ID: 985620426

View in Genome Browser
Species Human (GRCh38)
Location 5:952152-952174
Sequence GGGCCACATGAGCCCACCCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985620426_985620431 -8 Left 985620426 5:952152-952174 CCCTGGGTGGGCTCATGTGGCCC No data
Right 985620431 5:952167-952189 TGTGGCCCTGGGAGAGCTGGCGG No data
985620426_985620436 6 Left 985620426 5:952152-952174 CCCTGGGTGGGCTCATGTGGCCC No data
Right 985620436 5:952181-952203 AGCTGGCGGCAGGACAGGAGAGG No data
985620426_985620437 12 Left 985620426 5:952152-952174 CCCTGGGTGGGCTCATGTGGCCC No data
Right 985620437 5:952187-952209 CGGCAGGACAGGAGAGGTCTTGG No data
985620426_985620432 -4 Left 985620426 5:952152-952174 CCCTGGGTGGGCTCATGTGGCCC No data
Right 985620432 5:952171-952193 GCCCTGGGAGAGCTGGCGGCAGG No data
985620426_985620435 1 Left 985620426 5:952152-952174 CCCTGGGTGGGCTCATGTGGCCC No data
Right 985620435 5:952176-952198 GGGAGAGCTGGCGGCAGGACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985620426 Original CRISPR GGGCCACATGAGCCCACCCA GGG (reversed) Intergenic