ID: 985620417

View in Genome Browser
Species Human (GRCh38)
Location 5:952135-952157
Sequence CCAGGGGTCAGGGTCATGCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985620417_985620429 -2 Left 985620417 5:952135-952157 CCTGGCATGACCCTGACCCCTGG No data
Right 985620429 5:952156-952178 GGGTGGGCTCATGTGGCCCTGGG No data
985620417_985620436 23 Left 985620417 5:952135-952157 CCTGGCATGACCCTGACCCCTGG No data
Right 985620436 5:952181-952203 AGCTGGCGGCAGGACAGGAGAGG No data
985620417_985620437 29 Left 985620417 5:952135-952157 CCTGGCATGACCCTGACCCCTGG No data
Right 985620437 5:952187-952209 CGGCAGGACAGGAGAGGTCTTGG No data
985620417_985620424 -9 Left 985620417 5:952135-952157 CCTGGCATGACCCTGACCCCTGG No data
Right 985620424 5:952149-952171 GACCCCTGGGTGGGCTCATGTGG No data
985620417_985620435 18 Left 985620417 5:952135-952157 CCTGGCATGACCCTGACCCCTGG No data
Right 985620435 5:952176-952198 GGGAGAGCTGGCGGCAGGACAGG No data
985620417_985620428 -3 Left 985620417 5:952135-952157 CCTGGCATGACCCTGACCCCTGG No data
Right 985620428 5:952155-952177 TGGGTGGGCTCATGTGGCCCTGG No data
985620417_985620431 9 Left 985620417 5:952135-952157 CCTGGCATGACCCTGACCCCTGG No data
Right 985620431 5:952167-952189 TGTGGCCCTGGGAGAGCTGGCGG No data
985620417_985620430 6 Left 985620417 5:952135-952157 CCTGGCATGACCCTGACCCCTGG No data
Right 985620430 5:952164-952186 TCATGTGGCCCTGGGAGAGCTGG No data
985620417_985620432 13 Left 985620417 5:952135-952157 CCTGGCATGACCCTGACCCCTGG No data
Right 985620432 5:952171-952193 GCCCTGGGAGAGCTGGCGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985620417 Original CRISPR CCAGGGGTCAGGGTCATGCC AGG (reversed) Intergenic