ID: 985629178

View in Genome Browser
Species Human (GRCh38)
Location 5:1005861-1005883
Sequence CTGGAATGGCTGAGGGGACC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 328
Summary {0: 1, 1: 0, 2: 1, 3: 30, 4: 296}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985629167_985629178 19 Left 985629167 5:1005819-1005841 CCAGAAGGGAACGTCAAGGGGAG 0: 1
1: 0
2: 1
3: 6
4: 89
Right 985629178 5:1005861-1005883 CTGGAATGGCTGAGGGGACCAGG 0: 1
1: 0
2: 1
3: 30
4: 296

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985629178 Original CRISPR CTGGAATGGCTGAGGGGACC AGG Intergenic
900313749 1:2047229-2047251 CTGGAGAAGCTGTGGGGACCCGG + Intergenic
900457691 1:2785465-2785487 TAGGAAGGGCTGAGGGGAGCAGG + Intronic
900624407 1:3601584-3601606 CTGGGCAGGCTGAGGGGGCCAGG - Intronic
900657668 1:3767740-3767762 CTGGAAAGGAGGAGGGCACCTGG + Intronic
901849157 1:12004516-12004538 CTGCAATGGCCGAGGAGATCAGG + Exonic
902074937 1:13776877-13776899 CTGGACTGGATGAGGTCACCTGG - Intronic
902367971 1:15989813-15989835 CTGGGAGGGCTGAGGTCACCTGG - Intergenic
903578593 1:24354351-24354373 CTGGAATGGAAGAGGGGATGTGG - Intronic
904568936 1:31446149-31446171 TTGCAAAGGCTGAGGGGAGCGGG - Intergenic
904872195 1:33625704-33625726 CCAGAATGGCTGATGGGCCCGGG + Intronic
905694498 1:39965010-39965032 CCGGAATGGCAGATGGGAACTGG - Intronic
906200527 1:43957328-43957350 CTGGGAAGGCTGAGGGAATCAGG - Intronic
906517909 1:46450454-46450476 CTGGAAGGGCTGAGGGAACAGGG - Intergenic
909696682 1:78475296-78475318 CAGAAATGCCTGAGGGCACCGGG - Intronic
911200298 1:95037284-95037306 CTGGAATGGCTGAAGCAACATGG + Intronic
914755276 1:150558697-150558719 CTGGAAAGGCTGAGGTGTCCTGG - Intronic
916362318 1:163984479-163984501 CTGGAATGTTTGAGGAGAACAGG + Intergenic
916877673 1:168987328-168987350 CTGGGAAGGCAGAGGAGACCTGG - Intergenic
917147469 1:171907588-171907610 CTACAATGGCTGAGGTGATCTGG + Intronic
917903299 1:179564973-179564995 CTGGAAAGGTAGTGGGGACCAGG + Intronic
919988081 1:202689713-202689735 CTGGGATGTCTGAGAGGATCAGG - Intronic
920032925 1:203048302-203048324 CTGGCACGGGTGAGGGCACCAGG + Intronic
920037327 1:203074840-203074862 CTGGCATGGGTGAGGGGGGCAGG + Intronic
920047144 1:203140650-203140672 CTGGAGTGGCTGAAGGCACCTGG - Intronic
920053232 1:203175758-203175780 CTGGACTGGCTGGGGGGCCAGGG + Exonic
920275077 1:204798595-204798617 CTGGGCGTGCTGAGGGGACCAGG - Intergenic
921030407 1:211331104-211331126 CAGGACTGGCTGAGGGGGACAGG - Intronic
922214474 1:223509287-223509309 AGGGAATGCCTGAGGGGCCCTGG - Intergenic
1062817009 10:508259-508281 CTGGAGTGGGTGAGGGGCTCTGG - Intronic
1064258182 10:13763126-13763148 CTGGGATGGACTAGGGGACCTGG + Intronic
1064430806 10:15268328-15268350 CTGCAGTGCCTGAGGGGACATGG + Intronic
1065268931 10:24006748-24006770 TTGGCATGGCTGAGGGAACCAGG + Intronic
1067514223 10:46923029-46923051 CTGGAATGGGTCAAGGGTCCTGG + Intronic
1067648032 10:48128802-48128824 CTGGAATGGGTTAAGGGTCCTGG - Intergenic
1069352240 10:67542406-67542428 CTGGAAATGCTGTGGTGACCAGG - Intronic
1069605368 10:69735573-69735595 CTGGAATGCCTGCAGGGGCCTGG + Intergenic
1069840848 10:71338366-71338388 CTGGAAATGCTGAGGGGAATGGG + Intronic
1075512017 10:123080195-123080217 TTGGAAGGGCAGAGGTGACCAGG - Intergenic
1075674408 10:124286402-124286424 ATGGGAGGGATGAGGGGACCGGG + Intergenic
1075723299 10:124599474-124599496 CGGGACTGGCAGAGGGGGCCTGG - Intronic
1075726059 10:124611509-124611531 CTGGAGGGGCTTAGGGGACAAGG + Intronic
1076230787 10:128818294-128818316 CTGGGAAGGCTGAGTGGCCCTGG + Intergenic
1076291561 10:129349564-129349586 CTGGAATAGCGGATGGGAACTGG + Intergenic
1076564276 10:131387368-131387390 CAGGGATGGCCGAGGGGAGCCGG - Intergenic
1080513793 11:33001296-33001318 CTGGAATGGCTGAGTCGTCCAGG + Intergenic
1080572684 11:33570350-33570372 CTGGAAAGTCTGAGGGAAGCGGG + Intronic
1080899101 11:36470635-36470657 CTGGAGTGGGTGAGGGTACAAGG + Intergenic
1081743461 11:45457015-45457037 CAGGAAAGGCTGTGTGGACCAGG - Intergenic
1082974682 11:59059901-59059923 CAGGAAAGGCTGAGGAGAACTGG - Intergenic
1083578986 11:63813275-63813297 CGGGAAGGGCCGAGGGGACCCGG - Intergenic
1084614459 11:70226459-70226481 CTGGAATGGCTGGGGGGTGGGGG + Intergenic
1085426769 11:76411659-76411681 TTGGAATTGCTGAGGTGACAAGG - Intronic
1086576241 11:88341731-88341753 CTGGGAAAGCTGAGGGCACCAGG - Intergenic
1088629989 11:111765867-111765889 CTGGAGCGGCTGAGGGGCGCAGG - Intronic
1089127753 11:116189394-116189416 CTGGATGGGCTGAGGGGCCCAGG - Intergenic
1090423741 11:126592964-126592986 GTGGGAGGGCTGAGGGGAGCAGG + Intronic
1090465954 11:126933349-126933371 CTAGAATGACAGAAGGGACCAGG - Intronic
1090840142 11:130480312-130480334 CAGGAATCACTGAGTGGACCTGG + Intergenic
1092259614 12:6946051-6946073 CTGGAAAGGCAGAGGGAATCAGG - Intergenic
1092579191 12:9820530-9820552 CTGGAGAGTCTGTGGGGACCAGG + Intergenic
1093369838 12:18353796-18353818 CTGGAAAGGCTGAGAGGCCTTGG - Intronic
1095835824 12:46637870-46637892 TTGGAATGTCTGAGGCTACCAGG + Intergenic
1096070281 12:48771630-48771652 TTGGAATGGGTGAGTGGAACTGG - Intronic
1096233849 12:49912674-49912696 CAGGAAGGGCTGAGGAGCCCTGG - Intergenic
1096601743 12:52734594-52734616 CTGGACTGAGTGAGGGGCCCGGG - Intergenic
1097918251 12:65042639-65042661 CTGGAGGGGCAGAGGGGAGCAGG - Intergenic
1098083382 12:66813768-66813790 CTGGAAAGCCTGAGGTGAGCTGG - Intergenic
1100411193 12:94321683-94321705 CTGGAGAGTCTGTGGGGACCAGG - Intronic
1101968125 12:109294592-109294614 CTGCAGTGGCTGTGGGTACCAGG + Intronic
1103394976 12:120600404-120600426 CAGGAGTGGCTGTGGGGTCCGGG - Intergenic
1103725854 12:122997037-122997059 CTGGATAGGCTTGGGGGACCAGG + Intronic
1104311816 12:127660176-127660198 CTGAAATTGCTGAGGGGAGAAGG - Intergenic
1105673023 13:22642016-22642038 CAGGAATGGTTGAGGGGACATGG - Intergenic
1105701258 13:22937320-22937342 CTGGCCTGGCAGTGGGGACCAGG + Intergenic
1105854093 13:24360375-24360397 CTGGCCTGGCAGTGGGGACCAGG + Intergenic
1106009141 13:25801227-25801249 CTGGGATGGCTGCGGAGCCCAGG + Intronic
1106660158 13:31791138-31791160 CTGGAATGGGTGAGGTCATCTGG - Intronic
1106754266 13:32806577-32806599 GTGAAATGGCTGATGAGACCTGG + Intergenic
1108000396 13:45900714-45900736 CAGTCATGGCTGAGTGGACCAGG + Intergenic
1109412597 13:61992985-61993007 CTGGAATGGCTCATGTGACTGGG + Intergenic
1110035119 13:70673093-70673115 TTGGAGTGTCTGAGGTGACCAGG - Intergenic
1110144862 13:72178271-72178293 CTGGACTGCCTAAGGGTACCTGG - Intergenic
1111024032 13:82494826-82494848 CTGGCTTGGCTGAAGTGACCTGG - Intergenic
1111468509 13:88647031-88647053 CTGGAAAGGCTGAGAGGCCTTGG + Intergenic
1113767265 13:112889167-112889189 CTGGGAGGGCTCAGGGGACGGGG + Intergenic
1114824466 14:26060039-26060061 CTGGAAAGGCTGAGAGGAGATGG + Intergenic
1114991626 14:28296188-28296210 CTGGAGAGTCTGTGGGGACCAGG - Intergenic
1117032199 14:51684609-51684631 CTGGAATGTCTGAGGGCATTTGG + Intronic
1117498642 14:56330639-56330661 CTGGATGGGCTGAGGGAGCCTGG - Intergenic
1117767194 14:59095444-59095466 TGGGAATGGCTGAGGGGATTGGG - Intergenic
1119806899 14:77487991-77488013 CCAGAAGGGCTGAGGGGATCAGG + Intronic
1121952262 14:98181878-98181900 CTGGATTGACAGAGGGGGCCTGG - Intergenic
1121994013 14:98587625-98587647 CTGGAATGCTTGAAGGCACCTGG - Intergenic
1122068754 14:99191656-99191678 CTGAAATGGCAGAGGGGGCAGGG + Intronic
1122820535 14:104342609-104342631 CTGCAGAGGCTGAGGGGAGCAGG + Intergenic
1122862113 14:104587387-104587409 CTGCAATGGCAGAGGGGCTCTGG - Intronic
1123149352 14:106166288-106166310 CAGGAATGTGTGAGGTGACCTGG - Intergenic
1123709854 15:22979767-22979789 CCGGAATGGCTCCGCGGACCAGG + Intronic
1124138791 15:27059114-27059136 CCTGAATGGCAGAGGGCACCAGG - Intronic
1124152716 15:27196301-27196323 CTGGGAGGGCTGAGGGGAGCAGG - Intronic
1125110384 15:36025607-36025629 CGGGGATGGCAGAGAGGACCAGG - Intergenic
1128304547 15:66589321-66589343 CTGGAAGTGTTGAGGGGACCTGG + Intronic
1128341369 15:66824726-66824748 CTGGGATGACAGAGGGGACTTGG - Intergenic
1128646481 15:69382274-69382296 GAGGAATGGCTGAAGGAACCGGG + Intronic
1129538476 15:76333022-76333044 CTGGCCTGGGTTAGGGGACCTGG + Intergenic
1129694218 15:77731421-77731443 CTGAAGGGGCTGAGGGCACCAGG - Intronic
1130298411 15:82663100-82663122 GTGGGATGGAGGAGGGGACCGGG - Intronic
1130620092 15:85453412-85453434 CTGGAAAATCTGAGGTGACCAGG - Intronic
1132649465 16:1014015-1014037 CTGGGATGGCTGAGAGGAGAGGG + Intergenic
1132956706 16:2598160-2598182 CTGCTGTGGCCGAGGGGACCGGG + Exonic
1134301350 16:12994176-12994198 TTGGAAGGGCTGAGGGAGCCAGG + Intronic
1137616464 16:49850886-49850908 CTGGACTGGATGTGGGGACATGG - Intronic
1138247131 16:55476222-55476244 CTAGAATGGCCCAGGGGACGAGG - Intronic
1138418843 16:56886487-56886509 CTGGAGGGGCACAGGGGACCAGG + Intronic
1138704570 16:58901662-58901684 TTGGAATGGCTGAGGGAATTAGG + Intergenic
1139473732 16:67192193-67192215 CTGGCCTGGCTGAGGGGAGGCGG + Exonic
1139922314 16:70467964-70467986 CTGGTATGGCTGCTGGGCCCAGG + Exonic
1140057349 16:71537020-71537042 CTGGACTGTCTCCGGGGACCAGG - Exonic
1140893641 16:79306337-79306359 CTGTAATGGATGAGGAAACCAGG + Intergenic
1141928050 16:87182133-87182155 CTGGAAGGGCTCAGGAGAACTGG - Intronic
1142676293 17:1515586-1515608 CTGGAATGGCAGAGGGTACAGGG + Intronic
1142875467 17:2849608-2849630 CTCCAAAGGCTGAGGGGGCCTGG - Intronic
1143152456 17:4816008-4816030 CTGGAATGACTGAGGGGGTAAGG - Intronic
1143205085 17:5135750-5135772 CTGGGAGGGCTGAGGTCACCTGG - Intronic
1143718407 17:8792834-8792856 CTGGAAAGACAGATGGGACCAGG - Intergenic
1144639108 17:16927832-16927854 CTGGGAGGGCTGAGGCCACCTGG + Intergenic
1144675514 17:17159029-17159051 CTGGAAAGGCTGCTGGGAGCAGG - Intronic
1144792509 17:17868466-17868488 CTGGTGCGGCAGAGGGGACCAGG + Intronic
1145760760 17:27424481-27424503 CTGGGAGGGCTGAGGTCACCTGG - Intergenic
1146261996 17:31427899-31427921 CTGGCATGGCTGGGGGGAGGGGG + Intronic
1146526422 17:33570779-33570801 CTGGAATGGCTGGGATGACCAGG + Intronic
1146705530 17:34998340-34998362 CTGGAAAGGCTCAGGGGAGAGGG - Intronic
1146843564 17:36170047-36170069 CTGGGAGGGCTGAGGTCACCTGG + Intronic
1146855871 17:36257985-36258007 CTGGGAGGGCTGAGGTCACCTGG + Intronic
1146864749 17:36330390-36330412 CTGGGAGGGCTGAGGTCACCTGG - Intronic
1146871777 17:36381896-36381918 CTGGGAGGGCTGAGGTCACCTGG + Intronic
1146879138 17:36432978-36433000 CTGGGAGGGCTGAGGTCACCTGG + Intronic
1146883076 17:36454124-36454146 CTGGGAGGGCTGAGGTCACCTGG + Intergenic
1147067609 17:37930984-37931006 CTGGGAGGGCTGAGGTCACCTGG - Intronic
1147074664 17:37982520-37982542 CTGGGAGGGCTGAGGTCACCTGG + Intronic
1147079139 17:38010539-38010561 CTGGGAGGGCTGAGGTCACCTGG - Intronic
1147086187 17:38062059-38062081 CTGGGAGGGCTGAGGTCACCTGG + Intronic
1147095078 17:38134481-38134503 CTGGGAGGGCTGAGGTCACCTGG - Intergenic
1147102132 17:38186024-38186046 CTGGGAGGGCTGAGGTCACCCGG + Intergenic
1147557441 17:41488476-41488498 CTGCAGTGGCTGACGGGATCAGG + Intronic
1147980150 17:44269112-44269134 ATGGACTGGCTGAAGGAACCTGG + Intergenic
1148442457 17:47718556-47718578 CTGCCATGGCTGAGGCCACCAGG + Intergenic
1148591344 17:48818505-48818527 GTGGGATGGGGGAGGGGACCAGG - Intergenic
1148807268 17:50270345-50270367 CTGTAATGGCTGATGGCACTAGG - Intergenic
1148858000 17:50589582-50589604 CTGGAATGGCAGATGAGACAGGG + Intronic
1150085069 17:62269109-62269131 CTGGGAGGGCTGAGGTCACCTGG + Intergenic
1151208152 17:72523646-72523668 TTGGCAAGGCTGAGGGGACATGG - Intergenic
1151576684 17:74955981-74956003 ATGGCTTGGCTGAGGGGCCCAGG - Intronic
1151791556 17:76308602-76308624 GTGGACTGTCTGAGGGGACCAGG - Intergenic
1152135275 17:78499900-78499922 CTCTAATGACTGATGGGACCGGG + Intronic
1152329341 17:79662822-79662844 GTGGAGTGGCTGAGGAAACCAGG + Intergenic
1152467978 17:80476440-80476462 CCGGCATGGCTGCGGGCACCGGG + Exonic
1152471905 17:80494190-80494212 CTGGAATGGAGGAGGGCAGCCGG - Intergenic
1153138125 18:1941284-1941306 ATGGAATGGATCTGGGGACCAGG + Intergenic
1153780803 18:8493580-8493602 CTGGAATGGGTGGTGGGATCCGG - Intergenic
1155434602 18:25798556-25798578 CTGGAATGGCTAAGAGGATGTGG - Intergenic
1156448921 18:37255558-37255580 CAGGAGGGGCTGAGGGGAGCTGG - Intronic
1156825307 18:41424076-41424098 CTGGCATGGCTCAGGGGATGGGG - Intergenic
1158381947 18:56941467-56941489 CTTGAATTGCAGAGGGAACCAGG + Intronic
1160054272 18:75464646-75464668 CTGGGATGGCTGATGGGGCATGG - Intergenic
1160384749 18:78488325-78488347 CTGGGATGGCTGAGGTGCCTGGG - Intergenic
1160584071 18:79903191-79903213 GGGCAATGGCTGAGGGGGCCGGG - Exonic
1164415025 19:28039818-28039840 CTGGAATTGCTGAGTGCAGCTGG - Intergenic
1165318974 19:35074441-35074463 CTGGAGTCCCTCAGGGGACCTGG + Intergenic
1165993594 19:39829844-39829866 CTGGCAGGGCTGTGGGCACCTGG - Intronic
1167216543 19:48169692-48169714 CTGGAAGTGCTGAGGGGGCGGGG - Intronic
925201350 2:1969656-1969678 CAGGAATGGCTGTGGGACCCTGG + Intronic
927705458 2:25293994-25294016 CAGGCCTGGCTGAGGGGACTAGG - Intronic
927784720 2:25965766-25965788 CTGGAATGGCTGAGAGCTTCAGG - Intronic
928216301 2:29364254-29364276 CTGGAATGGCTGAGAGGCTTTGG + Intronic
929408190 2:41666875-41666897 CTGGATTAGCTGACCGGACCTGG - Intergenic
929580464 2:43078957-43078979 CTGGAATGACGGAGGGCACTGGG + Intergenic
930160118 2:48146318-48146340 CTGGAATAGCTGGGGGCCCCAGG - Intergenic
930259159 2:49124946-49124968 CAGGAATGGATGAGTGGACAGGG - Intronic
931834307 2:66082718-66082740 GGGGCATGGCTGTGGGGACCAGG + Intergenic
932188732 2:69720770-69720792 CAGGAATCACTGAGGGGACCTGG - Intronic
932557104 2:72834138-72834160 CTGGAATAGCTCAGGGAGCCAGG - Intergenic
933707637 2:85303901-85303923 CTCGGATGGGTGAGGGGGCCGGG - Exonic
935132086 2:100268381-100268403 CTGGAGTGGCTGAGGGGAAGAGG + Intergenic
935343704 2:102083465-102083487 CTGGAATGTCTGAGTGGTCAAGG + Intronic
935858661 2:107303111-107303133 CTGGAATTGCTGATGAAACCTGG + Intergenic
937223678 2:120356325-120356347 CTGTCATGGCAGAGGGGACCTGG + Intergenic
940242917 2:151582627-151582649 CTGGAATGGCTGAAGGGTATTGG - Exonic
940243872 2:151593179-151593201 CTGGAATGGCTGAAGGGTATTGG - Exonic
940244831 2:151603732-151603754 CTGGAATGGCTGAAGGGTATTGG - Exonic
942705328 2:178765404-178765426 CTGTGATGAGTGAGGGGACCTGG + Intronic
948077979 2:235181430-235181452 ATGGAATGGTTGAGAGGCCCTGG + Intergenic
948336141 2:237208852-237208874 CTGAGATGGCTAAGGGGACCAGG - Intergenic
1170579748 20:17689194-17689216 CAGGAATGGCAGAGGGGATGTGG + Intergenic
1171383000 20:24747354-24747376 CTGTGATGGCTGAGGGGATCAGG - Intergenic
1172121404 20:32601044-32601066 GTTGAATGACTGAGTGGACCAGG + Intronic
1172594991 20:36144646-36144668 ATAGAATGGCTGAGTGGGCCTGG + Intronic
1173539805 20:43842874-43842896 CTCAAATGTCTGAGGGGCCCAGG + Intergenic
1173626314 20:44475741-44475763 CTGGAGTGGCTGGGAGGAGCTGG - Intergenic
1174339905 20:49889086-49889108 CTGAGATGGCTGAGGGGGCCAGG - Exonic
1175112418 20:56657951-56657973 CTGGAGTGGCAGAGGGGAGCCGG + Intergenic
1175235767 20:57509959-57509981 TTGGAAAGGATGAGGGGCCCTGG - Intronic
1175420124 20:58826564-58826586 CTGGATTAGCAGAGGGGACCTGG + Intergenic
1175921045 20:62450842-62450864 CTGGGAGGGGTGGGGGGACCTGG - Intergenic
1175928227 20:62481108-62481130 CTGGCAGGGCTGTGGGGCCCGGG + Intergenic
1176206183 20:63889481-63889503 CAGGAAGGGCAGTGGGGACCAGG - Intronic
1176206190 20:63889500-63889522 CAGGAAGGGCAGTGGGGACCAGG - Intronic
1176668682 21:9711790-9711812 CTGGAATGGCTCACAGAACCAGG + Intergenic
1179615516 21:42580703-42580725 CTGGAATGCCTGAGAGGGTCGGG - Exonic
1179622115 21:42623871-42623893 CTGGATTGCATGAGGGCACCGGG - Intergenic
1181423588 22:22818669-22818691 ATGGAATGGAGGAGGGGACTGGG + Intronic
1182000886 22:26918963-26918985 CTTGCATGGCAGAGGAGACCTGG + Intergenic
1183473882 22:38025093-38025115 CTTGAGTGGCTGGAGGGACCAGG - Intronic
1183623881 22:38990095-38990117 CAGGAAAGGCTGAGGGGGCCAGG + Intronic
1184423892 22:44397698-44397720 CTGTGCTGGCTGTGGGGACCTGG + Intergenic
1184429018 22:44430393-44430415 CTCGACTGGCTGCAGGGACCAGG - Intergenic
1184687981 22:46104975-46104997 CTGGAATGGCTGAGGTTGCGGGG - Intronic
950152583 3:10699040-10699062 CTGGAAGGCCGGAGGGAACCAGG - Intronic
950268341 3:11592435-11592457 CTGGTGAGGCTGTGGGGACCTGG + Intronic
950566736 3:13773717-13773739 CTGCAGTGGCTGAGCGGAACTGG + Intergenic
952114198 3:30159663-30159685 ATGGCAGGGCTGAGGGGGCCTGG - Intergenic
952268083 3:31806205-31806227 CTGGGAGGGCTGAGGGAACAAGG - Intronic
954864341 3:53716323-53716345 CTGCAGTGACTGAGGGGACCAGG - Intronic
954970967 3:54651569-54651591 ATGGAATGGCTTAGGGGACCTGG + Intronic
956221397 3:66907666-66907688 CTGTAATTGCTGAGGGAACCAGG - Intergenic
956728571 3:72176882-72176904 CAGGCATGGCTGAGGGCAGCTGG + Intergenic
958632721 3:96702613-96702635 CTTGAAAGGCTGAGAGGACTTGG + Intergenic
960049778 3:113228563-113228585 CTGGAATGGCACATGGGGCCTGG - Intronic
961207070 3:125092724-125092746 TTGAAATGGCTGAGGGGAAAGGG + Intronic
961798006 3:129423780-129423802 CTGGTAGGGGTGAGAGGACCAGG - Intronic
961822864 3:129584234-129584256 CTGGAATGGATGGGGGAGCCAGG + Intronic
961935517 3:130578764-130578786 CAGGAAATGCTGAAGGGACCAGG + Intronic
962805223 3:138922318-138922340 CTGGTGTGTCTGAGGGGACTTGG - Intergenic
968588695 4:1446880-1446902 CTGGCCTGGCACAGGGGACCCGG - Intergenic
968622035 4:1608203-1608225 CGGGAGGGGCTGAGGAGACCAGG - Intergenic
969706287 4:8794037-8794059 CTGGGGTGGCAGAGCGGACCTGG - Intergenic
969930745 4:10628563-10628585 CTGGAGGGGCTGAGGGGCCTTGG + Intronic
970640800 4:18063990-18064012 CTGGACTGGCTCAAGGCACCAGG - Intergenic
975106259 4:70572012-70572034 TTGGAATGTCCGAGGTGACCAGG - Intergenic
976746575 4:88409005-88409027 CAGGACTGGCTGATGGGTCCAGG + Intronic
985406100 4:189639735-189639757 CTGGAATGGCTCACAGAACCAGG - Intergenic
985629178 5:1005861-1005883 CTGGAATGGCTGAGGGGACCAGG + Intergenic
985747471 5:1655308-1655330 CTGATGCGGCTGAGGGGACCAGG - Intergenic
985972924 5:3392265-3392287 CTGGGGTGGCTGGGGAGACCGGG + Intergenic
988714139 5:33808207-33808229 CTGAAATGGCTGTGGGGAGCAGG + Intronic
991471183 5:66970551-66970573 CTGGAATGGCTGTCTGGGCCTGG - Intronic
991657847 5:68921214-68921236 CTTGAGCGGCTGATGGGACCAGG - Intergenic
992800159 5:80288614-80288636 CTGGGGTGGCTTGGGGGACCTGG + Intergenic
993351355 5:86853727-86853749 TTGGAGTGTCTGAGGTGACCAGG - Intergenic
994190940 5:96868541-96868563 CCTGAATGGCTGAGTGGACTTGG - Intronic
994277494 5:97855900-97855922 CTGGAATATCTGAGGTGACTAGG + Intergenic
995247195 5:109947833-109947855 CAGGAATGGCTGAGGGAATAGGG + Intergenic
998218795 5:140258317-140258339 CTGGAGTGGCTGGGTGGTCCAGG + Intronic
998729799 5:145061889-145061911 CTGGCATGGCAGAGGTGATCAGG + Intergenic
999240896 5:150126849-150126871 CTGGCAGGGCTGAAGGGACGTGG - Intronic
999595193 5:153195460-153195482 ATGGTGTTGCTGAGGGGACCTGG - Intergenic
1000111400 5:158111590-158111612 CTGGAATAGCTGCAGGGAACTGG + Intergenic
1003331253 6:5130390-5130412 CTGGCATTGCACAGGGGACCTGG + Intronic
1004194057 6:13487972-13487994 CTGGGGTAGGTGAGGGGACCCGG + Intergenic
1005350825 6:24933861-24933883 GTGGAATGGCTGAGGTCCCCAGG - Intronic
1005812472 6:29528139-29528161 CTGGAAAGGCAGAGGTCACCTGG - Intergenic
1007629071 6:43262827-43262849 CTGGGCTGGCTGAGAGGAGCAGG - Exonic
1008562597 6:52737000-52737022 CAGGAAAGCCTGATGGGACCTGG - Intergenic
1011823195 6:91276344-91276366 CTGGAGGGGCTGTGGGGACACGG + Intergenic
1012032247 6:94086470-94086492 ATGGAATGGCTGTGGGCACAAGG - Intergenic
1012802779 6:103854203-103854225 CTGGAAGGGATGAGTGGGCCAGG + Intergenic
1015427804 6:133092533-133092555 CTGGAATAGCAGTGGGGATCTGG + Intergenic
1017054774 6:150426811-150426833 CTGGAATGGCAGTGGGGACATGG - Intergenic
1017122989 6:151041377-151041399 CTGAGATGACTGAGGGGACGGGG + Intronic
1017782862 6:157730003-157730025 CTGGAATGGGTGTGGGGGCGGGG + Intronic
1018384098 6:163287389-163287411 CTGGGAGGGCTGAGGGTCCCCGG - Intronic
1019035744 6:169057102-169057124 CTGGCAAGGCTGTGGGGAACAGG + Intergenic
1019113993 6:169741955-169741977 CTGGACTGGCAGAGGGGTACTGG - Intronic
1019212292 6:170416518-170416540 CTGGAATGGAGGAGGGGCCTCGG - Intergenic
1019299508 7:296238-296260 CAGGCAGGGCTGAGGGCACCAGG - Intergenic
1019864459 7:3693846-3693868 ATGAGATGGCTGCGGGGACCAGG - Intronic
1021820563 7:24494120-24494142 CTGGGATGGCTGTGGGGCCTTGG - Intergenic
1024063778 7:45716813-45716835 TTGGAATGGCTGAGGGAGGCAGG + Exonic
1024113627 7:46172302-46172324 TTGGAATGCCTGAGGGGGCAGGG + Intergenic
1026477528 7:70749681-70749703 CTGCTATGGCCCAGGGGACCTGG - Intronic
1028082843 7:86599622-86599644 TTGGAGTGTCTGAGGTGACCAGG + Intergenic
1028505114 7:91561864-91561886 CTGGAACGGCTGAAGGGATATGG + Intergenic
1031107973 7:117569003-117569025 TTGGAAATGCTGAGGTGACCAGG + Intronic
1032304740 7:130722140-130722162 CTTGACTGGATGAGTGGACCTGG + Intergenic
1033036400 7:137879861-137879883 GTGCAATGCCTGAGGGGATCAGG - Exonic
1033429486 7:141276091-141276113 TTAGAAAGGCTGAGGGGACATGG + Intronic
1034281509 7:149858040-149858062 CCGGAATAGGTGAGAGGACCTGG + Intronic
1035169243 7:157008863-157008885 CAGGAAAGCCTGAGGGGCCCAGG + Intronic
1035597103 8:866815-866837 CGGGAAAGGCCCAGGGGACCTGG - Intergenic
1036011732 8:4732906-4732928 CTGGGATGGCAGAGGAGATCGGG + Intronic
1036590901 8:10167129-10167151 CTGGCATGGGAGAGGGGACCTGG - Intronic
1036937848 8:13021640-13021662 TTGGAGTGGCTGAGAGCACCAGG + Exonic
1038311956 8:26451561-26451583 CTGGCATGGCTGAAGTGACATGG + Intronic
1043387388 8:79761761-79761783 CTGGACTGGGTGAGGGTTCCAGG - Intergenic
1044833725 8:96275792-96275814 GTAGAATGGCTGAGGGGAATGGG - Intronic
1048222632 8:132555997-132556019 GTGGAATGGGTGTGGGGACGTGG - Intergenic
1049206475 8:141365939-141365961 CTGGAGTGCCTCAGGGGCCCTGG + Intronic
1049229948 8:141476802-141476824 CTGGAATGCCTGAGGGCCCCGGG - Intergenic
1049233544 8:141496502-141496524 CTGAAATGGAGGAGGGGCCCTGG + Intergenic
1049344824 8:142133225-142133247 ACAGAATGGCTGAGGGGCCCAGG + Intergenic
1049728779 8:144164945-144164967 CTGGAGGGGCTGAAGGGACTAGG + Intronic
1051370907 9:16358255-16358277 GTGGAATGGGTGAGGGTTCCAGG - Intergenic
1053297940 9:36928249-36928271 CTGGAATGGCTGAGGAGCTGTGG - Intronic
1053684368 9:40507511-40507533 CTGAGATGACTGAGGGGACAGGG + Intergenic
1053934337 9:43135797-43135819 CTGAGATGACTGAGGGGACAGGG + Intergenic
1054279357 9:63117442-63117464 CTGAGATGACTGAGGGGACAGGG - Intergenic
1054297462 9:63342975-63342997 CTGAGATGACTGAGGGGACAGGG + Intergenic
1054321941 9:63678535-63678557 CTGGAATGGCTTAGGCAAACAGG - Intergenic
1054395480 9:64647483-64647505 CTGAGATGACTGAGGGGACAGGG + Intergenic
1054430126 9:65152683-65152705 CTGAGATGACTGAGGGGACAGGG + Intergenic
1054500257 9:65868849-65868871 CTGAGATGACTGAGGGGACAGGG - Intergenic
1054938162 9:70711366-70711388 CTGGACTGGCTGAGAGCACTGGG - Intronic
1054939853 9:70729359-70729381 CTGGACTGGCTGAGAGCACTGGG - Intronic
1055216218 9:73866133-73866155 CTGAAATGGCTAAGGGTACTGGG + Intergenic
1056798595 9:89675739-89675761 CTGCAAGGGCAGAGGGGACAGGG + Intergenic
1056807466 9:89740085-89740107 GTGGAGTGGCAAAGGGGACCCGG + Intergenic
1057043455 9:91864689-91864711 CTGGCATGTCAGAAGGGACCAGG + Intronic
1060036932 9:120263799-120263821 CTGGAGAGGCAGAGGCGACCAGG + Intergenic
1061936507 9:133860638-133860660 CTGGAATGGCAGAGAGAGCCTGG - Intronic
1062183253 9:135202480-135202502 CTGGCATGGCTCAGAGGGCCTGG + Intergenic
1062261204 9:135664030-135664052 CTGGAAGGGCGGAGGGGTTCTGG + Intronic
1203657185 Un_KI270753v1:9151-9173 CTGGAATGGCTCACAGAACCAGG - Intergenic
1186924569 X:14319105-14319127 TTGATATGGCTGAGGGGTCCAGG - Intergenic
1188880626 X:35487378-35487400 CTGGAAAGTCTGAGGGGACTAGG + Intergenic
1192144131 X:68669613-68669635 CTGAAGTGGCTGAGGTGGCCTGG + Intronic
1194867493 X:99086486-99086508 TTGGAATGTCTGAGGCAACCAGG + Intergenic
1198533347 X:137565853-137565875 CTTGAGTGGCTGCGGGGAACTGG - Intergenic
1199980474 X:152917803-152917825 CTGGAAAGGCCAAGGGGACCCGG + Intronic