ID: 985625003

View in Genome Browser
Species Human (GRCh38)
Location 5:980998-981020
Sequence TGAGGTCTGCTTACTCCAAG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 97
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 85}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985625000_985625003 2 Left 985625000 5:980973-980995 CCATGTGGACTCCTAAATTATTG 0: 1
1: 0
2: 0
3: 15
4: 124
Right 985625003 5:980998-981020 TGAGGTCTGCTTACTCCAAGAGG 0: 1
1: 0
2: 0
3: 11
4: 85
985625002_985625003 -9 Left 985625002 5:980984-981006 CCTAAATTATTGTCTGAGGTCTG 0: 1
1: 0
2: 2
3: 19
4: 236
Right 985625003 5:980998-981020 TGAGGTCTGCTTACTCCAAGAGG 0: 1
1: 0
2: 0
3: 11
4: 85

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985625003 Original CRISPR TGAGGTCTGCTTACTCCAAG AGG Intronic
902722057 1:18310296-18310318 TGAGGTTTCCTTCCACCAAGAGG + Intronic
903357929 1:22759484-22759506 TGAGCTCAGCCGACTCCAAGAGG - Intronic
903854078 1:26325846-26325868 TGAGGTATGCTTACTACCAGTGG + Intronic
912756170 1:112326316-112326338 TGAGGTCTGCCTATCCCATGGGG + Intergenic
917144016 1:171868361-171868383 TGTGGTCTGCTCAGGCCAAGAGG + Intronic
920199265 1:204249454-204249476 TGAGGTATGCTTACTCTCTGAGG + Intronic
920536441 1:206739720-206739742 TGAGGCCTTATTACCCCAAGAGG - Intergenic
1064552105 10:16513063-16513085 TGAGGACTGCAGACACCAAGTGG - Exonic
1072523859 10:96254287-96254309 TGATGTCTGCTTTCAACAAGGGG + Intronic
1074603821 10:114940732-114940754 TGGGGCCTTCTTACTCCAAGGGG + Intronic
1076099430 10:127763731-127763753 TGAGTTCTGGTTAATCCAAGGGG - Intergenic
1077110689 11:860771-860793 TGTGGTCTGGGTGCTCCAAGGGG + Intronic
1077910784 11:6570118-6570140 TGGGGGCTGATGACTCCAAGGGG - Intronic
1078553213 11:12294411-12294433 TGAGGACTGGTTTCTCCCAGGGG - Exonic
1078907151 11:15698065-15698087 TGAGATCTGATTACTTCATGTGG + Intergenic
1085112510 11:73900424-73900446 TGAAGTGTGCTTTCTCCAAAAGG + Intronic
1088353843 11:108921022-108921044 TGAGGACTGCTTAGGCCAAATGG - Intronic
1091686074 12:2563698-2563720 TGAAGTCAGGCTACTCCAAGAGG + Intronic
1092932244 12:13326977-13326999 TTGTGTCTGATTACTCCAAGAGG + Intergenic
1094736092 12:33235555-33235577 TGAGCTGTGTTTACTCCAGGGGG + Intergenic
1101240676 12:102835120-102835142 TGAGGTCTCTTTATTCCAAAGGG - Intergenic
1104129558 12:125880058-125880080 TGAGGTTTGCTTACTCCAGTGGG - Intergenic
1104355909 12:128087125-128087147 TGAGGTCTGCTAATTCCAACTGG - Intergenic
1114349990 14:21839478-21839500 TGAAGACTGCTTAATCCAACGGG + Intergenic
1115463076 14:33683880-33683902 TGTGCTCTGCATACACCAAGAGG - Intronic
1120952038 14:90050491-90050513 CCAGGTCTGCTTCCTCCAAGCGG + Intergenic
1125338431 15:38651303-38651325 TGAAGTGTGCTTATTCCATGTGG - Intergenic
1125499731 15:40232145-40232167 TGAGCTCTGCCTCCTGCAAGGGG - Intergenic
1125887753 15:43241249-43241271 TGAGCTCTGCTTACGCCAGGAGG + Intronic
1130136715 15:81187779-81187801 TGAGGTCTGCTCACCACAACTGG - Intronic
1133212620 16:4271941-4271963 AGAGGTCCGCCTACTCCAAGAGG + Intronic
1135328674 16:21543754-21543776 TGAGGACTGCTGAGTCCGAGGGG + Intergenic
1147605798 17:41773136-41773158 TGAGTTCTGCTTACTCACTGAGG - Intronic
1149522244 17:57326297-57326319 TGGGTTTTGCTTACTCCCAGCGG + Intronic
1152551614 17:81033191-81033213 GGAGGCCTCCTCACTCCAAGAGG - Intergenic
1153819177 18:8818248-8818270 TCAGGTCTTCTAACTCCAGGTGG + Intronic
1159526015 18:69590423-69590445 CGAGATCAGCATACTCCAAGTGG + Intronic
1161426635 19:4207351-4207373 TGAGGTATGCTGCCACCAAGTGG + Intronic
1164397151 19:27876354-27876376 TGAGGTATGCATACTGCAATGGG + Intergenic
1165112090 19:33508374-33508396 TTAGGTCTGCTTTCTGCAGGAGG - Intronic
1166353827 19:42215555-42215577 AGAGGCCTGCTTACTCCTTGGGG - Intronic
927641561 2:24848886-24848908 TGAGCTCTGCTTACTGCAGGTGG + Intronic
929213200 2:39382338-39382360 TAAGGTTTGAGTACTCCAAGGGG - Intronic
935559890 2:104548996-104549018 TGAGATCTGTTTACTCAAAAGGG + Intergenic
941473632 2:165921366-165921388 TGATGTCTCCTGACTCCATGGGG + Intronic
944426269 2:199586584-199586606 TGAGGGCTGCTTACTATAACCGG + Intergenic
945201864 2:207289861-207289883 TGAGTCCTGCTTTCTGCAAGAGG + Intergenic
946465851 2:219911434-219911456 TGAGGTCTGCTTGTTCCTAAAGG - Intergenic
947110133 2:226709375-226709397 GGACCTCTGCTGACTCCAAGAGG - Intergenic
948351479 2:237344623-237344645 TCCGGTTTGCTGACTCCAAGAGG - Exonic
949052103 2:241902898-241902920 TGAGGCCTGCTGGCTCCCAGGGG + Intergenic
1175263102 20:57687067-57687089 TGTGGGCTGCTTGCTGCAAGAGG - Intronic
1176004361 20:62852248-62852270 TAAGGTCTGCTCACTCCTAGAGG + Intronic
1176916282 21:14629582-14629604 TGAATTCTGCTTTCTCTAAGAGG + Intronic
1181997832 22:26897132-26897154 AGGGGTCTGCTGACACCAAGGGG + Intergenic
949851886 3:8428299-8428321 TGGGGGCTGCATGCTCCAAGTGG + Intergenic
954323475 3:49847965-49847987 GGAGGTCTGCTTACACCCACAGG - Intronic
954444124 3:50537479-50537501 TGAGTTCTGCCTCCTCCAGGAGG - Intergenic
954644247 3:52121238-52121260 AGAGGTCTGCTGAGTCCCAGGGG + Intronic
955343200 3:58141624-58141646 TTAGGTCTGCGTGCTACAAGTGG + Intronic
956717068 3:72088106-72088128 TCAGCTCTGCTGACTCCCAGGGG - Intergenic
960007492 3:112794919-112794941 TGAGGTCTGCTTGTTGCCAGGGG - Intronic
960413106 3:117352118-117352140 TGAAGTCTGCATACTTAAAGTGG + Intergenic
969265060 4:6059143-6059165 TGTGGTCTGCATCCTCCATGCGG - Intronic
977267411 4:94872127-94872149 TGAGGTCTGCTTTCTCTTACCGG + Intronic
985625003 5:980998-981020 TGAGGTCTGCTTACTCCAAGAGG + Intronic
987025751 5:13925038-13925060 TGAGGGAGGATTACTCCAAGAGG - Intronic
992876173 5:81058158-81058180 TGAGTTATGCTTTCACCAAGTGG + Intronic
997851349 5:137335655-137335677 GGAGGTGTGCTTACTTGAAGAGG - Intronic
1000214192 5:159139136-159139158 GGAGGGCTGCTTCCTGCAAGTGG + Intergenic
1002496332 5:179614718-179614740 TGATTTATGCTTACTCTAAGTGG - Exonic
1008014441 6:46502643-46502665 TGAGGACTGCTTGTTCCAGGGGG - Intergenic
1008154148 6:47993413-47993435 TAGAGTCTGCTTTCTCCAAGTGG - Intronic
1008889953 6:56476620-56476642 TCAGGTAAGCTTACTCCATGTGG + Intronic
1011622506 6:89256207-89256229 TCAGGGCTGCTTTCTCCATGAGG + Intergenic
1016003485 6:139066496-139066518 TGAGGCCTTCTTCCTCCATGGGG - Intergenic
1016977862 6:149826619-149826641 TGAGATCTCCCTTCTCCAAGAGG - Intronic
1017488080 6:154921186-154921208 TGAGGTCAGTTACCTCCAAGTGG - Intronic
1018767783 6:166947350-166947372 TGAGTGCTGCTTACTCCACAAGG + Intronic
1021276632 7:18659921-18659943 AGATGTCTGCTTACTCTCAGTGG - Intronic
1024286183 7:47759669-47759691 TGTGGCCTGTTTACTCCATGGGG + Intronic
1026424146 7:70272995-70273017 TGAGTTCTGCTTCCTCAGAGGGG + Intronic
1026804011 7:73418315-73418337 AGAGGTTTGCTTCCCCCAAGTGG - Intergenic
1028635495 7:92984633-92984655 TGAGGTATTCTTACTAGAAGAGG + Intergenic
1028725181 7:94078535-94078557 TGAGGTCAGCTTGCTGAAAGGGG - Intergenic
1030941662 7:115658483-115658505 TGAGGTCTGACTATTCCAATTGG - Intergenic
1037692880 8:21197547-21197569 TGAGATCTGCCTATTTCAAGAGG - Intergenic
1046248716 8:111601676-111601698 TGATCTCTGGTTACTCCAAAAGG - Intergenic
1048915091 8:139175138-139175160 GGAGGTCTGCTTACTTTAGGGGG + Intergenic
1052249861 9:26385357-26385379 TGAGGTCTCCTTACTGCAATAGG - Intergenic
1058454908 9:105129983-105130005 TGAGGACTGTTTACTGAAAGAGG - Intergenic
1061276684 9:129572767-129572789 TGAGGTCTGTTTACTGCAGCTGG - Intergenic
1061366515 9:130174754-130174776 TGAGGTGAGATTGCTCCAAGAGG + Intronic
1186987346 X:15031284-15031306 TGAGTTCTGCTTCCTCAGAGGGG + Intergenic
1192397924 X:70802556-70802578 GGAGGTCTTCTTACTTCAAAAGG + Intronic
1198925180 X:141783089-141783111 TGATGTCCTTTTACTCCAAGTGG - Intergenic
1199225985 X:145375108-145375130 TTCTGTCTGTTTACTCCAAGTGG - Intergenic