ID: 985620427

View in Genome Browser
Species Human (GRCh38)
Location 5:952153-952175
Sequence AGGGCCACATGAGCCCACCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985620427_985620436 5 Left 985620427 5:952153-952175 CCTGGGTGGGCTCATGTGGCCCT No data
Right 985620436 5:952181-952203 AGCTGGCGGCAGGACAGGAGAGG No data
985620427_985620435 0 Left 985620427 5:952153-952175 CCTGGGTGGGCTCATGTGGCCCT No data
Right 985620435 5:952176-952198 GGGAGAGCTGGCGGCAGGACAGG No data
985620427_985620432 -5 Left 985620427 5:952153-952175 CCTGGGTGGGCTCATGTGGCCCT No data
Right 985620432 5:952171-952193 GCCCTGGGAGAGCTGGCGGCAGG No data
985620427_985620431 -9 Left 985620427 5:952153-952175 CCTGGGTGGGCTCATGTGGCCCT No data
Right 985620431 5:952167-952189 TGTGGCCCTGGGAGAGCTGGCGG No data
985620427_985620437 11 Left 985620427 5:952153-952175 CCTGGGTGGGCTCATGTGGCCCT No data
Right 985620437 5:952187-952209 CGGCAGGACAGGAGAGGTCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985620427 Original CRISPR AGGGCCACATGAGCCCACCC AGG (reversed) Intergenic