ID: 985629564

View in Genome Browser
Species Human (GRCh38)
Location 5:1007656-1007678
Sequence GAGGCAGTAATTGGAGTGAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985629561_985629564 -2 Left 985629561 5:1007635-1007657 CCGAGGATGGTCTGAGAATGGGA No data
Right 985629564 5:1007656-1007678 GAGGCAGTAATTGGAGTGAAAGG No data
985629557_985629564 0 Left 985629557 5:1007633-1007655 CCCCGAGGATGGTCTGAGAATGG No data
Right 985629564 5:1007656-1007678 GAGGCAGTAATTGGAGTGAAAGG No data
985629559_985629564 -1 Left 985629559 5:1007634-1007656 CCCGAGGATGGTCTGAGAATGGG No data
Right 985629564 5:1007656-1007678 GAGGCAGTAATTGGAGTGAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985629564 Original CRISPR GAGGCAGTAATTGGAGTGAA AGG Intergenic
No off target data available for this crispr