ID: 985620423

View in Genome Browser
Species Human (GRCh38)
Location 5:952146-952168
Sequence CATGAGCCCACCCAGGGGTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985620423_985620431 -2 Left 985620423 5:952146-952168 CCTGACCCCTGGGTGGGCTCATG No data
Right 985620431 5:952167-952189 TGTGGCCCTGGGAGAGCTGGCGG No data
985620423_985620435 7 Left 985620423 5:952146-952168 CCTGACCCCTGGGTGGGCTCATG No data
Right 985620435 5:952176-952198 GGGAGAGCTGGCGGCAGGACAGG No data
985620423_985620436 12 Left 985620423 5:952146-952168 CCTGACCCCTGGGTGGGCTCATG No data
Right 985620436 5:952181-952203 AGCTGGCGGCAGGACAGGAGAGG No data
985620423_985620432 2 Left 985620423 5:952146-952168 CCTGACCCCTGGGTGGGCTCATG No data
Right 985620432 5:952171-952193 GCCCTGGGAGAGCTGGCGGCAGG No data
985620423_985620430 -5 Left 985620423 5:952146-952168 CCTGACCCCTGGGTGGGCTCATG No data
Right 985620430 5:952164-952186 TCATGTGGCCCTGGGAGAGCTGG No data
985620423_985620437 18 Left 985620423 5:952146-952168 CCTGACCCCTGGGTGGGCTCATG No data
Right 985620437 5:952187-952209 CGGCAGGACAGGAGAGGTCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985620423 Original CRISPR CATGAGCCCACCCAGGGGTC AGG (reversed) Intergenic