ID: 985623410

View in Genome Browser
Species Human (GRCh38)
Location 5:968682-968704
Sequence CATTCCCCCACTGTGTGGAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985623410_985623419 20 Left 985623410 5:968682-968704 CCCTTCCACACAGTGGGGGAATG No data
Right 985623419 5:968725-968747 CACCCGGTTTGTGGGGTGAGAGG No data
985623410_985623417 12 Left 985623410 5:968682-968704 CCCTTCCACACAGTGGGGGAATG No data
Right 985623417 5:968717-968739 AAATTCGACACCCGGTTTGTGGG No data
985623410_985623418 13 Left 985623410 5:968682-968704 CCCTTCCACACAGTGGGGGAATG No data
Right 985623418 5:968718-968740 AATTCGACACCCGGTTTGTGGGG No data
985623410_985623416 11 Left 985623410 5:968682-968704 CCCTTCCACACAGTGGGGGAATG No data
Right 985623416 5:968716-968738 CAAATTCGACACCCGGTTTGTGG No data
985623410_985623414 4 Left 985623410 5:968682-968704 CCCTTCCACACAGTGGGGGAATG No data
Right 985623414 5:968709-968731 TCAGCCTCAAATTCGACACCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985623410 Original CRISPR CATTCCCCCACTGTGTGGAA GGG (reversed) Intergenic
No off target data available for this crispr