ID: 985615929

View in Genome Browser
Species Human (GRCh38)
Location 5:922095-922117
Sequence CAGCACCAACAGAAGGTACC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985615929_985615934 10 Left 985615929 5:922095-922117 CCAGGTACCTTCTGTTGGTGCTG No data
Right 985615934 5:922128-922150 TATCAGCTTTTCGCCTGGGTGGG No data
985615929_985615933 9 Left 985615929 5:922095-922117 CCAGGTACCTTCTGTTGGTGCTG No data
Right 985615933 5:922127-922149 GTATCAGCTTTTCGCCTGGGTGG No data
985615929_985615931 5 Left 985615929 5:922095-922117 CCAGGTACCTTCTGTTGGTGCTG No data
Right 985615931 5:922123-922145 CTCAGTATCAGCTTTTCGCCTGG No data
985615929_985615935 13 Left 985615929 5:922095-922117 CCAGGTACCTTCTGTTGGTGCTG No data
Right 985615935 5:922131-922153 CAGCTTTTCGCCTGGGTGGGTGG No data
985615929_985615936 18 Left 985615929 5:922095-922117 CCAGGTACCTTCTGTTGGTGCTG No data
Right 985615936 5:922136-922158 TTTCGCCTGGGTGGGTGGCCTGG No data
985615929_985615932 6 Left 985615929 5:922095-922117 CCAGGTACCTTCTGTTGGTGCTG No data
Right 985615932 5:922124-922146 TCAGTATCAGCTTTTCGCCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985615929 Original CRISPR CAGCACCAACAGAAGGTACC TGG (reversed) Intergenic
No off target data available for this crispr