ID: 985628416

View in Genome Browser
Species Human (GRCh38)
Location 5:1002182-1002204
Sequence GCTGCAGCTCAGGCAGAAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985628414_985628416 -2 Left 985628414 5:1002161-1002183 CCACACATTTGGAACATGGCTGC No data
Right 985628416 5:1002182-1002204 GCTGCAGCTCAGGCAGAAGCAGG No data
985628410_985628416 19 Left 985628410 5:1002140-1002162 CCAGTGAAATTTCACCACAAACC No data
Right 985628416 5:1002182-1002204 GCTGCAGCTCAGGCAGAAGCAGG No data
985628412_985628416 5 Left 985628412 5:1002154-1002176 CCACAAACCACACATTTGGAACA No data
Right 985628416 5:1002182-1002204 GCTGCAGCTCAGGCAGAAGCAGG No data
985628409_985628416 20 Left 985628409 5:1002139-1002161 CCCAGTGAAATTTCACCACAAAC No data
Right 985628416 5:1002182-1002204 GCTGCAGCTCAGGCAGAAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985628416 Original CRISPR GCTGCAGCTCAGGCAGAAGC AGG Intergenic
No off target data available for this crispr