ID: 985623416

View in Genome Browser
Species Human (GRCh38)
Location 5:968716-968738
Sequence CAAATTCGACACCCGGTTTG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985623413_985623416 6 Left 985623413 5:968687-968709 CCACACAGTGGGGGAATGGCAGT No data
Right 985623416 5:968716-968738 CAAATTCGACACCCGGTTTGTGG No data
985623411_985623416 10 Left 985623411 5:968683-968705 CCTTCCACACAGTGGGGGAATGG No data
Right 985623416 5:968716-968738 CAAATTCGACACCCGGTTTGTGG No data
985623410_985623416 11 Left 985623410 5:968682-968704 CCCTTCCACACAGTGGGGGAATG No data
Right 985623416 5:968716-968738 CAAATTCGACACCCGGTTTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985623416 Original CRISPR CAAATTCGACACCCGGTTTG TGG Intergenic
No off target data available for this crispr