ID: 985620437

View in Genome Browser
Species Human (GRCh38)
Location 5:952187-952209
Sequence CGGCAGGACAGGAGAGGTCT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985620433_985620437 -8 Left 985620433 5:952172-952194 CCCTGGGAGAGCTGGCGGCAGGA No data
Right 985620437 5:952187-952209 CGGCAGGACAGGAGAGGTCTTGG No data
985620427_985620437 11 Left 985620427 5:952153-952175 CCTGGGTGGGCTCATGTGGCCCT No data
Right 985620437 5:952187-952209 CGGCAGGACAGGAGAGGTCTTGG No data
985620417_985620437 29 Left 985620417 5:952135-952157 CCTGGCATGACCCTGACCCCTGG No data
Right 985620437 5:952187-952209 CGGCAGGACAGGAGAGGTCTTGG No data
985620425_985620437 13 Left 985620425 5:952151-952173 CCCCTGGGTGGGCTCATGTGGCC No data
Right 985620437 5:952187-952209 CGGCAGGACAGGAGAGGTCTTGG No data
985620422_985620437 19 Left 985620422 5:952145-952167 CCCTGACCCCTGGGTGGGCTCAT No data
Right 985620437 5:952187-952209 CGGCAGGACAGGAGAGGTCTTGG No data
985620434_985620437 -9 Left 985620434 5:952173-952195 CCTGGGAGAGCTGGCGGCAGGAC No data
Right 985620437 5:952187-952209 CGGCAGGACAGGAGAGGTCTTGG No data
985620423_985620437 18 Left 985620423 5:952146-952168 CCTGACCCCTGGGTGGGCTCATG No data
Right 985620437 5:952187-952209 CGGCAGGACAGGAGAGGTCTTGG No data
985620426_985620437 12 Left 985620426 5:952152-952174 CCCTGGGTGGGCTCATGTGGCCC No data
Right 985620437 5:952187-952209 CGGCAGGACAGGAGAGGTCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985620437 Original CRISPR CGGCAGGACAGGAGAGGTCT TGG Intergenic