ID: 985620425

View in Genome Browser
Species Human (GRCh38)
Location 5:952151-952173
Sequence GGCCACATGAGCCCACCCAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985620425_985620436 7 Left 985620425 5:952151-952173 CCCCTGGGTGGGCTCATGTGGCC No data
Right 985620436 5:952181-952203 AGCTGGCGGCAGGACAGGAGAGG No data
985620425_985620432 -3 Left 985620425 5:952151-952173 CCCCTGGGTGGGCTCATGTGGCC No data
Right 985620432 5:952171-952193 GCCCTGGGAGAGCTGGCGGCAGG No data
985620425_985620430 -10 Left 985620425 5:952151-952173 CCCCTGGGTGGGCTCATGTGGCC No data
Right 985620430 5:952164-952186 TCATGTGGCCCTGGGAGAGCTGG No data
985620425_985620431 -7 Left 985620425 5:952151-952173 CCCCTGGGTGGGCTCATGTGGCC No data
Right 985620431 5:952167-952189 TGTGGCCCTGGGAGAGCTGGCGG No data
985620425_985620437 13 Left 985620425 5:952151-952173 CCCCTGGGTGGGCTCATGTGGCC No data
Right 985620437 5:952187-952209 CGGCAGGACAGGAGAGGTCTTGG No data
985620425_985620435 2 Left 985620425 5:952151-952173 CCCCTGGGTGGGCTCATGTGGCC No data
Right 985620435 5:952176-952198 GGGAGAGCTGGCGGCAGGACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985620425 Original CRISPR GGCCACATGAGCCCACCCAG GGG (reversed) Intergenic