ID: 985620432

View in Genome Browser
Species Human (GRCh38)
Location 5:952171-952193
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985620427_985620432 -5 Left 985620427 5:952153-952175 CCTGGGTGGGCTCATGTGGCCCT No data
Right 985620432 5:952171-952193 GCCCTGGGAGAGCTGGCGGCAGG No data
985620425_985620432 -3 Left 985620425 5:952151-952173 CCCCTGGGTGGGCTCATGTGGCC No data
Right 985620432 5:952171-952193 GCCCTGGGAGAGCTGGCGGCAGG No data
985620426_985620432 -4 Left 985620426 5:952152-952174 CCCTGGGTGGGCTCATGTGGCCC No data
Right 985620432 5:952171-952193 GCCCTGGGAGAGCTGGCGGCAGG No data
985620423_985620432 2 Left 985620423 5:952146-952168 CCTGACCCCTGGGTGGGCTCATG No data
Right 985620432 5:952171-952193 GCCCTGGGAGAGCTGGCGGCAGG No data
985620422_985620432 3 Left 985620422 5:952145-952167 CCCTGACCCCTGGGTGGGCTCAT No data
Right 985620432 5:952171-952193 GCCCTGGGAGAGCTGGCGGCAGG No data
985620417_985620432 13 Left 985620417 5:952135-952157 CCTGGCATGACCCTGACCCCTGG No data
Right 985620432 5:952171-952193 GCCCTGGGAGAGCTGGCGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type