21358458-21358480 AGCCCTGGGCGGCAGAGGGAGGG - Intergenic
1183201423 22:36387773-36387795 TGCCCGGGGCGGGACCGCGGTGG + Intronic
1183708780 22:39490564-39490586 AGCCCTGGGCTGCACAGTGAGGG - Exonic
1184658626 22:45955163-45955185 TGCCCGGGGCAGCAGTGGGAGGG - Intronic
950429930 3:12944870-12944892 GGTCGGGGGCAGCACAGTGAGGG - Intronic
966906926 3:184532997-184533019 TGCCAGAGGTGGCACAGTGTTGG - Intronic
969248551 4:5952502-5952524 GGCCCCAGGCGGCACAGTCAAGG + Intronic
969303402 4:6310569-6310591 TGCCCAGGGCCACACAGTAAAGG - Intergenic
969544776 4:7818561-7818583 GGCCTGCGGCGTCACAGTGATGG + Intronic
977444348 4:97110272-97110294 GGCCCAGTGTGGCACAGTGAAGG + Intergenic
978409594 4:108412258-108412280 TGCCCAGGACAGCACAGGGACGG - Intergenic
981545146 4:145885950-145885972 TGCCTGGGGCAGCAAAGGGAAGG - Exonic
984102331 4:175500140-175500162 GGCCTGGGGCGGCAGTGTGAGGG + Intergenic
984377734 4:178953887-178953909 TGGCGGTGGCGGCACGGTGAAGG - Intergenic
985613863 5:907729-907751 TGCCCGGGGCGGCACAGTGAGGG - Intronic
987081292 5:14427572-14427594 TGCCCTGGGTGGGCCAGTGAAGG - Intronic
987113954 5:14712249-14712271 AGGCCGGGGCAGCAGAGTGACGG - Intronic
988595395 5:32585877-32585899 GGCCCGGGGCGGTAGATTGAGGG + Intronic
991992987 5:72359886-72359908 TGCCCAGGGCCACACAGTAATGG - Intronic
996790600 5:127290069-127290091 GGCCCCGGGAGGCCCAGTGATGG - Intergenic
998107353 5:139476991-139477013 TGCCCGAGGTCACACAGTGAGGG + Intronic
998974450 5:147628757-147628779 TGCCAGGGACAGCACAGTGCTGG + Exonic
999134261 5:149307356-149307378 TCCCCAGGATGGCACAGTGATGG + Intronic
1002197634 5:177509864-177509886 TGCCCGGGGCGGGACGGGGGAGG - Intronic
1004774093 6:18823122-18823144 TGCCTGGGGTGGCACAGGGCAGG - Intergenic
1005835282 6:29704117-29704139 AGCCAGGGACGGGACAGTGAAGG - Intergenic
1006980551 6:38144488-38144510 TGCTGGGCGCAGCACAGTGATGG - Intronic
1007697035 6:43740549-43740571 TGCCTTGGGAGGCCCAGTGATGG - Intergenic
1013488340 6:110619435-110619457 TGCCTGGGGCAGCACAGTAGAGG + Intronic
1017793763 6:157823484-157823506 GGCCCGGGGCGGCGCGGAGAGGG + Intronic
1020070664 7:5224793-5224815 TGCCCGGGGAGGAACAAGGACGG + Intronic
1022410238 7:30134740-30134762 GGCCCGGGGCGGCACCGCGATGG + Intergenic
1023836095 7:44068054-44068076 TGGCAGTGGTGGCACAGTGACGG + Intronic
1024096061 7:45983710-45983732 TGGCCAGGGCCCCACAGTGAAGG - Intergenic
1025021893 7:55486822-55486844 TGCCCAGGGCAGCACAGGGCAGG + Intronic
1026129301 7:67606915-67606937 TTCCAGGGTCGGCACAGTGCAGG - Intergenic
1026914027 7:74109061-74109083 TGCCCGGGGCCGCACAGCGGGGG - Intronic
1034956704 7:155339552-155339574 TGCCCAGGGCAGCCCAGGGAGGG + Intergenic
1037521535 8:19684670-19684692 TCCCAGGGGCAGCACAGGGAGGG - Intronic
1048843427 8:138584596-138584618 TGCACTGGGCGGCAAAGGGATGG + Intergenic
1049719499 8:144109100-144109122 TTCCCGGGACAGCACCGTGAAGG + Exonic
1057810924 9:98256009-98256031 TGCCCCGCGCGGCACAGGGAGGG - Intergenic
1059344028 9:113616245-113616267 TGCCCGGGTCGCCACACTGCTGG - Intergenic
1061267983 9:129519327-129519349 TGCCCAGGGTCACACAGTGAAGG - Intergenic
1062231431 9:135484164-135484186 TGCCCCGGGCGGCACCGTGGAGG + Intronic
1195688672 X:107606495-107606517 AGCCAGGGGCAGCACAGTCAGGG + Intergenic
1195880312 X:109586405-109586427 TGTCCCGGGCGGAACAGTGTGGG - Intergenic