ID: 985620431

View in Genome Browser
Species Human (GRCh38)
Location 5:952167-952189
Sequence TGTGGCCCTGGGAGAGCTGG CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985620423_985620431 -2 Left 985620423 5:952146-952168 CCTGACCCCTGGGTGGGCTCATG No data
Right 985620431 5:952167-952189 TGTGGCCCTGGGAGAGCTGGCGG No data
985620425_985620431 -7 Left 985620425 5:952151-952173 CCCCTGGGTGGGCTCATGTGGCC No data
Right 985620431 5:952167-952189 TGTGGCCCTGGGAGAGCTGGCGG No data
985620417_985620431 9 Left 985620417 5:952135-952157 CCTGGCATGACCCTGACCCCTGG No data
Right 985620431 5:952167-952189 TGTGGCCCTGGGAGAGCTGGCGG No data
985620422_985620431 -1 Left 985620422 5:952145-952167 CCCTGACCCCTGGGTGGGCTCAT No data
Right 985620431 5:952167-952189 TGTGGCCCTGGGAGAGCTGGCGG No data
985620427_985620431 -9 Left 985620427 5:952153-952175 CCTGGGTGGGCTCATGTGGCCCT No data
Right 985620431 5:952167-952189 TGTGGCCCTGGGAGAGCTGGCGG No data
985620426_985620431 -8 Left 985620426 5:952152-952174 CCCTGGGTGGGCTCATGTGGCCC No data
Right 985620431 5:952167-952189 TGTGGCCCTGGGAGAGCTGGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985620431 Original CRISPR TGTGGCCCTGGGAGAGCTGG CGG Intergenic