ID: 985628956

View in Genome Browser
Species Human (GRCh38)
Location 5:1005035-1005057
Sequence GGAGGAGGAGGTGCGGCCGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 1142
Summary {0: 1, 1: 0, 2: 12, 3: 140, 4: 989}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985628956_985628966 9 Left 985628956 5:1005035-1005057 CCTGCGGCCGCACCTCCTCCTCC 0: 1
1: 0
2: 12
3: 140
4: 989
Right 985628966 5:1005067-1005089 CCAGGCCCCTGCCCCGCCCGCGG 0: 1
1: 1
2: 9
3: 93
4: 767
985628956_985628977 28 Left 985628956 5:1005035-1005057 CCTGCGGCCGCACCTCCTCCTCC 0: 1
1: 0
2: 12
3: 140
4: 989
Right 985628977 5:1005086-1005108 GCGGCTGAGGAGATAAGGAGAGG 0: 1
1: 0
2: 0
3: 24
4: 248
985628956_985628960 -9 Left 985628956 5:1005035-1005057 CCTGCGGCCGCACCTCCTCCTCC 0: 1
1: 0
2: 12
3: 140
4: 989
Right 985628960 5:1005049-1005071 TCCTCCTCCATCCGGAGACCAGG 0: 1
1: 0
2: 1
3: 17
4: 219
985628956_985628969 15 Left 985628956 5:1005035-1005057 CCTGCGGCCGCACCTCCTCCTCC 0: 1
1: 0
2: 12
3: 140
4: 989
Right 985628969 5:1005073-1005095 CCCTGCCCCGCCCGCGGCTGAGG 0: 1
1: 0
2: 4
3: 62
4: 498
985628956_985628974 23 Left 985628956 5:1005035-1005057 CCTGCGGCCGCACCTCCTCCTCC 0: 1
1: 0
2: 12
3: 140
4: 989
Right 985628974 5:1005081-1005103 CGCCCGCGGCTGAGGAGATAAGG 0: 1
1: 0
2: 0
3: 1
4: 45

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985628956 Original CRISPR GGAGGAGGAGGTGCGGCCGC AGG (reversed) Intergenic
900096160 1:940979-941001 GCAGGAGGATGGGCGGCCACAGG - Intronic
900123949 1:1061394-1061416 GGAGGAGGAGCTGGGGCCCCGGG + Intergenic
900189999 1:1349272-1349294 GGGGGCGGATGGGCGGCCGCGGG - Intronic
900311704 1:2036480-2036502 GCAGGAGGAAGTGCTGCCCCGGG - Intergenic
900335478 1:2160941-2160963 GCAGGAGGAGGCGCCGCCGTCGG + Intronic
900365286 1:2309701-2309723 GGAGGAGGGGGTGGGGGGGCCGG - Exonic
900365306 1:2309739-2309761 GGAGGAGGGGGTGGGGGGGCCGG - Exonic
900504435 1:3022282-3022304 GCAGGGGAAGGTGTGGCCGCTGG - Exonic
900516121 1:3082963-3082985 AGAGGAAGAGGTGGGGGCGCTGG + Intronic
900642333 1:3693734-3693756 GGAGGAGGAGCTGAGGCTGCAGG - Intronic
900642353 1:3693804-3693826 GGAGGAGGGGCTGAGGCTGCAGG - Intronic
900642406 1:3693980-3694002 GGAGGAGGGGCTGAGGCTGCAGG - Intronic
900642536 1:3694403-3694425 GGAGGAGGGGCTGAGGCTGCAGG - Intronic
900642567 1:3694508-3694530 GGAGGAGGGGCTGAGGCTGCAGG - Intronic
900642598 1:3694613-3694635 GGAGGAGGGGCTGAGGCTGCAGG - Intronic
900642687 1:3694929-3694951 GGAGGAGGGGCTGAGGCTGCAGG - Intronic
900969415 1:5981146-5981168 GGAGGAGGAGGTGGCGGTGCTGG - Intronic
900971133 1:5992955-5992977 GGAGAAGGAGGTGAGGAGGCTGG - Intronic
901120222 1:6885788-6885810 GGAGGAGGAGGGGAGGCAGCAGG - Intronic
901433957 1:9234955-9234977 GGAAGAGGAGGTGCGGCCCAGGG + Exonic
901518294 1:9764152-9764174 GGAGGAGGAGGAGCAACCACAGG + Intronic
901628997 1:10639166-10639188 GGAGGAGGAGCTGGAGCTGCCGG - Exonic
901740119 1:11336131-11336153 GCAGGAGGAGGTGCAGCCACAGG + Intergenic
901740362 1:11338123-11338145 GGAGGAGGAGGTGGGGGAGGAGG - Intergenic
901744404 1:11362986-11363008 GGAGGAGGAGGAGGAGCAGCGGG + Intergenic
901744405 1:11362989-11363011 GGAGGAGGAGGAGCAGCGGGAGG + Intergenic
901781964 1:11600037-11600059 GGGGCAGGAGGGGCTGCCGCCGG + Intergenic
902223355 1:14980868-14980890 GGAGGGGGAGGTGGGGTGGCTGG + Intronic
902350036 1:15847666-15847688 GGGGGAGGCAGTGCGGCGGCGGG + Intergenic
902507353 1:16946862-16946884 GGAGCAGGAGGTGGCGCGGCAGG + Exonic
902615796 1:17622966-17622988 GGAGGGCGGGGTGAGGCCGCAGG - Intronic
902811269 1:18889382-18889404 GGATGAGGAGGTGTGGACGTCGG - Exonic
902877586 1:19350067-19350089 GGAGGAGGAGAGGCGCCTGCTGG - Intronic
903066766 1:20704054-20704076 CGAGGAGCAGGTGTGGCCGTGGG + Intronic
903095538 1:20969478-20969500 GGAGGAGTAGGTGTGGACGTGGG + Exonic
903173102 1:21565609-21565631 AGATGAGGAGGGGGGGCCGCAGG + Intronic
903560028 1:24220271-24220293 TGAGGAGGTGGTGCGGGAGCAGG - Intergenic
903576110 1:24340815-24340837 GGAGGAGGAGCTGGGGCCTTGGG + Intronic
904038132 1:27569719-27569741 GGAGGTGGAGGTGAGCCTGCTGG - Intronic
904171308 1:28593612-28593634 GGGGGAGGAGGTCCTGCCTCTGG + Intronic
904322555 1:29707167-29707189 CAAGGAGGAGGTGCGGGCCCGGG - Intergenic
904619390 1:31766287-31766309 GAAGGAGGAGGGGGGGCCTCAGG - Intergenic
904715594 1:32465290-32465312 GGAGGGGCAGGCGCGGCCGTGGG + Intronic
905107504 1:35573314-35573336 AGAGGAGGAAGGGCGGGCGCTGG + Intergenic
905630824 1:39517681-39517703 GGAGGAGGAGGGGAGGCTTCAGG - Intronic
905666935 1:39768491-39768513 GGAGGAGGAGGGGAGGCTTCAGG + Intronic
906062498 1:42958074-42958096 GGAGGAGTAGGGGAGGCCGGTGG + Intronic
906191916 1:43904463-43904485 GGAGAAAGAGCTGCGGCCACTGG - Intronic
906291878 1:44624684-44624706 GGAGGAGGAGGAGAGGGCGAGGG + Intronic
906653814 1:47533576-47533598 GGAGGAGGAGGGGGCGGCGCCGG + Intergenic
906662534 1:47593246-47593268 GGAGCAGGAGGTGCGGGCCCCGG - Intergenic
906720072 1:47997706-47997728 GGAGGAGGAGGCGCGGGCAGGGG - Intergenic
907158222 1:52353590-52353612 GGAGGTGAAGGTGAGGCTGCGGG - Exonic
908572455 1:65423483-65423505 GGAGGAGGGGGTACTGCCGATGG + Intronic
909170012 1:72282875-72282897 GAGGGAGGAGGCGCGGCGGCGGG + Intergenic
910241043 1:85086582-85086604 GCAGGAGGAGGTGGAACCGCAGG - Intronic
910387897 1:86704836-86704858 CGAGGCGGAGGTGCCGCGGCCGG - Intronic
910408550 1:86915201-86915223 GGCCGAGGAGGCGCTGCCGCCGG + Intronic
911044974 1:93620641-93620663 GCAGGAGGAGGTGGGGCTGGAGG - Intronic
911348362 1:96722443-96722465 GGGGGAGGGCGTGCGGCGGCGGG + Intronic
911863869 1:102991168-102991190 GGAGGAGGTGGTGAGGCAGGAGG + Intronic
912515881 1:110216351-110216373 GGAGGTGGAGGGGCTGCCCCGGG - Intronic
912910931 1:113758953-113758975 GGAGGGGCAGGGGCCGCCGCTGG + Intronic
913250686 1:116910141-116910163 GGAGGAGGAGGAGAGGCGGCGGG + Exonic
913656613 1:120966452-120966474 GGAGGAGGAGGTGCAGTTTCAGG + Intergenic
913972264 1:143424050-143424072 GGAGGAGGTGCTGTGCCCGCTGG + Intergenic
914066646 1:144249663-144249685 GGAGGAGGTGCTGTGCCCGCTGG + Intergenic
914112507 1:144716691-144716713 GGAGGAGGTGCTGTGCCCGCTGG - Intergenic
914521165 1:148417700-148417722 GGAGGAGGAGGTGCAGTTTCAGG + Intergenic
914646576 1:149658189-149658211 GGAGGAGGAGGTGCAGTTTCAGG + Intergenic
914950497 1:152109769-152109791 GGAAGAGGAGGTGCAGCAGGAGG - Exonic
914950513 1:152109862-152109884 GGAGGAAGAGGAGCTGCAGCAGG - Exonic
914950543 1:152110042-152110064 GGAGGAAGAGGAGCTGCAGCAGG - Exonic
915117125 1:153608214-153608236 GGAGGAGGAGGTATGGCCTGTGG - Intronic
915135549 1:153728698-153728720 GGAGGAGGAGGAGCGGGAGCAGG + Exonic
915495978 1:156282818-156282840 GGCGGAGGAGGAGCTGTCGCGGG - Exonic
916233422 1:162561971-162561993 GGAGGATGGGGTGCGACTGCGGG - Intronic
917118652 1:171626554-171626576 GGAGAAGGAGGTGGGGCAGGAGG - Intergenic
917737240 1:177932515-177932537 GGGGGAGCAGCTGCGGGCGCTGG - Exonic
918497462 1:185156676-185156698 GGAGGAGGAGCTGCTGCCCCTGG - Exonic
919880812 1:201899400-201899422 GGAGGGGGTGGTGGGGCAGCTGG + Exonic
920372710 1:205489685-205489707 GGAGGCTGAGGTGCAGCTGCAGG - Intergenic
921189714 1:212699245-212699267 GGTGGGGGGGGTGCTGCCGCGGG - Intronic
921325318 1:213982746-213982768 GGCGGGGGAGGAGAGGCCGCGGG + Intergenic
922314851 1:224434059-224434081 GGAGGAGGAGGTGGCGGCGGCGG - Exonic
922513139 1:226186450-226186472 GGCGGAGGAGGCGCGGCGGCTGG - Exonic
922526664 1:226309309-226309331 CGGGGAGGAGGTGCCGCCGAAGG + Exonic
922564167 1:226590402-226590424 GGAGGAAGAGGTGCTGGGGCAGG - Intronic
922586390 1:226737505-226737527 GGAGGAGGAGGCGCCGGCGGCGG - Exonic
923008132 1:230067846-230067868 GGACGAGGATTTGCAGCCGCTGG - Intronic
924289651 1:242524506-242524528 GGAGGGCGAGGTGCGGGCGGGGG + Exonic
924539645 1:244969895-244969917 GGAGGAGGAGGCCGGGCCGCGGG + Exonic
1062843779 10:689671-689693 GGAGGCGGCGGCGCGGGCGCGGG + Intronic
1062886618 10:1021256-1021278 GGAGGAGGTGGTGGGGCTGTGGG + Intronic
1063032861 10:2253605-2253627 AGAGGAGGAGGTGAGGTCCCTGG - Intergenic
1065186600 10:23174880-23174902 GGAGGGGGAGGGCAGGCCGCCGG + Intergenic
1065918039 10:30368474-30368496 GGAGCAGGAGGAGAGGCTGCTGG - Intronic
1066602846 10:37126036-37126058 GCAGGAGGAGGTGGGGGCGGTGG + Intronic
1066651549 10:37661078-37661100 GGAGGAGGGGGTTCTGCCCCAGG - Intergenic
1067113940 10:43420514-43420536 GGAGCAGGCGGGGCGGCCGCAGG + Intergenic
1067830595 10:49609452-49609474 TGGGGAGGGGGTGCGGCGGCGGG + Intronic
1069255045 10:66322469-66322491 GTTGGAGGAGGTGAGGCAGCTGG + Intronic
1069445739 10:68471795-68471817 GGAGGAGGCGGAGCTGCCGGCGG - Exonic
1069706114 10:70459885-70459907 TGTGGAGAAGGTGCGGCAGCTGG - Intergenic
1069761757 10:70816123-70816145 GGAGGTGGAGGGGCCGCCGCGGG + Exonic
1070032709 10:72692506-72692528 GGAGGAGGAGGGGCGACGGCGGG + Intronic
1070327814 10:75399700-75399722 TGAGGAGGAGGTGGGCGCGCTGG + Exonic
1070610068 10:77926791-77926813 GGAGGCGGAGGTGGGGACGGCGG + Intergenic
1071519425 10:86319799-86319821 AGAGGAGGAGGGGCAGCCCCTGG - Intronic
1073105948 10:101032167-101032189 GGAGGAGGGGCTGGAGCCGCGGG - Intronic
1073122553 10:101131550-101131572 GGTGGAGGTGGTGCGGACCCAGG - Exonic
1073403576 10:103277727-103277749 GGAGGAGGTGCAGCGGCTGCGGG + Exonic
1073491328 10:103855293-103855315 GGATGAGAAGGTGACGCCGCCGG - Exonic
1073540955 10:104315865-104315887 GGAGGAGGAGGTGGCTCGGCTGG - Exonic
1073594594 10:104787188-104787210 GGAGGAGGATGTGAGGCAGCTGG + Intronic
1074503021 10:114043605-114043627 GCAGGAAGGGGTGCGTCCGCAGG + Intergenic
1074532151 10:114305281-114305303 GCAGGAGGGGATGCGGACGCAGG + Intronic
1074865509 10:117542426-117542448 GGAGGAGGAGAAGCCGCAGCGGG + Exonic
1075002473 10:118808711-118808733 GGAGGAGGAGGAGCAGCAGAGGG - Intergenic
1075910320 10:126119131-126119153 GGAGGCTGAGGTCCGGCCTCTGG + Intronic
1076323786 10:129604686-129604708 GGAGGAGGGGGTGCCCCTGCAGG + Intronic
1076454359 10:130579092-130579114 GCAGGAGGAGGTGAGGCCCTTGG - Intergenic
1076570119 10:131426938-131426960 GGAGGAGGAGGTGCCCACTCTGG - Intergenic
1076614649 10:131747519-131747541 GGATCAGGAGGTGCGTCCCCTGG - Intergenic
1076670320 10:132117442-132117464 GGTGGAGGAGGCGCTGACGCTGG + Exonic
1076788943 10:132766843-132766865 GGAGCTGGAGGTGCGGCCTCAGG + Intronic
1076788968 10:132766922-132766944 GGAGCCGGAGGTGCGGCCTCAGG + Intronic
1076891770 10:133288224-133288246 GGAGGAGGAGCTCCGGAAGCCGG - Exonic
1077081516 11:726522-726544 GGGGTGGGAGGTGCGGCCGAAGG + Intronic
1077117032 11:889853-889875 GGAGGAACAGCTGTGGCCGCTGG - Intronic
1077360368 11:2138059-2138081 GGAGGAGGACGGACGGCTGCGGG - Intronic
1077467570 11:2740813-2740835 AGAGGAGGAGACGTGGCCGCAGG - Intronic
1077500450 11:2907682-2907704 GCAGGGGGAGGAGCGGCTGCAGG + Intronic
1077545037 11:3165451-3165473 GGATGAGGAGAAGCGGCAGCCGG - Intronic
1078003122 11:7513645-7513667 GGAGGAGGAGGCGCGGCGAACGG + Intronic
1078019695 11:7645609-7645631 TGAGGAGGAGGTGCAGAAGCTGG + Intronic
1078085924 11:8233027-8233049 GGAGGGGGACCTGCGGCGGCTGG - Intronic
1078556075 11:12327193-12327215 GGAGGTGGAGGAGCGGCAGAGGG + Exonic
1078987035 11:16607005-16607027 GGAGGAGGAGGAGCGGGAGGAGG - Intronic
1081578478 11:44334637-44334659 GGAGGAGCAGCTGCAGCCGAGGG - Intergenic
1081636746 11:44726925-44726947 GGCGGCGGAGGTGGGGCCGGCGG + Intronic
1082089744 11:48079634-48079656 GGAAGAGGAGGAGCGGCCCCTGG + Intronic
1082236081 11:49821357-49821379 GGAGGAGGAGATGAGGCAACAGG - Intergenic
1083176051 11:60951159-60951181 GCAGAAGGAGCTGCGGCCGTCGG + Exonic
1083205541 11:61146581-61146603 GGAGGAGGAGGGAGGGCTGCGGG + Intronic
1083295339 11:61712354-61712376 GGTGGAGGAGGTGCCTCCTCTGG + Intronic
1083342521 11:61967750-61967772 TGTGGGGGAGGGGCGGCCGCTGG + Intergenic
1083431507 11:62615733-62615755 GGAGGAGCAGCTGCAGCGGCAGG - Exonic
1083644481 11:64164734-64164756 GGTGGAGTAGGTGTGGCCTCTGG - Intronic
1083847557 11:65344945-65344967 GGAGGAGGTGGTGGGGCAGTGGG - Intronic
1083889501 11:65588891-65588913 GGAGGTGGAGGTGCTGGCTCAGG + Intronic
1083913991 11:65728141-65728163 GGAGGAGCTGGTGCGGCTGAAGG - Intergenic
1084189711 11:67493397-67493419 GGTGCAGGAGGTGCGGCGGCTGG - Exonic
1084225366 11:67711791-67711813 GGAGGAGGAGGCGCCGCCCGCGG - Intergenic
1084363741 11:68684823-68684845 GGAGGAGCAGAGGCGGCGGCCGG - Intronic
1084566349 11:69931075-69931097 GGGTGGGGAGGTGGGGCCGCAGG + Intergenic
1084810215 11:71607483-71607505 GGAGGAGGAGGCGCCGCCCGCGG + Intergenic
1084978848 11:72817822-72817844 GGAGGAGGAGGGGCTCCGGCTGG + Exonic
1085054448 11:73395550-73395572 GGAGGAGGTGGAGCTGCAGCTGG + Exonic
1085157679 11:74311422-74311444 CGGGGAGGAGGCGCGGCTGCGGG - Exonic
1085534730 11:77211190-77211212 GCGGGAGGAGGTGCTGCAGCTGG + Exonic
1086306284 11:85484237-85484259 GGAGGAGGAGGAGGGGCGGTGGG - Intronic
1088522141 11:110711936-110711958 GGAGGCGGCGGCGCTGCCGCTGG + Intronic
1089316480 11:117594642-117594664 GGAGGAGCAGGGGCTGCTGCAGG - Intronic
1089460095 11:118647935-118647957 GGAGATGGAGCTGCGGCGGCAGG + Exonic
1089518976 11:119051382-119051404 GGAGGGGGAGGCGTGGCTGCTGG - Intronic
1090056644 11:123430209-123430231 GGAGGAGGAGGAGCGGGGGCTGG - Intergenic
1090190485 11:124763122-124763144 TGGGGAGGAGGGGCGGCTGCGGG + Intergenic
1090281018 11:125456011-125456033 GGAGGAGCTGGTGCAGCAGCTGG - Exonic
1090473917 11:127003326-127003348 CCCGGAGGAGGTGAGGCCGCGGG - Intronic
1090788577 11:130070360-130070382 GGAGGAGGTGGCGGCGCCGCGGG - Intronic
1091390941 12:125750-125772 GGAGGAGGAGGAGCGGCCGGGGG + Exonic
1091393253 12:138710-138732 GGAGGCCGAGGGGCGGGCGCCGG + Exonic
1091488921 12:916283-916305 GCAGGAGGAAGTGTAGCCGCAGG - Intronic
1091569288 12:1670435-1670457 GGAGAAGGAGGGGAGGACGCAGG - Intergenic
1092743170 12:11649562-11649584 CGCGGGGGAGGGGCGGCCGCGGG - Intergenic
1092899003 12:13041000-13041022 GGAGGAAGGGAGGCGGCCGCTGG + Intergenic
1093561970 12:20552510-20552532 GGAGGAGGAGGAGCAGCAGGAGG + Intronic
1093583236 12:20807514-20807536 GGGGGAGGAGGGGCGGCAGGGGG + Intergenic
1095112873 12:38317111-38317133 GGAGAAGGAGCTGGGGACGCTGG - Intronic
1095875966 12:47080057-47080079 GGAGGAGGCGGCGAGGCCGCGGG - Intronic
1096181885 12:49555747-49555769 GGATGAGGAGGTGCAGCCAGGGG - Exonic
1096215827 12:49796960-49796982 GGAGGAGGAGCTGCTGCCTGGGG + Exonic
1096538140 12:52288348-52288370 GTATGAGGAGGTGCGGGCTCAGG - Exonic
1096540636 12:52305018-52305040 GTATGAGGAGGTGCGGGCTCAGG + Exonic
1096626188 12:52897506-52897528 GGAGGAGCTGGTGCGGCTGAAGG + Exonic
1096678864 12:53241848-53241870 GGAGTAGGAGGGGCGGACGGTGG - Intergenic
1096769971 12:53928795-53928817 GGAGAGGGAGGTGCGGCGGGTGG + Intergenic
1096782133 12:53997597-53997619 GGCGGAGGAAGGGCGGCCGTAGG - Intronic
1096884018 12:54698912-54698934 GGAGGAGGAGGAGCGGGGGTGGG - Intergenic
1097245361 12:57604938-57604960 GGAGGTGGAGGAGGGGGCGCCGG - Intronic
1097990097 12:65825024-65825046 AGAGGAGGAGGCGCTGCCGGTGG - Exonic
1099676326 12:85765129-85765151 GGAGGTGGAGGTGAGCCCCCTGG + Intergenic
1100361587 12:93884519-93884541 GGAGGACGGGGTGGGGCCTCGGG + Intronic
1100981559 12:100166492-100166514 GGAGTAGGAGGAGAGGCTGCTGG - Intergenic
1101109690 12:101473567-101473589 GGAGGAGGAGAGGAGGCTGCAGG - Intergenic
1101870352 12:108560830-108560852 GGAGGAGCAGGTGGGCCCGGGGG - Exonic
1102258400 12:111429057-111429079 GGAGGAGGAGGAGGGACGGCAGG + Intronic
1103331259 12:120155599-120155621 GGAGGAGGAGATCCGGAAGCTGG - Exonic
1103410881 12:120710648-120710670 GGAGCAGGAGCTGCTGGCGCTGG + Exonic
1103932397 12:124457689-124457711 GGAGGAGGCGGGGAGGCCCCGGG - Intronic
1104391013 12:128390577-128390599 GGAGGCGGAGGTGCGGCTACAGG - Intronic
1104466428 12:128994318-128994340 GGAGGAGGAAGGGCGGGAGCTGG + Intergenic
1104759186 12:131286980-131287002 GGAGGGGGAGGTGCGGGGTCTGG - Intergenic
1104788448 12:131466783-131466805 AGAGGAAGAGGTGAGGCCGGAGG - Intergenic
1104820281 12:131673072-131673094 GGAGGAGGAGGGGCAGACCCGGG + Intergenic
1104821425 12:131679516-131679538 GGAGGGGGAGGTGCGGGGTCTGG + Intergenic
1104862362 12:131930172-131930194 TTAGGTGCAGGTGCGGCCGCCGG + Intronic
1104895416 12:132161425-132161447 GGAGGAGGAGGTGAGGGAGGAGG - Intergenic
1104966219 12:132509834-132509856 GGAGGGTGAGGAGTGGCCGCGGG - Intronic
1107851643 13:44577355-44577377 GGAGGAGGAGGGGCGACCGCCGG + Intergenic
1109052395 13:57500362-57500384 GTAGGAGGAGGTGGGGCCTTAGG - Intergenic
1112012001 13:95300929-95300951 GGAGCAGGAGGTGGGGAGGCGGG - Intronic
1112329675 13:98467690-98467712 GCAGAAGGAGGTGGGGCAGCTGG - Intronic
1112441101 13:99425834-99425856 CCTGGAGGAGGGGCGGCCGCGGG + Intergenic
1112507106 13:99981818-99981840 GGAGGAGGAGGCGGCGGCGCGGG - Exonic
1112574930 13:100627217-100627239 GGAGGAGCAGCTGCGCTCGCAGG + Intronic
1113086069 13:106570589-106570611 GTATGAGGAGGTGGGGCTGCTGG - Intergenic
1113086077 13:106570621-106570643 GTATGAGGAGGTGGGGCTGCTGG - Intergenic
1113086085 13:106570653-106570675 GTATGAGGAGGTGGGGCTGCTGG - Intergenic
1113378570 13:109784587-109784609 CGAGGCGGAGGCGCTGCCGCTGG + Exonic
1113390737 13:109893927-109893949 GGAGGAGGAGGTGATCCTGCAGG + Intergenic
1113707261 13:112442920-112442942 GGTGGAGGAGGTGGTGCTGCTGG - Intergenic
1113806020 13:113110345-113110367 GGAGAAGGCGGCGCGGCCCCGGG - Intronic
1113914620 13:113863204-113863226 GGAGGACGAGGCGCGGCCCGGGG + Intronic
1114522791 14:23349352-23349374 GGAGTAGGAGGGGCTGCTGCAGG - Exonic
1114549711 14:23525752-23525774 GGAGGAGGAGGGGTGGCAGCTGG + Exonic
1116416965 14:44689804-44689826 GGAGGAGGAGGAGGGGCAGGAGG + Intergenic
1116945195 14:50830305-50830327 GGAAGCGGAGGTGCGGCCGCAGG + Intronic
1117325950 14:54669094-54669116 GGAGAAGGAGGCGCAGCCACAGG + Intronic
1117377429 14:55129247-55129269 CGAGGAGGTGCTGCGGGCGCCGG - Exonic
1117842102 14:59870588-59870610 GCAGGACGAGCTGCTGCCGCTGG - Exonic
1117999636 14:61510988-61511010 GGAGGAGGAGGAGCCTCCGGAGG + Intronic
1118707195 14:68491225-68491247 GGAGGAGGAAGGGCGGCTGCGGG - Intronic
1118854643 14:69611647-69611669 GGAGGAGGTGGGGCGGTCGCCGG - Exonic
1118894082 14:69931340-69931362 GAAGGAGGAGTTGGGGCAGCTGG - Intronic
1118929125 14:70223795-70223817 GGAGGAAGCGGTGGGGCCTCGGG - Intergenic
1119706157 14:76783788-76783810 GGAGGAGGAGGCATGGCAGCAGG + Intergenic
1120703616 14:87725195-87725217 GAAGGAGCAGGTGAGGCCTCTGG + Intergenic
1120720168 14:87881924-87881946 GGAGGAGGAAGTGGGGAAGCAGG - Intronic
1120850190 14:89162813-89162835 GGAGGAGGAGATGGAGTCGCTGG + Exonic
1120874330 14:89362450-89362472 GGAGGAGGAGGTGGTGGAGCTGG - Intronic
1120993575 14:90398190-90398212 GGAGGAGGCGGCGGCGCCGCGGG + Intronic
1121013080 14:90533345-90533367 GGAGGAGGAGGTGAGGGGCCTGG - Exonic
1121432297 14:93896184-93896206 GGAGGCGGAGGGGCCGCAGCTGG + Intergenic
1121472515 14:94166217-94166239 GGAGGGGGCGGTGCGGGGGCGGG - Intronic
1121547055 14:94770160-94770182 GGAGGAGGGAGAGCGGACGCAGG - Exonic
1121636225 14:95455541-95455563 GGAGGAGGAGGAGCGGCTGCGGG - Exonic
1122029640 14:98902761-98902783 GGAGGAGGAGGAGCGCCTCCAGG + Intergenic
1122066065 14:99175197-99175219 GGAGGAGGAGGAGCTGCTACTGG - Exonic
1122789346 14:104177794-104177816 GGCGGAGGAGGCGCTGCCGGTGG - Exonic
1122796251 14:104207623-104207645 GGAGCAGGAGGGGCGACTGCTGG - Intergenic
1122878300 14:104678829-104678851 GGAGGAAGGGGTGGGGGCGCTGG - Intergenic
1122886640 14:104713269-104713291 GGAGGAGGCGCGGCGGCCTCGGG + Exonic
1123024859 14:105419811-105419833 GGAAGAGGAGGAGCGGCCGCGGG - Exonic
1123165821 14:106324183-106324205 GGAGGCGGAGGAGCCGGCGCAGG - Intergenic
1202834433 14_GL000009v2_random:67367-67389 GGAGCAGGTGCTGCGGCTGCTGG - Intergenic
1123468674 15:20534324-20534346 GGAGGAGAAGATGCGGAGGCAGG - Exonic
1123468736 15:20534744-20534766 GGAGGAGAAGGTGTGGAGGCAGG - Exonic
1123468778 15:20534966-20534988 GGAGGAGAAGGTGTGGAGGCAGG - Exonic
1123468842 15:20535365-20535387 GGAGGAGAAGATGCGGAGGCAGG - Exonic
1123468850 15:20535407-20535429 GGAGGAGAAGATGCGGAGGCAGG - Exonic
1123468858 15:20535449-20535471 GGAGGAGAAGATGCGGAGGCAGG - Exonic
1123649198 15:22465241-22465263 GGAGGAGAAGATGCGGAGGCAGG + Exonic
1123649206 15:22465283-22465305 GGAGGAGAAGATGCGGAGGCAGG + Exonic
1123649270 15:22465682-22465704 GGAGGAGAAGGTGTGGAGGCAGG + Exonic
1123649282 15:22465745-22465767 GGAGGAGAAGGTGTGGAGGCAGG + Exonic
1123649327 15:22465985-22466007 GGAGGAGAAGGTGTGGAGGCAGG + Exonic
1123649396 15:22466423-22466445 GGAGGAGAAGATGCGGAGGCAGG + Exonic
1123649418 15:22466570-22466592 GGAGGAGAAGATGCGGAGGCAGG + Exonic
1123649440 15:22466738-22466760 GGAGGAGAAGATGCGGAGGCAGG + Exonic
1123680287 15:22757985-22758007 GTCGGAGGAGGTGCGGGCGCTGG + Intergenic
1123681606 15:22768167-22768189 GGAGGAGCAGATGCGGAAGCAGG - Intergenic
1123681624 15:22768251-22768273 GGAGGAGCAGATGCGGAAGCAGG - Intergenic
1123681643 15:22768335-22768357 GGAGGAGCAGATGCGGAAGCAGG - Intergenic
1123681682 15:22768503-22768525 GGAGGAGCAGATGCGGAAGCAGG - Intergenic
1123681685 15:22768524-22768546 GGAGGAGCAGATGCGGGAGCAGG - Intergenic
1123681689 15:22768545-22768567 GGAGGAGCAGGTGGGGGAGCAGG - Intergenic
1123681696 15:22768566-22768588 GGAGGAGCAGATGCGGAAGCAGG - Intergenic
1123681699 15:22768587-22768609 GGAGGAGCAGATGCGGAAGCAGG - Intergenic
1123681710 15:22768650-22768672 GGAGGAGCAGATGCGGAAGCAGG - Intergenic
1123681725 15:22768713-22768735 GGAGGAGCAGATGCGGAAGCAGG - Intergenic
1123681728 15:22768734-22768756 GGAGGAGCAGATGCGGAAGCAGG - Intergenic
1123681741 15:22768818-22768840 GGAGGAGCAGATGCGGAAGCAGG - Intergenic
1123681788 15:22769025-22769047 GGAGGAGCAGATGCGGAAGCAGG - Intergenic
1123681794 15:22769067-22769089 GGAGGAGCAGATGCGGAAGCAGG - Intergenic
1123681819 15:22769193-22769215 GGAGGAGCAGATGCGGAAGCAGG - Intergenic
1123681834 15:22769277-22769299 GGAGGAGCAGATGCGGAAGCAGG - Intergenic
1123681843 15:22769319-22769341 GGAGGAGCAGGTGCGGGAGCAGG - Intergenic
1123681854 15:22769361-22769383 GGAGGAGCAGATGCGGAAGCAGG - Intergenic
1123681857 15:22769382-22769404 GGAGGAGCAGATGCGGAAGCAGG - Intergenic
1123681860 15:22769403-22769425 GGAGGAGCAGATGCGGAAGCAGG - Intergenic
1123681863 15:22769424-22769446 GGAGGAGCAGATGCGGAAGCAGG - Intergenic
1123681893 15:22769571-22769593 GGAGGAGCAGATGCGGAAGCAGG - Intergenic
1123681896 15:22769592-22769614 GGAGGAGCAGATGCGGAAGCAGG - Intergenic
1123681899 15:22769613-22769635 GGAGGAGCAGATGCGGAAGCAGG - Intergenic
1123681902 15:22769634-22769656 GGAGGAGCAGATGCGGAAGCAGG - Intergenic
1123681905 15:22769655-22769677 GGAGGAGCAGGTGCGAAAGCAGG - Intergenic
1123681908 15:22769676-22769698 GGAGGAGCAGGTGCGAAAGCAGG - Intergenic
1123681933 15:22769823-22769845 GGAGGAGCAGATGCGGGAGCAGG - Intergenic
1123681937 15:22769844-22769866 GGAGGAGCAGATGCGGGAGCAGG - Intergenic
1123681941 15:22769865-22769887 GGAGGAGCAGATGCGGGAGCAGG - Intergenic
1123681954 15:22769946-22769968 GGAGGAGCAGATGCGGGAGCAGG - Intergenic
1123681958 15:22769967-22769989 GGAGGAGCAGATGCGGGAGCAGG - Intergenic
1123681962 15:22769988-22770010 GGAGGAGCAGATGCGGAAGCAGG - Intergenic
1123681968 15:22770030-22770052 GGAGGAGCAGGTGCAGAAGCAGG - Intergenic
1123682010 15:22770198-22770220 GGAGGGGCAGGTGCGGGAGCAGG - Intergenic
1123682017 15:22770219-22770241 GGAGGGGCAGGTGCGGGAGCAGG - Intergenic
1123682024 15:22770240-22770262 GGAGGGGCAGGTGCGGGAGCAGG - Intergenic
1123682031 15:22770261-22770283 GGAGGGGCAGGTGCGGGAGCAGG - Intergenic
1123682038 15:22770282-22770304 GGAGGGGCAGGTGCGGGAGCAGG - Intergenic
1123682045 15:22770303-22770325 GGAGGGGCAGGTGCGGGAGCAGG - Intergenic
1123682052 15:22770324-22770346 GGAGGGGCAGGTGCGGGAGCAGG - Intergenic
1123682059 15:22770345-22770367 GGAGGGGCAGGTGCGGGAGCAGG - Intergenic
1123682066 15:22770366-22770388 GGAGGGGCAGGTGCGGGAGCAGG - Intergenic
1123682073 15:22770387-22770409 GGAGGGGCAGGTGCGGGAGCAGG - Intergenic
1123682080 15:22770408-22770430 GGAGGGGCAGGTGCGGGAGCAGG - Intergenic
1123682087 15:22770429-22770451 GGAGGGGCAGGTGCGGGAGCAGG - Intergenic
1123682094 15:22770450-22770472 GGAGGGGCAGGTGCGGGAGCAGG - Intergenic
1123682101 15:22770471-22770493 GGAGGGGCAGGTGCGGGAGCAGG - Intergenic
1123682108 15:22770492-22770514 GGAGGGGCAGGTGCGGGAGCAGG - Intergenic
1123682115 15:22770513-22770535 GGAGGGGCAGGTGCGGGAGCAGG - Intergenic
1123682122 15:22770534-22770556 GGAGGGGCAGGTGCGGGAGCAGG - Intergenic
1123682129 15:22770555-22770577 GGAGGGGCAGGTGCGGGAGCAGG - Intergenic
1123682136 15:22770576-22770598 GGAGGGGCAGGTGCGGGAGCAGG - Intergenic
1123682143 15:22770597-22770619 GGAGGGGCAGGTGCGGGAGCAGG - Intergenic
1123682150 15:22770618-22770640 GGAGGGGCAGGTGCGGGAGCAGG - Intergenic
1123682157 15:22770639-22770661 GGAGGGGCAGGTGCGGGAGCAGG - Intergenic
1123682164 15:22770660-22770682 GGAGGGGCAGGTGCGGGAGCAGG - Intergenic
1123682171 15:22770681-22770703 GGAGGGGCAGGTGCGGGAGCAGG - Intergenic
1123682178 15:22770702-22770724 GGAGGGGCAGGTGCGGGAGCAGG - Intergenic
1123682185 15:22770723-22770745 GGAGGAGCAGATGCGGGAGCAGG - Intergenic
1123728993 15:23129535-23129557 GGAGGAGAAGATGCGGAGGCAGG - Exonic
1123729054 15:23129952-23129974 GGAGGAGAAGGTGTGGAGGCAGG - Exonic
1123729117 15:23130348-23130370 GGAGGAGAAGATGCGGAGGCTGG - Exonic
1123729125 15:23130390-23130412 GGAGGAGAAGATGCGGAGGCAGG - Exonic
1123729133 15:23130432-23130454 GGAGGAGAAGATGCGGAGGCAGG - Exonic
1123747157 15:23327000-23327022 GGAGGAGAAGATGCGGAGGCAGG - Intergenic
1123747222 15:23327438-23327460 GGAGGAGAAGGTGTGGAGGCAGG - Intergenic
1123747285 15:23327834-23327856 GGAGGAGAAGATGCGGAGGCTGG - Intergenic
1123747293 15:23327876-23327898 GGAGGAGAAGATGCGGAGGCAGG - Intergenic
1123747301 15:23327918-23327940 GGAGGAGAAGATGCGGAGGCAGG - Intergenic
1123761903 15:23439950-23439972 GGAGGAGAAGATGCGGGAGCAGG - Exonic
1123761912 15:23439992-23440014 GGAGGAGAAGATGCGGGAGCAGG - Exonic
1123761921 15:23440034-23440056 GGAGGAGAAGATGCGGGAGCAGG - Exonic
1123761925 15:23440055-23440077 GGAGGAGAAGATGCGGGAGCAGG - Exonic
1123762145 15:23441373-23441395 GGAGGAGAAGATGCGGGAGCAGG - Exonic
1123762162 15:23441475-23441497 GGAGAAGGAGCTGCGGGAGCAGG - Exonic
1123762186 15:23441622-23441644 GGAGGAGGAGCTACGGGAGCAGG - Exonic
1124109511 15:26773101-26773123 GGAGGGGGAGGAGCGGGCGCTGG + Intronic
1124279421 15:28350295-28350317 GGAGGAGAAGATGCGGGAGCAGG - Intergenic
1124279425 15:28350316-28350338 GGAGGAGAAGATGCGGAGGCAGG - Intergenic
1124279447 15:28350484-28350506 GGAGGAGAAGATGCGGAGGCAGG - Intergenic
1124279473 15:28350652-28350674 GGAGGAGAAGATGCGGAGGCAGG - Intergenic
1124279544 15:28351087-28351109 GGAGGAGAAGGTGTGGAGGCAGG - Intergenic
1124279582 15:28351288-28351310 GGAGGAGAAGGTGTGGAGGCAGG - Intergenic
1124279594 15:28351351-28351373 GGAGGAGAAGGTGTGGAGGCAGG - Intergenic
1124279658 15:28351750-28351772 GGAGGAGAAGATGCGGAGGCAGG - Intergenic
1124279666 15:28351792-28351814 GGAGGAGAAGATGCGGAGGCAGG - Intergenic
1124303032 15:28559816-28559838 GGAGGAGAAGATGCGGAGGCAGG + Intergenic
1124303040 15:28559858-28559880 GGAGGAGAAGATGCGGAGGCAGG + Intergenic
1124303104 15:28560257-28560279 GGAGGAGAAGGTGTGGAGGCAGG + Intergenic
1124303116 15:28560320-28560342 GGAGGAGAAGGTGTGGAGGCAGG + Intergenic
1124303154 15:28560521-28560543 GGAGGAGAAGGTGTGGAGGCAGG + Intergenic
1124303225 15:28560956-28560978 GGAGGAGAAGATGCGGAGGCAGG + Intergenic
1124303251 15:28561124-28561146 GGAGGAGAAGATGCGGAGGCAGG + Intergenic
1124303273 15:28561292-28561314 GGAGGAGAAGATGCGGAGGCAGG + Intergenic
1124303277 15:28561313-28561335 GGAGGAGAAGATGCGGGAGCAGG + Intergenic
1124332501 15:28832451-28832473 GTCGGAGGAGGTGCGGGCGCGGG + Intergenic
1124333818 15:28842618-28842640 GGAGGAGCAGATGCGGAAGCAGG - Intergenic
1124333842 15:28842723-28842745 GGAGGAGCAGATGCGGAAGCAGG - Intergenic
1124333851 15:28842765-28842787 GGAGGAGCAGATGCGGAAGCAGG - Intergenic
1124333890 15:28842966-28842988 GGAGGAGCAGATGCGGAAGCAGG - Intergenic
1124333904 15:28843071-28843093 GGAGGAGCAGATGCGGAAGCAGG - Intergenic
1124333918 15:28843134-28843156 GGAGGAGCAGATGCGGAAGCAGG - Intergenic
1124333921 15:28843155-28843177 GGAGGAGCAGATGCGGAAGCAGG - Intergenic
1124333924 15:28843176-28843198 GGAGGAGCAGATGCGGAAGCAGG - Intergenic
1124333927 15:28843197-28843219 GGAGGAGCAGATGCGGAAGCAGG - Intergenic
1124333930 15:28843218-28843240 GGAGGAGCAGATGCGGAAGCAGG - Intergenic
1124333933 15:28843239-28843261 GGAGGAGCAGATGCGGAAGCAGG - Intergenic
1124333938 15:28843281-28843303 GGAGAAGGAGCTGCGGGAGCAGG - Intergenic
1124532106 15:30517324-30517346 GGAGGAGGAGATGTGGAGGCAGG + Intergenic
1124532125 15:30517441-30517463 GGAGGAGGAGATGTGGAGGCAGG + Intergenic
1124532176 15:30517753-30517775 GGAGGAGAAGATGCGGGAGCAGG + Intergenic
1124532185 15:30517810-30517832 GGAACAGGAGGTGAGGCTGCAGG + Intergenic
1124766468 15:32489835-32489857 GGAACAGGAGGTGAGGCTGCAGG - Intergenic
1124766477 15:32489892-32489914 GGAGGAGAAGATGCGGGAGCAGG - Intergenic
1124766528 15:32490204-32490226 GGAGGAGGAGATGTGGAGGCAGG - Intergenic
1124766547 15:32490321-32490343 GGAGGAGGAGATGTGGAGGCAGG - Intergenic
1124971133 15:34490513-34490535 GGTGGAGGAGGCGGGGCGGCGGG - Intergenic
1125477899 15:40060008-40060030 GGAACAAGAGGTGAGGCCGCGGG - Intergenic
1125727059 15:41873554-41873576 GGTGGAGGAGAAGCGGCCGCTGG - Exonic
1126398231 15:48242212-48242234 CCAGGAGGAGGTGTGGCTGCAGG - Intronic
1127670178 15:61187494-61187516 GGAGGAGGAGGGGTGGCGGTAGG + Intronic
1127969460 15:63947054-63947076 GGAGTAGGAGGTGGGGAAGCAGG - Intronic
1128078301 15:64841805-64841827 GGAGGGGGCGGTGGGGCCGGGGG - Intergenic
1129029750 15:72609625-72609647 GGAGCAGGAGGAGAGGCTGCGGG + Intergenic
1129029792 15:72609847-72609869 GGAGCAGGAGGAGAGGCTGCTGG + Intergenic
1129189077 15:73927202-73927224 GGAGACGGAGGTGCGGGCCCGGG - Exonic
1129239930 15:74245165-74245187 GGAGGAGGAGATCCGTCCTCAGG - Intronic
1129254201 15:74324955-74324977 GGAGGAGGAGGTGGGGGAGGAGG - Intronic
1129463580 15:75711938-75711960 GGATGAGGAGGTGTGGCAGGGGG + Intronic
1129605580 15:77023423-77023445 GGAGGTGGAGGTGGTGCGGCAGG + Intronic
1129721308 15:77879464-77879486 GGATGAGGAGGTGTGGCAGGGGG - Intergenic
1130259585 15:82344800-82344822 GGAGGAGCAGGAGAGGCTGCTGG - Exonic
1130269097 15:82434386-82434408 GGAGGAGCAGGAGAGGCTGCTGG + Exonic
1130281648 15:82524209-82524231 GGAGGAGCAGGAGAGGCTGCTGG + Intergenic
1130281662 15:82524287-82524309 GGAGGAGCAGGAGAGGCTGCTGG + Intergenic
1130281676 15:82524365-82524387 GGAGGAGCAGGAGAGGCTGCTGG + Intergenic
1130473018 15:84240371-84240393 GGAGGAGCAGGAGAGGCTGCTGG + Exonic
1130473031 15:84240449-84240471 GGAGGAGCAGGAGAGGCTGCTGG + Exonic
1130473045 15:84240527-84240549 GGAGGAGCAGGAGAGGCTGCTGG + Exonic
1130480432 15:84354436-84354458 GGAGGAGCAGGAGAGGCTGCTGG + Intergenic
1130480445 15:84354514-84354536 GGAGGAGCAGGAGAGGCTGCTGG + Intergenic
1130480459 15:84354592-84354614 GGAGGAGCAGGAGAGGCTGCTGG + Intergenic
1130491252 15:84433167-84433189 GGAGGAGCAGGAGAGGCTGCTGG - Intergenic
1130491266 15:84433245-84433267 GGAGGAGCAGGAGAGGCTGCTGG - Intergenic
1130491279 15:84433323-84433345 GGAGGAGCAGGAGAGGCTGCTGG - Intergenic
1130502835 15:84511967-84511989 GGAGGAGCAGGAGAGGCTGCTGG - Intergenic
1130502849 15:84512045-84512067 GGAGGAGCAGGAGAGGCTGCTGG - Intergenic
1130502862 15:84512123-84512145 GGAGGAGCAGGAGAGGCTGCTGG - Intergenic
1130595316 15:85245049-85245071 GGAGGAGCAGGAGAGGCTGCTGG + Intergenic
1130595330 15:85245127-85245149 GGAGGAGCAGGAGAGGCTGCTGG + Intergenic
1130906318 15:88243015-88243037 GGAGGAGGAGCTGCAGCTGCAGG + Intronic
1130994740 15:88897510-88897532 GCAGCAGGAGGTGGGGCCACAGG - Intergenic
1131094863 15:89648705-89648727 GGAGGAGGAAGGGCTGACGCAGG + Exonic
1131154632 15:90067377-90067399 GGAGGAGGAGGTGCTGGAGGTGG + Exonic
1131224424 15:90612053-90612075 GGAGGAGGAGGTGGAGGCGGAGG - Intronic
1131249500 15:90820959-90820981 GGAGGAGGAGACGGGGCCTCAGG + Intergenic
1131643308 15:94315163-94315185 GGAGGAAGAAGTGCAGCTGCAGG - Intronic
1132475982 16:138371-138393 GGAGGACGAGGCGGGGACGCAGG + Exonic
1132533860 16:467575-467597 GGAGGAGGTGCTGGGGCCTCAGG + Intronic
1132533875 16:467619-467641 GGAGGAGGTGCTGGGGCCTCAGG + Intronic
1132533883 16:467641-467663 GGAGGAGGTGCTGGGGCCTCAGG + Intronic
1132533905 16:467707-467729 GGAGGAGGTGCTGGGGCCTCAGG + Intronic
1132533928 16:467773-467795 GGAGGAGGTGCTGGGGCCTCAGG + Intronic
1132533950 16:467839-467861 GGAGGAGGTGCTGGGGCCTCAGG + Intronic
1132533993 16:467971-467993 GGAGGAGGTGCTGGGGCCTCAGG + Intronic
1132534032 16:468099-468121 GGAGGAGGTGCTGGGGCCTCAGG + Intronic
1132600462 16:770594-770616 GGTGGAGGAGCTGCGGCACCTGG - Exonic
1132668651 16:1093935-1093957 GAAGGGGCAGGTGGGGCCGCCGG - Exonic
1132673598 16:1112642-1112664 GGACGTGGAGGTGGGGCCTCAGG + Intergenic
1132700332 16:1219567-1219589 GGAAGAGGAGCTGAGGCTGCAGG - Intronic
1132706263 16:1244696-1244718 GGAGGAGGGTGTCCGGCCGTGGG + Intergenic
1132713524 16:1279512-1279534 CGAGGAGGAGGCACGGCCGAGGG + Intergenic
1132854008 16:2036790-2036812 GGAGGACGAGGCCCGGCTGCTGG + Exonic
1132875680 16:2135903-2135925 GGAGGAGGAGGAGCCGCGGCGGG - Intergenic
1133034823 16:3028758-3028780 GCAGAAGGAGCTGCGGGCGCAGG - Exonic
1134066590 16:11232451-11232473 GGAGGAGGAGGAGGGGCAGGGGG + Intergenic
1134519305 16:14911450-14911472 GGAGGAGGAGGAGCCGCGGCGGG + Intronic
1134554623 16:15154778-15154800 GGAGGAGGAGGAGCCGCGGCGGG - Intergenic
1134610909 16:15607147-15607169 GGAGGAGGAGGTGAGAGAGCAGG - Intronic
1134706975 16:16310105-16310127 GGAGGAGGAGGAGCCGCGGCGGG + Intergenic
1134960565 16:18402019-18402041 GGAGGAGGAGGAGCCGCGGCGGG - Intergenic
1135800345 16:25488684-25488706 GGAGGAGGGAGTGGGGCCACTGG + Intergenic
1136088541 16:27902558-27902580 GGAGGGAGAGGGGGGGCCGCTGG + Intronic
1136510759 16:30737114-30737136 AGAGGAGGAGGAGGGGCCGGGGG + Exonic
1136556460 16:31010397-31010419 GGAGGAGGAGGAGCCGTCGCAGG - Exonic
1136927793 16:34389769-34389791 GGAGGAGGAGCTGCTGCTCCCGG - Intergenic
1136976781 16:35022037-35022059 GGAGGAGGAGCTGCTGCTCCCGG + Exonic
1137665301 16:50246103-50246125 GGGGAAGGAGGAGCGGCCGCAGG - Intergenic
1138298894 16:55910150-55910172 GGAGGAGGGGGTGTGGCCACAGG - Intronic
1138349570 16:56339284-56339306 AGAGGAGGAGGTGCAGGCCCGGG - Intronic
1138507711 16:57486430-57486452 GGCGAGGGAGGCGCGGCCGCAGG + Exonic
1138514542 16:57528919-57528941 GCTGGAGGAGGCGCGGGCGCGGG - Exonic
1139264076 16:65623157-65623179 GGAGGAGGAGGTGAGGTCCTGGG + Intergenic
1139284269 16:65796919-65796941 GGAGGAGGAGGAGAGGGAGCAGG - Intergenic
1139390681 16:66605005-66605027 GGAGGAGGACGTCGGGGCGCGGG + Intronic
1139515332 16:67449305-67449327 GGAGGAGTGAGTGCGGCCTCTGG - Intronic
1139592619 16:67941957-67941979 GGAAGAGCAGGTGGGGCCTCGGG + Intronic
1139853746 16:69965361-69965383 GGAGGAAGAGGCGCGGCTGCTGG - Intergenic
1139882724 16:70188274-70188296 GGAGGAAGAGGCGCGGCTGCTGG - Intergenic
1140223198 16:73058466-73058488 GGAGGAGGAGGAGCAGGCGGCGG + Intronic
1140369786 16:74407245-74407267 GGAGGAAGAGGCGCGGCTGCTGG + Intergenic
1140519163 16:75566777-75566799 GGAGGAGGAGGGCCGGGGGCCGG + Intronic
1140978170 16:80080895-80080917 GGAGGAAGAGGTGGGGCGGTGGG + Intergenic
1141418996 16:83899495-83899517 GGAGGCGGCGGTGCTGCTGCAGG + Exonic
1141608548 16:85169152-85169174 GGAGGGGGCGGGGCGGCGGCGGG - Intergenic
1141808246 16:86356397-86356419 GGAGGAGGAGGTGTGGGAACTGG + Intergenic
1141839778 16:86567204-86567226 GGAGCGGGAGGGGCGGCCCCGGG - Intergenic
1141964965 16:87435680-87435702 GGAGGAGCAGGTGGTGCCGCTGG - Intronic
1142090407 16:88206868-88206890 GGAGGGGGAGGGGAGGCCGCGGG + Intergenic
1142090420 16:88206894-88206916 GGAGGGGGAGGGGAGGCCGCGGG + Intergenic
1142090492 16:88207044-88207066 GGAGGGGGAGGGGAGGCCGCGGG + Intergenic
1142090517 16:88207095-88207117 GGAGGGGGAGGGGAGGCCGTGGG + Intergenic
1142138448 16:88462011-88462033 GGAGGAGATGGGGAGGCCGCCGG - Intronic
1142373705 16:89696413-89696435 GGAGGAGGGGGTGGGGCGGAGGG + Exonic
1142760979 17:2041827-2041849 GGACGAGAAGGTGGCGCCGCTGG + Exonic
1142872281 17:2828646-2828668 GGGAGAGCAGGTGGGGCCGCGGG + Intronic
1142979561 17:3663798-3663820 GGAGGAGGTGGTGCGTCTGCTGG - Exonic
1143137485 17:4719945-4719967 GGAGGAGGAGGTGAGGTCAGGGG + Intronic
1143164176 17:4889727-4889749 GCGGGAGGAGGAGCGGCGGCAGG + Exonic
1143164177 17:4889730-4889752 GGAGGAGGAGCGGCGGCAGGCGG + Exonic
1143179051 17:4973021-4973043 GGAGGTGGAGGTGAGGCCAGGGG + Intronic
1143263978 17:5621844-5621866 GGAAGAGGAGAGGCAGCCGCTGG - Intergenic
1144030787 17:11320703-11320725 GGAGGAGGAGCAGCAGCAGCCGG + Intronic
1144533796 17:16067042-16067064 GGAGGACAAGGTGCAGCCGGTGG + Intronic
1144548027 17:16215582-16215604 GAAGGAGGAGGAGCCGGCGCTGG - Intronic
1144572437 17:16407988-16408010 GGAGGAGGAGGTGCGGTGGGAGG + Intergenic
1144828678 17:18120342-18120364 GGACGAGGAGGAGCTGCCCCCGG + Exonic
1146009178 17:29180188-29180210 GGAGGAGGAGGAGGAGCCGGCGG + Intronic
1146793111 17:35764137-35764159 GGAGGGCGAGGAGCCGCCGCGGG + Exonic
1147327146 17:39674997-39675019 GGAGGAGGAGGCAAGGCCCCTGG - Intronic
1147419347 17:40314445-40314467 GCAGGAGGAGGTGGGGCAGGTGG + Intronic
1147752453 17:42744746-42744768 GGAGGAGGAGCGGCGGGGGCGGG - Intronic
1147879603 17:43645536-43645558 GGAGCAGGACGTTGGGCCGCAGG - Intronic
1147971128 17:44219547-44219569 GGAGGAGCCGCTGCCGCCGCGGG - Intronic
1147971201 17:44219794-44219816 GGAGGAGGAGGAGCGGGAGGGGG + Intronic
1148553927 17:48566555-48566577 GGAGGAGGAGTTGCAAACGCAGG + Intronic
1148646963 17:49224788-49224810 CGAGCAGGGCGTGCGGCCGCGGG - Exonic
1148740070 17:49887710-49887732 GGAGGAGGAGGAGAGGGTGCTGG - Intergenic
1148861707 17:50607958-50607980 GGAAGAGGAGGCCCGGCGGCGGG + Exonic
1149486336 17:57045887-57045909 GGAGGCGGAGGCGGGGCTGCCGG - Intergenic
1149833656 17:59893316-59893338 GGAGGAGGGGGTGAGGCCCGGGG + Exonic
1150580897 17:66473058-66473080 GGAGGAGGAGAGGTGGCTGCAGG - Intronic
1150747203 17:67825671-67825693 GAAGGGGGAGGGGCGGGCGCAGG - Exonic
1150791843 17:68205614-68205636 GGAGGAGGAGGGACGGGCGCGGG - Intergenic
1150867392 17:68867939-68867961 GGAGGAGGAGGTTCGGGTGCTGG - Exonic
1151297025 17:73193201-73193223 GAAGGAGGAGCTGCGGCAGATGG + Exonic
1151358067 17:73571933-73571955 GGGGAAGGAGGAGCGCCCGCGGG + Intronic
1151486610 17:74404814-74404836 TGGGGAGGAGGTGGGGCCTCAGG - Intergenic
1151496957 17:74463631-74463653 GGAGGAGGAGATGAGGCCACAGG - Intergenic
1152364087 17:79845003-79845025 GGGGAAGGAGGTCCGGACGCGGG + Intergenic
1152375284 17:79915694-79915716 GGAGGAGGAGGTGGGGCCAGGGG + Intergenic
1152576508 17:81143585-81143607 GGAGGACCAGGTGTGGCCACGGG - Intronic
1152616322 17:81339565-81339587 GGAGAAGGAGATGCAGGCGCAGG + Intergenic
1152634888 17:81426890-81426912 GGGGGAGGAGCTGGGGCCGCTGG - Exonic
1152685876 17:81693686-81693708 GGAGGAGGAGGAGCTGCAGCTGG + Exonic
1152728945 17:81960624-81960646 TGAGTAGGAGGTGCAGGCGCAGG + Exonic
1152734097 17:81988512-81988534 GCAGGAGGTGGTGGGGCCGTTGG + Intronic
1152819600 17:82430040-82430062 AGAGGAGGAGGAGCAGCAGCAGG - Intronic
1153285154 18:3449995-3450017 GGGGGCGGCGGTGCGGACGCGGG - Intronic
1153515203 18:5895575-5895597 GGAGGAGGGGGTGGGGCGGGGGG - Intronic
1153794409 18:8609512-8609534 GGAGGAGGAGGAGGGGACCCGGG + Exonic
1153854951 18:9136675-9136697 GCAGCAGGAGGGGCGGGCGCCGG + Intronic
1154209491 18:12367328-12367350 GGAGGAGGAGGTGGTGGCGGTGG - Exonic
1154303969 18:13217703-13217725 GGACGCGGCGCTGCGGCCGCCGG - Intronic
1154427050 18:14280090-14280112 GGAGCAGGAGCTGGGGCTGCTGG - Intergenic
1154429777 18:14299622-14299644 GGAGCAGGAGCTGGGGCTGCCGG - Intergenic
1154432051 18:14315966-14315988 GGAGCAGGAGCTGGGGCTGCCGG - Intergenic
1156352884 18:36316017-36316039 GGAGAAGGAGGGGTGGCCCCGGG + Intronic
1157589684 18:48828912-48828934 GGAGGAGGAGGAGCAGGCGGGGG - Intronic
1157605429 18:48923200-48923222 AGAGGAGGAGCTGGGGCTGCAGG - Intronic
1158599772 18:58847254-58847276 GCGGGAGGAGCTGGGGCCGCAGG + Intergenic
1158893501 18:61893964-61893986 GGAGGGGGTGGCGGGGCCGCAGG - Intronic
1158893577 18:61894260-61894282 GCCGGAGGAGCGGCGGCCGCCGG - Intergenic
1158893653 18:61894513-61894535 GGAGGAGGGGGTGGAGCCGCCGG - Intergenic
1158953880 18:62522652-62522674 GGCGGAGGCGGGGCGGCAGCTGG + Intergenic
1158968235 18:62642515-62642537 GGAGGATGAGGTGCAGCCTTGGG - Intergenic
1159040175 18:63317929-63317951 AGAGGAGGAGGTAGGGACGCCGG + Intronic
1160393945 18:78558567-78558589 GGAGGAGGGAGGGCGGCCACGGG - Intergenic
1160699408 19:498665-498687 GGAGGAGGAGGAGGAGCCCCAGG + Exonic
1160818428 19:1046892-1046914 GGAGAAGGAGACGCGGCTGCGGG + Exonic
1160967774 19:1754101-1754123 GGCGGGGGCGGCGCGGCCGCCGG - Exonic
1160968134 19:1755489-1755511 GGCGGGGGAGGGGCGGCCCCGGG + Intronic
1160971385 19:1769255-1769277 GGAGGAGGAGGTGCTGGAGTTGG + Intronic
1161017990 19:1992920-1992942 GGAGGCGGAGGCGGGGCCGGGGG - Intronic
1161132503 19:2599449-2599471 GGAGGTGGAGGTGCGGACCTGGG + Intronic
1161241425 19:3225564-3225586 GGCGGGGCAGGTCCGGCCGCGGG + Intronic
1161318662 19:3631181-3631203 GGAGCAGCAGGTGTGGCCCCGGG - Exonic
1161404581 19:4084324-4084346 GGAGGGAGGGGTGGGGCCGCCGG + Intergenic
1161455237 19:4366635-4366657 GCAGGAGGCGGTGCAGCAGCGGG - Intronic
1161486679 19:4539662-4539684 GGAGGAGGAGGGGAAGCCCCAGG - Intronic
1161557798 19:4954412-4954434 GGAGGAGGAGGAGCAGCAGGAGG + Exonic
1161769202 19:6222268-6222290 GGAGGAGGAGGTGCGGGGCGAGG + Exonic
1161850904 19:6737541-6737563 AGAGGAGGGGGCTCGGCCGCGGG - Exonic
1161963414 19:7535072-7535094 GGAGTAGGGGGTGCGGCCTGGGG + Intronic
1162019690 19:7862870-7862892 GAATGAGGAGGCGGGGCCGCGGG - Intronic
1162488635 19:10977845-10977867 GGAGGAGGAGGTGGAGCCACAGG + Intronic
1162493282 19:11007904-11007926 GGAGGAGGAAGAGCAGCCGCAGG + Exonic
1163029819 19:14536988-14537010 GGAGGAGGAGGTGGGGCTTGAGG + Intronic
1163250219 19:16122409-16122431 GGAGCAGGAGGTGGAGCCCCTGG + Intronic
1163442433 19:17328704-17328726 GGAGGAGGAGGAGGCGGCGCTGG - Exonic
1163584012 19:18154302-18154324 TGAGGAGGAGGGGAGGCTGCCGG - Intronic
1163607052 19:18281273-18281295 GTAGGAGGCGGCGCGGCCGCAGG + Exonic
1163690899 19:18737730-18737752 GGAGGAGGAGGAGCAGCAGCAGG - Intronic
1164079659 19:21851585-21851607 GCAGGAGGAGCTGCGGCCCTGGG - Intronic
1164156438 19:22600322-22600344 GGAGCAGGAGGAGAGGCTGCTGG + Intergenic
1164244057 19:23415573-23415595 GTAGGAGGAGCTGTGGCCGGTGG - Intergenic
1164639361 19:29812632-29812654 CGTGGGGGAGGGGCGGCCGCGGG + Intronic
1165074658 19:33273991-33274013 GGAGGAGGAGAGGCAGCCTCAGG - Intergenic
1165321944 19:35091002-35091024 GGAGCAGGCAGGGCGGCCGCGGG - Intergenic
1165431563 19:35776044-35776066 GGAGGAGGAGGGGGCTCCGCCGG - Intronic
1165448248 19:35868539-35868561 GGAGGAGGAGGTGGCGGCGGTGG + Exonic
1165861244 19:38910700-38910722 GGAGAAGGGGGTGCGGGTGCTGG - Exonic
1165943013 19:39424656-39424678 GGAAGTGGAGGTGCAGCCGCTGG - Exonic
1166039276 19:40192034-40192056 GGAGGAGGAGGAGGGGGCGGTGG + Exonic
1166041582 19:40205967-40205989 GGAGGAGCAGCTGCGGCGGCGGG + Exonic
1166535942 19:43574882-43574904 TGAGGAGGAGGTGGGGTGGCAGG + Intronic
1166540001 19:43598969-43598991 GGAGGGGAAGGAGCGGGCGCAGG - Exonic
1166587654 19:43964988-43965010 TGAGGAGGAGCTGGGGCTGCTGG + Exonic
1166590264 19:43991586-43991608 TGAGGAGGAGCTGGGGCTGCTGG + Exonic
1166593839 19:44027061-44027083 TGAGGAGGAGCTGGGGCTGCTGG + Exonic
1166597223 19:44060493-44060515 TGAGGAGGAGCTGGGGCTGCTGG + Exonic
1166599430 19:44081053-44081075 CGAGGAGGAGCTGGGGCTGCTGG + Exonic
1166606583 19:44148809-44148831 TGAGGAGGAGCTGGGGCTGCTGG + Exonic
1166609005 19:44172126-44172148 GGAGGAGGAATTGGGGCTGCTGG + Exonic
1166620950 19:44299672-44299694 TGAGGAGGAGCTGGGGCTGCTGG - Exonic
1166624730 19:44340482-44340504 TGAGGAGGAGCTGGGGCTGCTGG - Exonic
1166731977 19:45064336-45064358 GGAGGAGGAGCGGCGGCTGCAGG - Exonic
1166831366 19:45641670-45641692 GGAGGATGTGGTCCGGCTGCGGG + Exonic
1166949437 19:46416662-46416684 GGAGGCGGAGGCGAGGCTGCAGG + Intergenic
1167217104 19:48171847-48171869 GGAGCAGGAGCTGCGGGAGCGGG + Exonic
1167270321 19:48502367-48502389 GGGGAAGGAGGTGAGGCCTCAGG - Intronic
1167360969 19:49030161-49030183 GTAGGTGGAGGGGCTGCCGCTGG + Intronic
1167363454 19:49042553-49042575 GTAGGTGGAGGGGCTGCCGCAGG + Intergenic
1167368058 19:49064989-49065011 GCAGGAGGAGGAGCTGCTGCCGG - Intronic
1167383984 19:49153503-49153525 GGAGGAGGAGGAGGGGCTGGAGG - Exonic
1167586166 19:50377006-50377028 GGAGGAGGCGGGGCGGGGGCGGG + Intronic
1167609594 19:50500808-50500830 GGAGGAGGAGCTGGGGGCGCTGG - Intergenic
1167648021 19:50716316-50716338 GGAGGAGGAGAGGCTGCTGCGGG - Exonic
1167799478 19:51730653-51730675 GGAGGAGGGGGTGGGGGGGCTGG + Intergenic
1168097449 19:54123761-54123783 GGAGGAGGAGCTGGAGCGGCTGG + Exonic
1168311500 19:55463275-55463297 AGAGGTGGAGGTGGGGCCCCTGG + Intergenic
1202638250 1_KI270706v1_random:60325-60347 GGAGCAGGAGCTGCGGCTGCTGG + Intergenic
924985330 2:264670-264692 GGAGGAGGAGCTGCGGGGGTGGG - Intronic
925039162 2:716812-716834 GGAGGAGGAGGGGAGGCCTTGGG + Intergenic
925311550 2:2887950-2887972 GGAGGAGGAGGTAGGGGCGCAGG - Intergenic
926089867 2:10043177-10043199 GGAGGGGGCGGGGCGGCGGCTGG - Intronic
926225126 2:10961725-10961747 GGAGGCGGAGGGGAGGCGGCTGG - Intergenic
926304582 2:11628792-11628814 AGAGGAGGAGGAGAGGCAGCCGG + Intronic
926457085 2:13080290-13080312 GTAAGAGGAGGTGCGGCCTATGG + Intergenic
926703514 2:15819921-15819943 GGAGGTGGAGGTCAGGCGGCGGG + Intergenic
927645945 2:24877093-24877115 GGAGGAGGAGGGGCTGCCTTGGG - Intronic
927694572 2:25231177-25231199 GGGGGAGGAGGGGCTGCCTCAGG - Exonic
927812475 2:26187677-26187699 AGAGGAGGAGGAGGGGGCGCAGG - Exonic
927843546 2:26460081-26460103 CGAGGAGGAGGAGCAGCAGCAGG + Exonic
927847078 2:26477159-26477181 GGCGGACGAGGTGCGGCCCAAGG - Exonic
928114652 2:28538372-28538394 GCAGCAGGAGGTGAGGCCACGGG + Exonic
928158043 2:28894608-28894630 GGAGGAGGAAGTGAGGCGGAGGG - Intergenic
928278817 2:29926047-29926069 GGAGGAGGAGCAGCAGCAGCAGG + Intergenic
928314004 2:30232197-30232219 GGCTGAGCTGGTGCGGCCGCAGG + Intronic
928823660 2:35392341-35392363 AGCGGGGGAGGTGCGGCCGGGGG - Intergenic
928904560 2:36356057-36356079 GGAGGAGGGGAAGCTGCCGCCGG + Exonic
929437724 2:41940934-41940956 GGAGGAGGAGGGGAGGCCGTGGG + Intronic
930031523 2:47060986-47061008 GGAGGAGGTGGTGGGAGCGCGGG - Intronic
930621798 2:53651815-53651837 GAAGGAGGAGGTGGGGAGGCAGG - Intronic
931253780 2:60553850-60553872 GGAGGGGGCGCTGGGGCCGCGGG + Intergenic
932216601 2:69970149-69970171 GGAGGAGGAGCTGAGGGCACTGG - Intergenic
932562730 2:72887370-72887392 GCAGGAGGCGGTGCGGCCGCGGG - Exonic
932765309 2:74465372-74465394 GGAGGCGGAGGCGCAGGCGCTGG - Exonic
933667022 2:84971726-84971748 GGAGGGGGAGGGGAGGCGGCGGG + Intronic
934176957 2:89584987-89585009 GGAGGAGGTGCTGTGCCCGCTGG + Intergenic
934287264 2:91659347-91659369 GGAGGAGGTGCTGTGCCCGCTGG + Intergenic
934882524 2:97996050-97996072 GGACGAGGAGGTGGGGCCCAGGG - Intergenic
935112297 2:100104747-100104769 AGGGGAGGAGGGGCGGGCGCAGG - Intronic
935605942 2:104972321-104972343 GGAGGAGGAGATGCAGCACCTGG - Intergenic
937086762 2:119177083-119177105 GGGGGAGGAGGTACGGTCCCTGG + Intergenic
937099067 2:119254713-119254735 GGAGGAGGAGGTCTGGCGGATGG + Exonic
937249594 2:120515135-120515157 GGAGGAGAAGGTGGGGCAGAAGG - Intergenic
937264166 2:120605703-120605725 TGAGGAGGAGGTGGGGTGGCGGG - Intergenic
937362201 2:121237216-121237238 GGAGCTGGAGGTGAGGCCACAGG - Intronic
938072513 2:128316128-128316150 GGAGGACCAGGTGGGGCCGATGG - Intronic
938073277 2:128319200-128319222 GGAGGAGGGGGTACGGACCCAGG - Intergenic
938352358 2:130608398-130608420 GTAGGAGGAGGTTCGGGAGCTGG + Intergenic
938767185 2:134468188-134468210 GTATGAGGAGGTGGGGCCTCTGG + Intronic
940116987 2:150219960-150219982 GGAGGACGGGGTGGGGCCTCAGG - Intergenic
941112100 2:161427135-161427157 GGAGGAGCACGTGCGGTCGGTGG + Intronic
941800702 2:169656484-169656506 GGAGAAGGAGGTGCGGGAGGAGG + Intronic
941978933 2:171434143-171434165 GGAGGAGGCGGGGCCGCGGCAGG + Intronic
942044391 2:172090904-172090926 GGAGGAAGTGGTGGGGCTGCTGG + Intergenic
942296728 2:174524668-174524690 GGAGGAGAAGGTGACGCCGCAGG - Intergenic
943162827 2:184277766-184277788 GGAGGTGGAGGTGAGGCCCCAGG - Intergenic
943645944 2:190408228-190408250 GGAGGAGGAGGAGCCGCAGCGGG + Intergenic
944221731 2:197310439-197310461 GGAGGACTGTGTGCGGCCGCCGG - Intronic
944457507 2:199911042-199911064 GCAGCAGCAGGGGCGGCCGCAGG - Intergenic
944530057 2:200658908-200658930 GAAAGAGGAGGTGAGGCCCCAGG - Intronic
944673642 2:202016752-202016774 GGAGGAGGAGGTGTGGGGGCGGG + Intergenic
944822110 2:203441277-203441299 GGAGGAGGAGGTGGGGGTGGCGG + Exonic
946370651 2:219279509-219279531 GGCGGAGGAGGTGCGGCCGGGGG + Exonic
946661721 2:222008158-222008180 GGAGGATTAGGTGTGGCAGCTGG - Intergenic
947740915 2:232484524-232484546 GGAAGAGGAGGTGGTGCTGCTGG - Exonic
947749373 2:232524713-232524735 GGAGGAAGAGGAGAGGCCCCGGG - Intronic
947752370 2:232539759-232539781 GCAGGAGGAGCAGCGGCCCCTGG - Exonic
948027060 2:234786665-234786687 GGAGGAGGAGGAGCTGAAGCAGG + Intergenic
948206383 2:236164656-236164678 GGAGGGGGAGGTGCCGGGGCCGG + Intergenic
948243500 2:236458150-236458172 GGAGTAGGAGGTAGGGCCGAAGG + Intronic
948378797 2:237539224-237539246 GGAGGTGGGGGTGAGGCAGCAGG + Intronic
948438042 2:237967159-237967181 GCGGGGCGAGGTGCGGCCGCCGG + Intronic
948728346 2:239948037-239948059 GGTGGAGGAGGTGAGGTCGGGGG + Intronic
948751890 2:240137830-240137852 TGAGGAGCAGGTGGGGTCGCGGG - Intergenic
949045097 2:241869031-241869053 GGGGGTGGGGGTGGGGCCGCGGG + Intergenic
1170204684 20:13785281-13785303 GAAGGAGGAGGTGAGCCCGCGGG + Exonic
1171059709 20:21944418-21944440 GGTGGATGCGGTGCGGCAGCTGG + Intergenic
1171123668 20:22584706-22584728 GGAGGAGGAGGTGTGGACCGCGG + Intronic
1171472386 20:25382557-25382579 GGAGGAGAAGTTGCAGCAGCGGG + Intronic
1171484436 20:25476992-25477014 GGAGCTGGAGGAGCCGCCGCAGG - Exonic
1171884839 20:30644388-30644410 GGAGCAGGAGATGGGGCTGCTGG + Intergenic
1172090851 20:32431442-32431464 GGAGGAAGAGGAGCTGCTGCTGG - Exonic
1172118661 20:32585343-32585365 GGAGGAAGAGCCGCGGCAGCGGG - Intronic
1172528529 20:35615858-35615880 GGGAGGGCAGGTGCGGCCGCGGG + Intergenic
1173002083 20:39111739-39111761 GGAGGAGGAGGAGGGGCAGGGGG + Intergenic
1173248057 20:41349813-41349835 GGAGCTGGAGGTGCGGACCCCGG + Exonic
1173685240 20:44918939-44918961 GGAGGCGGAGCTGGGGGCGCGGG + Exonic
1173704696 20:45101113-45101135 GGAGGAGGGAGTGAGGCCGCTGG + Intergenic
1173791944 20:45833779-45833801 GCAGGAGGCGGGGCGGCGGCAGG + Intergenic
1173804840 20:45917760-45917782 GGAGGAGAAGGTGCAGTCACTGG + Intergenic
1174063620 20:47849369-47849391 TGAGGAGGAGGTGGGGAGGCAGG + Intergenic
1175238309 20:57527356-57527378 GGAGGAGGATGAGCGTCCGAGGG + Intergenic
1175402969 20:58711082-58711104 GGAGGAGGAGGAGAGGAGGCGGG - Intronic
1175682367 20:60999051-60999073 GGAGGAGCAGGTGCGCCCCATGG + Intergenic
1175809022 20:61847499-61847521 GCAGGAGGTGGTGGGGGCGCTGG - Intronic
1175889556 20:62310255-62310277 GGAACTGGAGGTGCGGCCCCTGG - Exonic
1175976438 20:62712663-62712685 GGAGGAGGAGCTGGGGGCTCAGG + Intronic
1175981284 20:62739961-62739983 GGACGAGGCGGTGCGGCCAGGGG - Intronic
1176122753 20:63461571-63461593 GGGGGAGGAGGGCCGGCCCCCGG - Intronic
1176125392 20:63472658-63472680 GGCGGAGCCGGCGCGGCCGCGGG - Intergenic
1176170241 20:63693442-63693464 GGAGGTGGAGGTGGTGCTGCTGG - Intronic
1176235347 20:64051152-64051174 GCACCAGGAGGTGCGGCCCCTGG + Intronic
1176549265 21:8214446-8214468 GGAGGAGGAGGAGGGGCGGCGGG - Intergenic
1176557158 21:8258669-8258691 GGAGGAGGAGGAGGGGCGGCGGG - Intergenic
1176568197 21:8397484-8397506 GGAGGAGGAGGAGGGGCGGCGGG - Intergenic
1176576100 21:8441704-8441726 GGAGGAGGAGGAGGGGCGGCGGG - Intergenic
1178321446 21:31609191-31609213 GGAGGAGGGGGTGAGGGAGCAGG + Intergenic
1178331384 21:31696584-31696606 GGAGGAGGAGAGGCAGCAGCGGG + Exonic
1178351130 21:31873616-31873638 GGAGGAGGAGCTGCGAGCGCGGG + Exonic
1178439157 21:32584406-32584428 GGGGGAGAAGGAGCGGCTGCGGG - Intronic
1179197919 21:39183298-39183320 GGAGGAGGAGGAGGGGCGGAGGG - Exonic
1179730022 21:43362479-43362501 GGAGGAGGTGGGGTTGCCGCCGG - Intergenic
1179926855 21:44539458-44539480 GGAGGAGGAGGGTCTGCAGCAGG + Exonic
1179929558 21:44558245-44558267 GGAGGAGGAGGGTCTGCAGCAGG + Exonic
1179931651 21:44574816-44574838 GGAGGAGGAGGGTCTGCAGCAGG - Exonic
1179932571 21:44579919-44579941 GGAGGAGGAGGGTCTGCAGCAGG + Exonic
1179934116 21:44591576-44591598 GGAGGAGGAGGATCTGCAGCAGG + Exonic
1179935514 21:44601523-44601545 GGAGGAGGAGGGTCTGCAGCAGG - Exonic
1179937055 21:44612702-44612724 GGAGGAGGAGGGTCTGCAGCAGG - Exonic
1179940768 21:44637962-44637984 GGAGGAGGAGGGTCTGCAGCAGG - Exonic
1179948697 21:44697761-44697783 GGAGGAGGAGGGTCTGCAGCAGG - Exonic
1180001238 21:44996489-44996511 TGAGGATGAGGTGCTGCTGCTGG + Intergenic
1180363716 22:11921554-11921576 GGAGCAGGAGCTGTGGCTGCTGG - Intergenic
1180615000 22:17121031-17121053 GGAGGAAGAGGGGCTGCAGCCGG + Exonic
1180695501 22:17749192-17749214 GGAGGAGGATGTGATGCAGCGGG + Intronic
1180796749 22:18609565-18609587 GGAGGAGAATGGGCGGCTGCAGG - Exonic
1181224975 22:21385706-21385728 GGAGGAGAATGGGCGGCTGCAGG + Exonic
1181253657 22:21549107-21549129 GGAGGAGAATGGGCGGCTGCAGG - Exonic
1182301038 22:29337295-29337317 GGAGGAGGACGTGCTGGCGGTGG + Intronic
1182442418 22:30372145-30372167 GGAGGAGCAGGTGCAGCAGTTGG + Exonic
1182527831 22:30932663-30932685 GGAGGAGGAGGTGGGCCCTGTGG - Exonic
1182552564 22:31108015-31108037 GGTGGAGGGGGTGCGGCTTCTGG + Intronic
1182806163 22:33072290-33072312 GGAGGAGGAGGTGGGGGAGGAGG + Intergenic
1183047197 22:35229560-35229582 GGGGGTGGAGGTGCAGCAGCAGG + Intergenic
1183258118 22:36776112-36776134 GGAGGAGGAGGCGGGGCAGGTGG - Exonic
1183487587 22:38097712-38097734 GGAGGAGGATGGGCGGCTGGTGG + Intronic
1183593275 22:38794055-38794077 GCAGGAGCAGGTGAGGCCCCGGG - Exonic
1183630994 22:39032455-39032477 GGAGGAGGTGGTGAGGCAGGGGG - Exonic
1183683780 22:39350257-39350279 GAAGGAGGAGCGGCGGCAGCGGG - Intronic
1183830328 22:40415499-40415521 GGAGGAGGAGGAGCGGCTGAGGG - Intronic
1183929870 22:41229859-41229881 GGAGGAGGAGGGGCCGGGGCCGG - Intronic
1184121356 22:42452631-42452653 GGAGGAGGAGGAGTGGCAGGCGG - Intergenic
1184382602 22:44155295-44155317 GGAGGCGGTGGTGGGGCCTCTGG + Intronic
1184620306 22:45671826-45671848 GGAGGAGGAGACGGCGCCGCGGG - Exonic
1184852250 22:47127736-47127758 GCAGGAGGAGCTGGGGCCACAGG + Intronic
1184918282 22:47588314-47588336 GGAGGAGCAGGTGAGGAGGCAGG - Intergenic
1185118100 22:48949383-48949405 GGAGGAGGGGGTGAGGCTGGAGG - Intergenic
1185294447 22:50046331-50046353 GGAGAGGGAGGAGCGGCTGCAGG + Intronic
1185384120 22:50523958-50523980 GGTGCAGGTGGTGCGGCAGCTGG - Exonic
1185399338 22:50607868-50607890 GGAGGAGGAGGTGCTGGCATAGG + Intronic
1203254150 22_KI270733v1_random:130762-130784 GGAGGAGGAGGAGGGGCGGCGGG - Intergenic
1203262206 22_KI270733v1_random:175841-175863 GGAGGAGGAGGAGGGGCGGCGGG - Intergenic
950432677 3:12959998-12960020 GGAGGGGGAGGTGCGGTCGCAGG - Intronic
950563651 3:13750841-13750863 TGAGGAGGAGGTGGGGGCTCTGG + Intergenic
950667413 3:14505819-14505841 GGAGGGCAAGGTGAGGCCGCAGG - Intronic
950710563 3:14810605-14810627 GGAGGAGGGGGCGCGAGCGCGGG - Intergenic
950902940 3:16513456-16513478 GGAGGAGAAGGCGCGGTCGCGGG + Exonic
951485228 3:23203001-23203023 GGAGGAGGAGGGGCGGGGGGAGG + Intronic
953228560 3:41043384-41043406 GGAAGAGGAGGTGTGGGCACTGG + Intergenic
953561381 3:43995833-43995855 GGTGGGTGAGGTGTGGCCGCGGG + Intergenic
954111312 3:48434948-48434970 GGAGGCGGTGGTGCAGCCCCAGG + Exonic
954222418 3:49162879-49162901 GGATGATGAGGTGCGGCAGCGGG - Exonic
954334673 3:49909348-49909370 AGAGGAGCAGGAGCGGCTGCTGG - Exonic
954370374 3:50166900-50166922 GGAGGAGGAGGTGGGTCCCCCGG + Intronic
954380747 3:50217762-50217784 GAAGGAGAAGGTGCAGCTGCAGG + Exonic
954412008 3:50374902-50374924 GGAGGAGGGGATGCTGCAGCTGG - Intronic
955161437 3:56468322-56468344 GGAGGAGCAGGAGCCGGCGCCGG + Exonic
955307396 3:57848167-57848189 GGAGGAGGAGGAGCAGGAGCAGG - Intronic
955347655 3:58173100-58173122 GGAGGAGGAGGTGGGGGCGGAGG - Intergenic
955387459 3:58491422-58491444 GCAGGAGGAGCTCTGGCCGCAGG + Intergenic
955997028 3:64688046-64688068 GGCGGAGGCGGGGGGGCCGCGGG + Intergenic
958868253 3:99526338-99526360 GGAGTAGGAGGTGGGGCCTTTGG - Intergenic
959902932 3:111680153-111680175 GGAAGAGGGTGTGCGGCCACAGG - Intronic
960120847 3:113947819-113947841 GGAGGAGGAGCCTCGCCCGCGGG + Intergenic
961588345 3:127954727-127954749 GCAGGAGGAGCTGAGGCTGCAGG - Intronic
961641356 3:128366535-128366557 GGAGGAGGAGGAGCAGGAGCTGG + Intronic
962222223 3:133573667-133573689 GGAGGAAGAGGCGCGCGCGCAGG - Intergenic
962630267 3:137268944-137268966 GGAGGAGGAGGTGCTAGCCCTGG - Intergenic
962808925 3:138945863-138945885 GGAGGCGGGGGTGCGGCCGGCGG + Exonic
963133171 3:141876763-141876785 GCGAGAGGAGCTGCGGCCGCGGG - Exonic
963939596 3:151085965-151085987 GGAAGAGGAGCTGGGGCCGTGGG + Intronic
964570767 3:158105768-158105790 GGAGGAGGAGGAGCAGGCGGAGG - Exonic
965165654 3:165192798-165192820 GGAGGAGAAGGGGCTGCAGCAGG + Intronic
966887827 3:184386545-184386567 GGCCGAGGGGGTGCGGGCGCTGG + Exonic
967055396 3:185825261-185825283 GGAGGAGGAGCAGCGGCGGGCGG + Intergenic
967685276 3:192409903-192409925 GGAGGCGGCGGCGCGGCGGCGGG - Intronic
968471591 4:785022-785044 GCAGGAGGAGGCGCAGGCGCAGG + Exonic
968473562 4:792522-792544 GAAGGAGGAGGAGCGGCAGGAGG - Exonic
968521265 4:1035809-1035831 GGAGGAGCAGGCACGGCCTCAGG + Intergenic
968601752 4:1513010-1513032 GGGGGAGGGGGTGCGGGGGCCGG - Intergenic
968660082 4:1795238-1795260 GGTGCCGGAGGGGCGGCCGCGGG + Intronic
968737642 4:2305493-2305515 GGAGGAGGAGCTGCACACGCTGG - Exonic
968905657 4:3449512-3449534 GGAGGGGAAGGCGGGGCCGCAGG - Intergenic
968909037 4:3467262-3467284 GGAGGAGGGGGAGAAGCCGCAGG - Intronic
969021704 4:4143548-4143570 GGAGGAGGAGGCGCCGCCCGCGG - Intergenic
969367836 4:6709617-6709639 GCAGGAGGAGATGCGGCCCCTGG - Exonic
969442330 4:7224730-7224752 GGAGGAGGAGGTGTGGCACTGGG + Intronic
969467543 4:7366532-7366554 GGAGGAGGGGGTGAGGCTGGAGG - Intronic
969536248 4:7757613-7757635 GGGGGCGGGGGTGGGGCCGCAGG - Intergenic
969732163 4:8963867-8963889 GGAGGAGGAGGCGCCGCCCGCGG + Intergenic
969791758 4:9497952-9497974 GGAGGAGGAGGCGCCGCCCCCGG + Intergenic
970194622 4:13542394-13542416 GGAGGAGGAGGAGGAGCCGGCGG - Exonic
971019042 4:22516014-22516036 GGAGGAGGCGGTGCTCGCGCCGG - Exonic
971043382 4:22778944-22778966 GGAGGAAGAGGCGCGGGCGCAGG - Intergenic
971320423 4:25601028-25601050 GGGGCAGGGGGTGAGGCCGCAGG + Intergenic
972533073 4:39977618-39977640 CGAGGAGGAGCAGCCGCCGCGGG + Exonic
972933540 4:44104234-44104256 GGAGGATTAGGTGGGGCCACTGG + Intergenic
973179665 4:47252089-47252111 GGAGTAGGAGGGGGGGCAGCGGG - Intronic
973613674 4:52659295-52659317 GGAGGAGGAGGCGGCGGCGCGGG + Exonic
973754779 4:54064246-54064268 GGAGGACGAGGAGCGGGCCCTGG - Exonic
973982008 4:56315056-56315078 GGTGGAGGAGCTGCGGTGGCAGG + Exonic
975585100 4:75941014-75941036 GGAGGAGGAGGAGCTGGGGCTGG + Exonic
976183953 4:82427222-82427244 GGTGGAAGAGGTGCTGCAGCTGG - Exonic
976561927 4:86511707-86511729 GGAGGAGGAGGAGCGGGAGCAGG + Intronic
977607335 4:98995978-98996000 GGAGGAGGAAACGCGGCCGGGGG - Intronic
977694479 4:99950592-99950614 GGAGGAGGAGCTGAGACCTCAGG + Intergenic
978333864 4:107644954-107644976 GGAGGAGGAGGACAGGGCGCCGG + Exonic
978382308 4:108142197-108142219 GGAGGAGCAGGTAAGGGCGCGGG - Intronic
978749618 4:112232059-112232081 GGAGGAGGAGCGGCGGCGCCTGG + Exonic
979349682 4:119629036-119629058 GAAGGAGGCCGCGCGGCCGCTGG + Intergenic
981067179 4:140497909-140497931 GGAGGAGGAGGTCGGGGCGCGGG + Intronic
982462268 4:155685536-155685558 GGTGGAGGAGCTGCGGAAGCTGG - Intronic
984206548 4:176793061-176793083 GCCGGGGGAGGTGGGGCCGCCGG - Intergenic
984462922 4:180058814-180058836 GGAGGAGGAGGAGGGGAAGCCGG + Intergenic
984715036 4:182917383-182917405 GGAGGAGGCGGGGCCGCCGCGGG + Intronic
985129627 4:186726659-186726681 AGTTGAGGAGTTGCGGCCGCCGG + Intronic
985215632 4:187650486-187650508 GGAGGAGGAGCTGCTGCTACAGG + Intergenic
1202765589 4_GL000008v2_random:146183-146205 GGAGCAGGAGCTGCGGCTGCTGG + Intergenic
985544235 5:501135-501157 GGAGGAGGAAGGGCCGGCGCTGG + Intronic
985628956 5:1005035-1005057 GGAGGAGGAGGTGCGGCCGCAGG - Intergenic
985763628 5:1764976-1764998 GGAGGAGGAGGAGGGGCTCCTGG - Intergenic
985805206 5:2038640-2038662 GGCGGCGGAGGTGCGGCCCCGGG - Intergenic
986305894 5:6515966-6515988 GGTGGAGGAGGTACGGCGGGAGG + Intergenic
986391283 5:7289965-7289987 GTCGGAGGAGGTGCGGGCGCGGG + Intergenic
986392577 5:7300079-7300101 GGAGGAGAAGGTCCGGGGGCAGG - Intergenic
986392593 5:7300163-7300185 GGAGGAGCAGATGCGGAAGCAGG - Intergenic
986392602 5:7300205-7300227 GGAGGAGCAGGTGCGGAAGCGGG - Intergenic
986392607 5:7300226-7300248 GGAGGAGCAGGTGCGGAAGCGGG - Intergenic
986392622 5:7300310-7300332 GGAGGAGCAGATGCGGAAGCAGG - Intergenic
986392628 5:7300352-7300374 GGAGGAGCAGATGCGGAAGCAGG - Intergenic
986392633 5:7300394-7300416 GGAGGAGCAGGTGCGGAAGCAGG - Intergenic
986392637 5:7300415-7300437 GGAGGAGCAGGTGCGAAAGCAGG - Intergenic
986392646 5:7300478-7300500 GGAGGAGCAGATGCGGAAGCAGG - Intergenic
986392649 5:7300499-7300521 GGAGGAGCAGATGCGGAAGCAGG - Intergenic
986392652 5:7300520-7300542 GGAGGAGCAGATGCGGAAGCAGG - Intergenic
986392655 5:7300541-7300563 GGAGGAGCAGATGCGGAAGCAGG - Intergenic
986392668 5:7300625-7300647 GGAGGAGCAGATGCGGAAGCAGG - Intergenic
986392677 5:7300667-7300689 GGAGGAGCAGGTGCGGAAGCAGG - Intergenic
986392681 5:7300688-7300710 GGAGGAGCAGGTGCGGAAGCAGG - Intergenic
986392685 5:7300709-7300731 GGAGGAGCAGGTGCGGAAGCAGG - Intergenic
986392689 5:7300730-7300752 GGAGGAGCAGGTGCGGAAGCAGG - Intergenic
986392693 5:7300751-7300773 GGAGGAGCAGGTGCGGAAGCAGG - Intergenic
986392697 5:7300772-7300794 GGAGGAGCAGGTGCGGAAGCAGG - Intergenic
986392701 5:7300793-7300815 GGAGGAGCAGGTGCGGAAGCAGG - Intergenic
986392705 5:7300814-7300836 GGAGGAGCAGGTGCGGAAGCAGG - Intergenic
986392709 5:7300835-7300857 GGAGGAGCAGGTGCGGAAGCAGG - Intergenic
986392713 5:7300856-7300878 GGAGGAGCAGGTGCGGAAGCAGG - Intergenic
986392717 5:7300877-7300899 GGAGGAGCAGGTGCGGAAGCAGG - Intergenic
986392721 5:7300898-7300920 GGAGGAGCAGGTGCGGAAGCAGG - Intergenic
986392725 5:7300919-7300941 GGAGGAGCAGGTGCGGAAGCAGG - Intergenic
986392729 5:7300940-7300962 GGAGGAGCAGGTGCGGAAGCAGG - Intergenic
986392733 5:7300961-7300983 GGAGGAGCAGGTGCGGAAGCAGG - Intergenic
986392737 5:7300982-7301004 GGAGGAGCAGGTGCGGAAGCAGG - Intergenic
986392741 5:7301003-7301025 GGAGGAGCAGATGCGGGAGCAGG - Intergenic
986392750 5:7301045-7301067 GGAGGAGCAGATGCGGAAGCAGG - Intergenic
986392767 5:7301108-7301130 GGAGGAGCAGATGCGGAAGCGGG - Intergenic
986392771 5:7301129-7301151 GGAGGAGCAGATGCGGAAGCGGG - Intergenic
986392775 5:7301150-7301172 GGAGGAGCAGATGCGGAAGCGGG - Intergenic
986392786 5:7301192-7301214 GGAGGAGCAGATGCGGGAGCGGG - Intergenic
986392791 5:7301213-7301235 GGAGGAGCAGATGCGGGAGCGGG - Intergenic
986392809 5:7301318-7301340 GGAGAAGGAGCTGCGGGAGCAGG - Intergenic
986415152 5:7520811-7520833 GGAGGAGGAGGTGAGGACGCTGG - Exonic
986608629 5:9546184-9546206 GGAGGAGGCGGCGCGGCGGCGGG - Intergenic
987050763 5:14144775-14144797 GCGGGAGGAGGCGCCGCCGCTGG - Intronic
987108633 5:14664635-14664657 GCGCGAGGAGGTGCGGCCGGAGG - Intergenic
987369436 5:17179812-17179834 GAAGGAGGAGGAGTGGCTGCTGG - Intronic
988444447 5:31269832-31269854 GGAGGAGAAGGAGGGGCAGCAGG - Intronic
989104557 5:37849392-37849414 GGAGGAGGAGTGGCGGCGGGAGG - Intergenic
990743702 5:58937236-58937258 GGAGGGGGAGGGGCGGGGGCGGG + Intergenic
992079640 5:73222932-73222954 GGAGGAGGAGGGGGAGCCACTGG + Intergenic
992118491 5:73565651-73565673 GGAGTAGGAGGTGTGACCGGAGG - Exonic
993386540 5:87268506-87268528 GGAGGAGGCGGCGCGGCAGCGGG + Exonic
993625463 5:90219357-90219379 GGAGGAGGAGGAGCGGGAGGAGG + Intergenic
994072964 5:95621418-95621440 GGAGGACGAGGAGGGGCCCCGGG + Exonic
994246990 5:97489302-97489324 AGAAGAGGAGGTGAGGCAGCAGG + Intergenic
995388308 5:111612244-111612266 GGTGGAGGAGGGGCGGGGGCGGG + Intergenic
997485290 5:134226016-134226038 GGAGGAGGCGCAGCGGCCGACGG - Exonic
998005541 5:138654520-138654542 GGAGGAGGAGGTGAGGATGTGGG + Intronic
999188462 5:149730236-149730258 GGAGGAGGGAGTGAGGCCGGCGG - Intergenic
999324518 5:150635320-150635342 AGAGGAGGATGTGCTGCTGCCGG + Intronic
999769078 5:154761464-154761486 GGAGGAGGAGGAGGAGCAGCCGG + Intronic
999895736 5:156031389-156031411 GGAGGAGGAGGAGTGGCAGTGGG + Intronic
1000625764 5:163536453-163536475 GGTGGGGGAGGTGCGGCAGGGGG - Intergenic
1001196760 5:169679957-169679979 GTAGGAGGAGGTGGGGCTGATGG - Intronic
1001251289 5:170148907-170148929 GGAGGAGGAGGTACTGCCCTGGG + Intergenic
1001286373 5:170426946-170426968 GAGGGAAGAGGCGCGGCCGCAGG + Intronic
1001446714 5:171790890-171790912 AGAGGAAGAGGTGCAGCAGCTGG + Exonic
1001556554 5:172641209-172641231 GGAGGAGGAGGCGGAGCCACCGG - Intergenic
1001960722 5:175878987-175879009 GCAGGAGGCGCTGCGGCAGCAGG + Exonic
1002021453 5:176366391-176366413 GGAGGACGAGGAGCCGGCGCTGG + Exonic
1002051855 5:176575812-176575834 GGATGAGGAGGTGCAGCTGCAGG + Exonic
1002186148 5:177455684-177455706 GTCGGAGGAGGTGAGGCCGCCGG - Intronic
1002291744 5:178205041-178205063 CGCGGGGTAGGTGCGGCCGCGGG + Exonic
1003111951 6:3258483-3258505 GGAGGAGGAGGTGGGACGGGAGG + Intronic
1003120804 6:3317855-3317877 GAAGGAAGAGCTGCGGCAGCTGG - Intronic
1003325086 6:5085185-5085207 GGGCGGGGAGGCGCGGCCGCTGG - Exonic
1004043891 6:12008986-12009008 GGAGGAGGGGATTCGGCCGGTGG + Intronic
1004044494 6:12011893-12011915 GCGGGAGGAGGGGAGGCCGCGGG - Intronic
1004186859 6:13428411-13428433 GGAGGAGGGGGTGCCGCCTGAGG + Intronic
1006224226 6:32522473-32522495 GGAGGAGGCGGCGCGGGCTCCGG - Intronic
1006312612 6:33271585-33271607 GGAGGAGGAAGAGGGCCCGCTGG - Exonic
1006396178 6:33788945-33788967 GCGGGAGGAGGCCCGGCCGCGGG - Exonic
1006491510 6:34392251-34392273 CGAGGAGGAGGTGAGGCGGCAGG - Exonic
1006602869 6:35237581-35237603 GGTGGAGGAGGTGGGGCGGGGGG - Intronic
1007287107 6:40755556-40755578 GGAGGAGGAGGGACGGCCCGTGG - Intergenic
1007289868 6:40777584-40777606 GGAGGTGGAAGTGGGGCCTCTGG - Intergenic
1007700037 6:43761091-43761113 GGGGGAGGAGATGCCACCGCAGG + Intergenic
1008109642 6:47478198-47478220 GGAGGAGGAGGAGCGGACGTCGG + Exonic
1009952627 6:70413948-70413970 GCAGGGGCAGGGGCGGCCGCGGG - Intronic
1011398738 6:86937471-86937493 GGAGGAGGAGGAGCAGGAGCAGG - Exonic
1012980986 6:105830839-105830861 GGAGGAGGGGAAGGGGCCGCAGG + Intergenic
1012981041 6:105830988-105831010 GGAGGAGGAGAAGGGGCAGCTGG + Intergenic
1013033819 6:106361101-106361123 GGAGGAGGAGGTGGGACTGGAGG - Intergenic
1013287546 6:108693994-108694016 GGAGGAGGAGGAAGGGCTGCAGG - Intergenic
1015732274 6:136361058-136361080 GGAGGAGCAGCTGCAGCGGCAGG - Exonic
1015939169 6:138431544-138431566 GGAGGAGGAGGAGGAGCCGGGGG + Exonic
1016461654 6:144285278-144285300 GGAGGAGGAGGAGCCGCCGAAGG + Intergenic
1017672299 6:156778902-156778924 GGAGGAGGAGGAGCAGGAGCAGG + Exonic
1017737969 6:157381094-157381116 GGAGCAGGAGGAGGAGCCGCGGG + Intergenic
1018378907 6:163240162-163240184 GGAGGCACAGGTGCGGCCCCGGG - Intronic
1018727844 6:166627328-166627350 GGAGGAGGAGGTGTGCGTGCCGG - Intronic
1018899355 6:168043441-168043463 GGAGGTGGTGGAGGGGCCGCTGG + Intronic
1018910926 6:168100697-168100719 GGAGCAGGAGGTGCAGACCCTGG - Intergenic
1019082255 6:169442823-169442845 GCAGGAGGAGGTGTGGGCTCAGG - Intergenic
1019162981 6:170081204-170081226 AGGGGAGGAGCTGCAGCCGCAGG + Intergenic
1019282848 7:209161-209183 GGAGGAGGTGGGGAGGCCGTGGG - Intronic
1019343673 7:519781-519803 GGAGGAGGAGGAGTAGGCGCAGG + Intronic
1019403226 7:868333-868355 GGAGGTGGGGGTGCGATCGCAGG + Intronic
1019403481 7:869524-869546 GGAGGAGGAGGGTCGGCCAAGGG - Intronic
1019516505 7:1442543-1442565 GGAGGCAGAGGGGCGGCCTCGGG - Intronic
1019521308 7:1461675-1461697 TGAGGAGGAGGGGCGGGTGCTGG - Intergenic
1019597345 7:1864260-1864282 GGAGGAGGGGAGGCGGCTGCAGG + Intronic
1019673295 7:2294663-2294685 GGAGCAGGAGCTGGAGCCGCAGG + Intronic
1019729522 7:2622585-2622607 GCAGGAGGAGCTGAGGCCGGAGG - Intergenic
1019729530 7:2622615-2622637 GGAGGAGGAGCTGGGGCAGGAGG - Intergenic
1019729531 7:2622618-2622640 GGAGGAGGAGGAGCTGGGGCAGG - Intergenic
1019780658 7:2937912-2937934 GGAGGAGGTGGAGCGGGAGCGGG - Exonic
1019989593 7:4682411-4682433 GCCGGCGGGGGTGCGGCCGCGGG - Exonic
1020275456 7:6622074-6622096 GCAGGAGGAGCTGCAGCAGCTGG + Exonic
1020309120 7:6855578-6855600 GGAGGAGGAGGCGCCGCCCCCGG - Intergenic
1020364663 7:7368083-7368105 GGAGGAGGAGGTGAGGAGACTGG - Intronic
1021452784 7:20798081-20798103 GGAGGCGGAGGCGCAGGCGCCGG + Intergenic
1022194831 7:28054726-28054748 GCAGGAAGAGGTGCAGACGCTGG + Intronic
1022417250 7:30188932-30188954 GGAGGAGGAGGGAGGGCTGCTGG + Intergenic
1022793753 7:33715085-33715107 GGAGGAGGAGGAGCTGCTGGAGG - Intergenic
1023638531 7:42236901-42236923 GGAGGCGCGGGCGCGGCCGCAGG + Intronic
1023767909 7:43529176-43529198 GGGGGAGGAGGTGGGAACGCCGG - Intronic
1023780109 7:43647493-43647515 CTAGGAGGAGGTCAGGCCGCAGG + Intronic
1023817531 7:43962050-43962072 GCAGCTGGAGGTGCGGCTGCGGG - Intergenic
1023918322 7:44606988-44607010 GGAGAGGGCGGTGCGTCCGCAGG + Intronic
1024251881 7:47511861-47511883 GCAGGGGGAGGTGCAGCGGCCGG - Intronic
1024539660 7:50465996-50466018 CGAGGAGGAGCTGCAGCCGTGGG - Intronic
1024818423 7:53298037-53298059 GGAGGAGGCCGTGGGGCAGCGGG - Intergenic
1025078668 7:55964469-55964491 GGAGCAGGGCGCGCGGCCGCGGG - Intronic
1025261827 7:57425208-57425230 GGAGAAGGAGGTGCTGCTGCAGG + Intergenic
1025739150 7:64182425-64182447 GGAGAAGGAGGTGCTGCTACAGG + Intronic
1026000514 7:66556897-66556919 GGAGAAGGTGGTGCTGCTGCAGG + Intergenic
1026066774 7:67081645-67081667 GCAGGAGGAGGAGCAGCAGCAGG - Intronic
1026504381 7:70969798-70969820 GGAGCAGGAGGTGTGGTTGCTGG + Intergenic
1026710148 7:72730696-72730718 GCAGGAGGAGGAGCAGCAGCAGG + Intronic
1028796513 7:94908643-94908665 GGCGGGGGAGATGGGGCCGCCGG - Intronic
1029316220 7:99716996-99717018 CGATGAGGAGGTGGGGCAGCTGG - Intronic
1029321880 7:99769587-99769609 CGATGAGGAGGTGGGGCAGCTGG - Intronic
1029443530 7:100600925-100600947 GGAGGAGGGAGTCCGGCCCCAGG + Exonic
1029458637 7:100683333-100683355 GGAGGAGCAGAAGCGGCGGCAGG - Exonic
1029494825 7:100891002-100891024 GGAGGAGGAGGAGGGGCAGGGGG + Exonic
1029701321 7:102248610-102248632 GCGGGAGGAGGTGCCGCGGCCGG + Exonic
1029701322 7:102248613-102248635 GGAGGAGGTGCCGCGGCCGGCGG + Exonic
1029742156 7:102496924-102496946 GCAGCTGGAGGTGCGGCTGCGGG - Exonic
1029760145 7:102596089-102596111 GCAGCTGGAGGTGCGGCTGCGGG - Exonic
1029970122 7:104780434-104780456 GGAGAAGGAGCTGCGTCCTCTGG - Intronic
1031025225 7:116672338-116672360 GGCGGAGGGAGTGCGGCCGGCGG + Intergenic
1031597297 7:123662835-123662857 GGAGGAGGAGGTGTGGCCACAGG - Exonic
1032128656 7:129212121-129212143 GAAGAAGGAGGTGTGCCCGCTGG + Exonic
1032215260 7:129952625-129952647 CGAGGAGCCGGCGCGGCCGCGGG - Exonic
1032340978 7:131072782-131072804 GAAGGAGGAGCTGCAGCAGCAGG + Intergenic
1032369080 7:131328106-131328128 TGAGGGGGACGTGCGGCCTCCGG + Intronic
1032391258 7:131556677-131556699 GGAGGGGGAGGGGCGGGGGCGGG - Intronic
1032523634 7:132563471-132563493 GGAGGAGGAGGAGCAGCAGAAGG - Intronic
1032523719 7:132563841-132563863 GGAGGAGGAGGAGCAGCAGAAGG - Intronic
1032523728 7:132563882-132563904 GGAGGAGGAGGAGCAGCAGAAGG - Intronic
1032580085 7:133096290-133096312 GGAGGATGGGGTGAGGCCTCAGG - Intergenic
1032804042 7:135338619-135338641 GGAGGAGGAGGAGCTGGGGCAGG - Intergenic
1032984745 7:137325467-137325489 GGAGGAGGAGGTGCTGACTATGG + Intronic
1033253162 7:139777752-139777774 GGAGGCGGTGATGCGGGCGCGGG - Intronic
1034199936 7:149278045-149278067 GGAGGAGGAGGCCCGACTGCGGG + Intronic
1034254899 7:149719584-149719606 GGAGGAGGAGTGGCGGCTCCTGG + Exonic
1034556452 7:151853227-151853249 GGAGGAGGAGGGGCTGCAGCTGG + Intronic
1034563035 7:151893914-151893936 GGAGGAGGATGTGAGGCAGGCGG - Intergenic
1034601541 7:152262126-152262148 GGAGGAGGTGGAGCAGACGCAGG - Intronic
1035035254 7:155890492-155890514 GGAGGAGGAGGAGCAGCCTTGGG + Intergenic
1035168555 7:157005583-157005605 GGAGGAGGCGGCGTGGACGCTGG + Exonic
1035205424 7:157291400-157291422 GGAGGAGGGGGTGAGGCCAGTGG + Intergenic
1035277732 7:157758101-157758123 GGAGCGGGAGATGCGGTCGCGGG + Intronic
1035304685 7:157924169-157924191 GGATGAGGGGGCGCGGCCACAGG + Intronic
1035765133 8:2099358-2099380 GGAGGAGAAGGTGCGAGCCCCGG + Intronic
1035818055 8:2562101-2562123 GGTGGAGGAGGAGCCGTCGCAGG - Intergenic
1035862577 8:3046199-3046221 GGAAGCGGAGGTGAGGCAGCGGG + Intronic
1037313087 8:17576841-17576863 TGAGGAGGTGGGGCGGGCGCTGG + Intronic
1037412491 8:18613302-18613324 GGAGGAGGGGGTGGGGCCTTGGG + Intronic
1037759085 8:21729995-21730017 GGAGGAGGAGGAGGAGCTGCAGG + Intronic
1038422120 8:27440114-27440136 GGAGGAGGAGGAGGGACCGCAGG + Intronic
1038491853 8:27977208-27977230 GGACTAGGAGGTGGGGCCTCTGG - Intronic
1038615733 8:29092652-29092674 GGAGGTGGAGGTGCGGCCTCTGG - Intronic
1039212727 8:35235418-35235440 GGAGGGGAAGGGGCGGCTGCGGG + Intergenic
1039567244 8:38560272-38560294 GGAGGAGGAGGTGCTGATGCTGG - Intergenic
1039812933 8:41065894-41065916 GGAGGAGGAGGAGCCCCCGTTGG + Intergenic
1040033090 8:42843502-42843524 GGGGGAGGAGGCGCGGCGGGAGG + Intergenic
1040079826 8:43275076-43275098 GGAGGAGGAGGAGGGGAAGCAGG - Intergenic
1040522909 8:48193233-48193255 GGAGGAGGAGGAGCAGGAGCTGG + Intergenic
1043053416 8:75408153-75408175 GGCGCTGGAGGTGCGGCAGCGGG + Intronic
1043388180 8:79768081-79768103 GAAGGAGGAGGCGCGGGCGGCGG + Intergenic
1043388198 8:79768139-79768161 CGGGGAGGAGCCGCGGCCGCCGG - Intergenic
1043389652 8:79780026-79780048 GGAGGAGGAGATGCTGCTGCTGG + Intergenic
1043463707 8:80486040-80486062 GGGGGCGGGGGTGCGGCCGCGGG - Intronic
1044126583 8:88465597-88465619 GGAGGAGGAGGAACGGCTGTCGG + Intergenic
1045582964 8:103499894-103499916 GGCGGAGGAGGTGCTGGCGGCGG + Intergenic
1045679170 8:104640473-104640495 GGAGGAGGAGAGGCGGACCCAGG + Intronic
1046004690 8:108464591-108464613 GGAGGACCAGGTGCAGCCACAGG + Intronic
1046871246 8:119208188-119208210 GGAGCAGGAGGTGAGGTCGGCGG + Intronic
1047203245 8:122783052-122783074 GGAGGAGGAGGTGGAGGCGGCGG + Intronic
1047254912 8:123207455-123207477 GGAGGCGGGTGTGGGGCCGCGGG - Exonic
1047748095 8:127860194-127860216 GGTGGCGGAGGTGCTGGCGCAGG + Intergenic
1048347943 8:133592113-133592135 GGAGGAGGAGGTGATGGTGCTGG - Intergenic
1048553968 8:135457600-135457622 GGCCGAGGAGGAGCGGGCGCGGG - Exonic
1049037655 8:140089244-140089266 AGAGGATGAGGTGCTGCCTCTGG - Intronic
1049103786 8:140598575-140598597 GGAGGAAGAGCTGCGGCTCCGGG - Intronic
1049282736 8:141758741-141758763 GGAGGAGGAGGTGCAGGGGAGGG - Intergenic
1049365709 8:142235910-142235932 GCAGGAGGAGGTGGGCACGCAGG + Intronic
1049400233 8:142423260-142423282 GCAGGAGGAGGTGCAACTGCAGG + Intergenic
1049573960 8:143382057-143382079 GGAAGGGGAGGTGGGGCTGCAGG + Intronic
1049680988 8:143918117-143918139 GGAGGAGCTGGTGCGCTCGCAGG - Exonic
1049681790 8:143922092-143922114 GCAGGAGGAGCTGCAGCAGCTGG - Exonic
1049682458 8:143925713-143925735 GGAGGAGGTGGTGCGGCGGGAGG - Exonic
1049682459 8:143925716-143925738 GCAGGAGGAGGTGGTGCGGCGGG - Exonic
1049732479 8:144185707-144185729 GGAGGGGGAGGGGCGGCGGGGGG + Intronic
1049778016 8:144415371-144415393 GGAGGAGGCGGTGGGGGCGGGGG - Exonic
1049790111 8:144468541-144468563 GGTGCAGGAGGTGCAGCTGCAGG + Exonic
1051206367 9:14693294-14693316 GGAGGCGGAGGTGGCGCGGCAGG - Exonic
1052192867 9:25678411-25678433 GGAGGAGGAGAGGAGGTCGCGGG + Exonic
1052795339 9:32918791-32918813 GGAGGACGGGGTGGGGCCTCAGG + Intergenic
1053097583 9:35341846-35341868 AGAGGAGGAGGAGCAGCAGCAGG + Intronic
1053279142 9:36806106-36806128 GGGGTAGGAGCTGGGGCCGCAGG - Intergenic
1053575564 9:39355574-39355596 GGAGGGGGAGGTGCAGCAGGAGG - Intergenic
1053663394 9:40300258-40300280 GGAGCAGGAGCTGGGGCTGCTGG - Intronic
1053664861 9:40310357-40310379 GGAGCAGGAGCTGGGGCTGCTGG - Intronic
1053840072 9:42183513-42183535 GGAGGGGGAGGTGCAGCAGGAGG - Intergenic
1053913905 9:42930799-42930821 GGAGCAGGAGCTGGGGCTGCTGG - Intergenic
1054097125 9:60914261-60914283 GGAGGGGGAGGTGCAGCAGGAGG - Intergenic
1054118531 9:61189890-61189912 GGAGGGGGAGGTGCAGCAGGAGG - Intergenic
1054375517 9:64446492-64446514 GGAGCAGGAGCTGGGGCTGCTGG - Intergenic
1054521220 9:66076027-66076049 GGAGCAGGAGCTGGGGCTGCTGG + Intergenic
1054589226 9:66992674-66992696 GGAGGGGGAGGTGCAGCAGGAGG + Intergenic
1055266069 9:74497554-74497576 GGAGGAGGAAGGGCAGCAGCAGG - Exonic
1057869205 9:98706133-98706155 GGAGGAGGAGGGGAGGCAGCAGG + Intronic
1057883103 9:98807959-98807981 GGGCGAGGAGCTGCGGCTGCAGG + Exonic
1060788683 9:126470518-126470540 GAAGGAGGAGGTGGGGGGGCTGG + Intronic
1060893485 9:127202886-127202908 GGAGGTGGGGAGGCGGCCGCAGG + Intronic
1060965568 9:127710671-127710693 GGAGGAGCAGGTGCGGAAGCAGG + Exonic
1060979708 9:127785376-127785398 GAAGGCGGAGGAGGGGCCGCGGG + Intergenic
1061063102 9:128260626-128260648 GGAGCAGGAGGAGAGGCTGCTGG - Exonic
1061129900 9:128702918-128702940 GGAGGAGGGGGCGCCGCGGCAGG + Exonic
1061230956 9:129315556-129315578 GAAGGAGGAGCTGAGGCCGAGGG - Intergenic
1061264439 9:129497146-129497168 GGAGAAGGAGGGGAGGCAGCAGG + Intergenic
1061297856 9:129686783-129686805 GGTGGAGGAGGGGCGGCCGGTGG - Intronic
1061490149 9:130939934-130939956 GGCGGAGGAGGGGCGGCCGGCGG - Intergenic
1061575546 9:131503628-131503650 GGAGGAGAACGTGGGGGCGCAGG + Intronic
1061610031 9:131740002-131740024 GGAGGCGGAGCGGCGGCGGCGGG - Intronic
1061798428 9:133101688-133101710 GGAGGACGAGGTGCTGCTGGAGG + Exonic
1061845378 9:133385255-133385277 GGAGGAGGTGGTGCAGACACCGG - Intronic
1061972106 9:134050423-134050445 GGAGGAGGTGGGGCGGCAGCTGG + Exonic
1062028903 9:134353099-134353121 GGAGGAGGGGCTGGGGCTGCTGG + Intronic
1062190795 9:135246900-135246922 GGAGGAGGAGGAGGGGAGGCAGG + Intergenic
1062286032 9:135772902-135772924 GGAGGATGAGGTGACGCCGTCGG + Exonic
1062362097 9:136193074-136193096 GGAGCGGGAGGTGCGGGGGCAGG - Intergenic
1062405003 9:136391998-136392020 GGAGGAGGAGGAGCGGCTGCAGG - Exonic
1062546432 9:137065620-137065642 GGAGAAGGAGGTGCTGCTGCAGG - Exonic
1062612638 9:137381942-137381964 CGAGGAGGAGGTGAGGGCGCAGG + Intronic
1062612654 9:137381999-137382021 CGGGGAGGAGGTGAGGACGCGGG + Intronic
1062612661 9:137382018-137382040 CGGGGAGGAGGTGAGGGCGCGGG + Intronic
1062612690 9:137382111-137382133 GGCGGTGGAGGTGAGGGCGCGGG + Intronic
1062612697 9:137382130-137382152 CGGGGAGGAGGTGAGGGCGCGGG + Intronic
1203470551 Un_GL000220v1:113906-113928 GGAGGAGGAGGAGGGGCGGCGGG - Intergenic
1203478372 Un_GL000220v1:157878-157900 GGAGGAGGAGGAGGGGCGGCGGG - Intergenic
1203546335 Un_KI270743v1:131073-131095 GGAGCAGGAGCTGCGGCTGCTGG + Intergenic
1185643452 X:1600760-1600782 GGAGGAGAAGGAGCGCGCGCTGG + Exonic
1185763507 X:2706446-2706468 GGAGGAGGAGGTGGTGCAGAGGG - Intronic
1186784763 X:12947085-12947107 GGAGGAGGATTTGAGTCCGCAGG - Intergenic
1187478633 X:19634638-19634660 GGAGGAGGAGGAGAGGACGGTGG + Intronic
1187722461 X:22165502-22165524 GGAGGCGGAGGTGCAGGTGCAGG + Intronic
1188654182 X:32669899-32669921 GGAGGAGTAGGAGAGGCGGCTGG - Intronic
1188811401 X:34657287-34657309 GGAGGAGCGGGCGCGGGCGCTGG - Exonic
1189297398 X:39928771-39928793 GGAGGAGCAGGTGTGGGGGCAGG + Intergenic
1190941102 X:55041840-55041862 GGAGGAGCAGGTGCAGCTGAAGG + Intergenic
1192194651 X:69020186-69020208 GGAGGAGGAAGTGTTGCCGATGG + Intergenic
1192234469 X:69286982-69287004 GGAGGAGGAGTTGGGGCCAAGGG - Intergenic
1193140508 X:78021948-78021970 GGAGGATGGGGTGGGGCCCCTGG + Intronic
1194662537 X:96642884-96642906 GGAGGATGGGGTGGGGCCTCGGG - Intergenic
1197300814 X:124778215-124778237 GGAGGACGAGGTGGAGCCCCGGG + Intronic
1198369201 X:135974254-135974276 CGGGGAGGAGGTGGGGCCGAGGG + Intergenic
1198369213 X:135974278-135974300 CGGGGAGGAGGTGGGGCCGAGGG + Intergenic
1198369225 X:135974302-135974324 CGGGGAGGAGGTGGGGCCGAGGG + Intergenic
1198369301 X:135974473-135974495 CGGGGAGGAGGTGGGGCCGAGGG + Intergenic
1198369312 X:135974496-135974518 GCGGGAGGAGGTGGGGCCGAGGG + Intergenic
1199978316 X:152907207-152907229 GGAGGAGCGGGGGCGGCAGCAGG - Intergenic
1200002321 X:153068475-153068497 GGAGGAGGAGGTGCAGGAGGAGG + Intergenic
1200005410 X:153081550-153081572 GGAGGAGGAGGTGCAGGAGGAGG - Intergenic
1200086064 X:153606507-153606529 GCAGGAAGAGATGCGGCCCCTGG + Intergenic
1200093813 X:153648004-153648026 GGAGCAGGAGCCGCGGCCGCGGG - Exonic
1200119809 X:153784905-153784927 GGGGGAGGAGGTGAGGCTGCTGG - Intronic
1200684466 Y:6246448-6246470 GGAGGAGGCGGTGCTGCTGTTGG + Exonic
1200687108 Y:6266772-6266794 GGAGGAGGCGGTGCTGCTGTTGG + Intergenic
1200831073 Y:7689350-7689372 GGAGGAGGAGGTGGTGCAGGTGG - Intergenic
1200989989 Y:9337689-9337711 GGAGGAGGCGGTGCTGCTGTTGG + Exonic
1200992657 Y:9358022-9358044 GGAGGAGGCGGTGCTGCTGTTGG + Exonic
1200995311 Y:9378301-9378323 GGAGGAGGCGGTGCTGCTGTTGG + Intronic
1200997975 Y:9398646-9398668 GGAGGAGGCGGTGCTGCTGTTGG + Exonic
1201000484 Y:9467180-9467202 GGAGGAGGCGGTGCTGCTGTTGG + Exonic
1201003146 Y:9487492-9487514 GGAGGAGGCGGTGCTGCTGTTGG + Exonic
1201005805 Y:9507775-9507797 GGAGGAGGCGGTGCTGCTGTTGG + Intergenic
1201008465 Y:9528105-9528127 GGAGGAGGCGGTGCTGCTGTTGG + Exonic
1201048168 Y:9907938-9907960 GGAGGAGGCGGTGCAGCTGTTGG - Intergenic
1201300282 Y:12498864-12498886 GGAGGAGGAGGTGGGGGAGGAGG - Intergenic
1201300290 Y:12498882-12498904 GGAGGAGGAGGTGGGGGAGGAGG - Intergenic
1201739732 Y:17311101-17311123 GGAGGAGGAGGAGGGGCAGAAGG - Intergenic