ID: 985631629

View in Genome Browser
Species Human (GRCh38)
Location 5:1017120-1017142
Sequence CACCAGGACGTGCCTGGACA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 188
Summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 171}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985631626_985631629 -9 Left 985631626 5:1017106-1017128 CCTATCCTACTTCTCACCAGGAC 0: 1
1: 0
2: 8
3: 17
4: 197
Right 985631629 5:1017120-1017142 CACCAGGACGTGCCTGGACATGG 0: 1
1: 0
2: 1
3: 15
4: 171
985631618_985631629 28 Left 985631618 5:1017069-1017091 CCTCATCCTCGTTCCCACAAAGG 0: 1
1: 2
2: 6
3: 24
4: 216
Right 985631629 5:1017120-1017142 CACCAGGACGTGCCTGGACATGG 0: 1
1: 0
2: 1
3: 15
4: 171
985631623_985631629 -4 Left 985631623 5:1017101-1017123 CCGACCCTATCCTACTTCTCACC 0: 1
1: 0
2: 2
3: 36
4: 390
Right 985631629 5:1017120-1017142 CACCAGGACGTGCCTGGACATGG 0: 1
1: 0
2: 1
3: 15
4: 171
985631622_985631629 14 Left 985631622 5:1017083-1017105 CCACAAAGGATAGCAGAGCCGAC 0: 1
1: 4
2: 3
3: 4
4: 80
Right 985631629 5:1017120-1017142 CACCAGGACGTGCCTGGACATGG 0: 1
1: 0
2: 1
3: 15
4: 171
985631625_985631629 -8 Left 985631625 5:1017105-1017127 CCCTATCCTACTTCTCACCAGGA 0: 1
1: 0
2: 2
3: 15
4: 171
Right 985631629 5:1017120-1017142 CACCAGGACGTGCCTGGACATGG 0: 1
1: 0
2: 1
3: 15
4: 171
985631621_985631629 15 Left 985631621 5:1017082-1017104 CCCACAAAGGATAGCAGAGCCGA 0: 1
1: 2
2: 3
3: 5
4: 94
Right 985631629 5:1017120-1017142 CACCAGGACGTGCCTGGACATGG 0: 1
1: 0
2: 1
3: 15
4: 171
985631620_985631629 22 Left 985631620 5:1017075-1017097 CCTCGTTCCCACAAAGGATAGCA 0: 1
1: 0
2: 4
3: 18
4: 275
Right 985631629 5:1017120-1017142 CACCAGGACGTGCCTGGACATGG 0: 1
1: 0
2: 1
3: 15
4: 171

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985631629 Original CRISPR CACCAGGACGTGCCTGGACA TGG Intronic
900136816 1:1121264-1121286 CACCAGGACGTGCGTGGACGAGG + Intergenic
900603408 1:3512948-3512970 CACCCAGACGTGCAGGGACAGGG + Intronic
900971810 1:5996053-5996075 GACCAGGAGGGGCCTGAACATGG - Intronic
901049821 1:6420462-6420484 GAACAGGCCGAGCCTGGACAAGG + Intronic
901090439 1:6637369-6637391 CACAAGGAGGTGCCTGGAGGAGG - Intronic
901631154 1:10648850-10648872 TCCCAGGAAGGGCCTGGACAGGG + Intronic
901718778 1:11178269-11178291 AACCAGGAGATGCCTGGAGACGG - Intronic
902611697 1:17601734-17601756 AACAAGGACTTGGCTGGACACGG - Intronic
903467030 1:23558932-23558954 CACCTGGAGGTGTCAGGACACGG + Exonic
905938644 1:41844924-41844946 CACCAGGAACAGCCTGGAGAGGG + Intronic
907320967 1:53602089-53602111 CAGCAGGACGGGCCAGGACTGGG - Intronic
907551997 1:55312506-55312528 CAAAAGGACCTGCCTGGACCAGG - Intergenic
915902412 1:159856145-159856167 CACCAGGAGGTGCCAGGTCAGGG + Intronic
917458091 1:175202810-175202832 CACCAGGACCAGCCTAGATATGG - Intergenic
1063465653 10:6242385-6242407 GCCCAGGACGGGCCTGGCCAGGG + Intergenic
1063960450 10:11301581-11301603 CTCCAGGACGGGCTTGGACTGGG + Intronic
1065857282 10:29840791-29840813 CACCAGGACATACCTGAGCAGGG + Intergenic
1067297039 10:44980554-44980576 CCTCAGGACCTGCCTGGACAAGG - Intronic
1067821249 10:49532642-49532664 GACCAGGACGTGCTGGAACAGGG - Exonic
1071668823 10:87587900-87587922 AACCAGGACATGCTTTGACAAGG + Intergenic
1072618385 10:97064341-97064363 GACCAGCACGGGGCTGGACATGG + Intronic
1073359155 10:102883420-102883442 CACCAGTCCTTGCCTGGGCATGG + Intronic
1073513393 10:104056790-104056812 CCCCAGGAGGTACCTGGCCAAGG - Intronic
1075798971 10:125140847-125140869 AACCATGACGTGGCTGGGCATGG + Intronic
1076119052 10:127921489-127921511 CACCTGGACCTGCCTGGGAAGGG + Intronic
1076314392 10:129530717-129530739 CAGCAGGACCGGCCTGGCCATGG + Intronic
1077187988 11:1243960-1243982 CACCAGGCTGGGCCTGGGCACGG - Exonic
1077188414 11:1245631-1245653 CACCAGGCTGGGCCTGGGCACGG - Exonic
1077188944 11:1247731-1247753 CACCAGGCTGGGCCTGGGCACGG - Exonic
1077189370 11:1249402-1249424 CACCAGGCTGGGCCTGGGCACGG - Exonic
1077215116 11:1392146-1392168 CACCAGGAGTTGGGTGGACATGG + Intronic
1077768493 11:5188951-5188973 CACCAGGACCTGCCTTAATAAGG + Intergenic
1080539144 11:33249991-33250013 CACCATGTCCAGCCTGGACAAGG + Intergenic
1083153947 11:60811022-60811044 CACCAGGCCTTCCCAGGACACGG + Intergenic
1083775172 11:64891114-64891136 CACCAGGACCTGCAGGGATAGGG - Intergenic
1083812085 11:65111881-65111903 CGCCTGCACCTGCCTGGACACGG - Exonic
1084033994 11:66497034-66497056 CACCAGGTCCCGCCTGGAAATGG + Intronic
1084169124 11:67392041-67392063 CAGCATGAAGTGCCTGGTCACGG + Exonic
1086769516 11:90744832-90744854 CAGCAGGACGAGCTTGGACCTGG - Intergenic
1086890471 11:92252672-92252694 CACCAGCAAGTGACTGGACAGGG - Intergenic
1088226596 11:107627014-107627036 GACCATGACCTGCCTGGACCAGG + Intronic
1089542021 11:119194957-119194979 CACCAGCCTGTGCCTGGACTCGG + Exonic
1089621790 11:119726868-119726890 CTCTAGGACTTGCCTGGCCATGG - Intronic
1091276661 11:134357439-134357461 CTCCAGGCCGTGGCTGGGCATGG - Intronic
1091411229 12:240833-240855 CACAAAGACGTGCCTGGAAGGGG + Intronic
1096826975 12:54286943-54286965 CACAAGGACGTTCCTGCAAAAGG - Intronic
1098550269 12:71754785-71754807 CAGAAGAACGTGCCTGGACGTGG - Intergenic
1101906080 12:108827555-108827577 CATCAGGATGTGCTGGGACAAGG - Intronic
1102934858 12:116887817-116887839 TACAAGGACGTCCCTGGAGAAGG - Intergenic
1103261483 12:119593102-119593124 CACCTGGACGGGCATGGACCGGG + Intergenic
1105016553 12:132789203-132789225 CACCAGGAAGAGGCTGGACTCGG - Exonic
1105038551 12:132943953-132943975 CATCAGGACGTTCCTGGGCATGG - Intronic
1120793982 14:88610901-88610923 CACCACGACATGCCTTGAAATGG + Exonic
1123108554 14:105854642-105854664 CACCATCACGTGCCTGGTGACGG - Intergenic
1127972686 15:63973875-63973897 AACCAGGGCCTGCCTGGAGAAGG - Intronic
1129241813 15:74256474-74256496 CAGCAGGACTTGCCAGGACGTGG - Intronic
1132128097 15:99247698-99247720 AACCAGGACTTGCCTGCAAATGG + Intronic
1132209622 15:100010351-100010373 AATCAGGAGGTGCCTGCACAGGG + Intronic
1132550865 16:553329-553351 CACCAGGACCTGCCTGGGGGAGG - Exonic
1132906302 16:2284489-2284511 CTCCAGGACGGGCCTGGTCAGGG + Intronic
1132978333 16:2721347-2721369 CACCACGACGCGCGCGGACAAGG - Intergenic
1133008728 16:2898474-2898496 CACCAGGAGGTCCCTGCAGAGGG + Intronic
1133302052 16:4788318-4788340 CACCAGGCCCTGCCAGGACAAGG - Exonic
1134519553 16:14912282-14912304 TTCCAGGAGGTGTCTGGACAAGG + Intronic
1134554378 16:15153953-15153975 TTCCAGGAGGTGTCTGGACAAGG - Intergenic
1134707225 16:16310938-16310960 TTCCAGGAGGTGTCTGGACAAGG + Intergenic
1134960316 16:18401187-18401209 TTCCAGGAGGTGTCTGGACAAGG - Intergenic
1136069101 16:27777596-27777618 CACCAGGAGCTGCAGGGACACGG - Exonic
1138729749 16:59182168-59182190 CACCAGCATGTGCGTGCACATGG - Intergenic
1139490332 16:67282497-67282519 CACCAGGACGGCAATGGACAAGG + Exonic
1141023332 16:80519320-80519342 CCCCAGGAAGTTCCTGGGCAGGG - Intergenic
1142961927 17:3556785-3556807 CATCAGGCCGTGACTGGACACGG - Intronic
1145065298 17:19757721-19757743 CACCAGCAGGTCCCTGGCCATGG + Intergenic
1146554185 17:33809349-33809371 CTTCAGGACCTGCCTGGACTGGG + Intronic
1148859540 17:50596824-50596846 CACCAGCACGGGCCTGGGCGAGG + Exonic
1151756356 17:76077363-76077385 TGCCAGGACGGGCCAGGACAGGG - Exonic
1152290322 17:79436601-79436623 CAGCAGTACGTGCCTGGGCCTGG + Intronic
1152352427 17:79791168-79791190 CACCAGGAGGAACATGGACAGGG - Intergenic
1154334430 18:13454656-13454678 CAGCAGGACATGCCTGGCCCGGG + Intronic
1157639039 18:49194034-49194056 CATCATGACGTGCCAGGGCATGG + Intronic
1157786040 18:50483451-50483473 GACCAGGCCCTCCCTGGACACGG + Intergenic
1157890976 18:51417725-51417747 CACTAGGTGGTGCCTGGACTAGG + Intergenic
1158630398 18:59109195-59109217 AACCAGGGCATTCCTGGACAAGG + Intergenic
1160455591 18:78996845-78996867 CACGAGTAAGTGCCTAGACACGG - Intronic
1161297478 19:3527145-3527167 CACCAGGACCCGCAGGGACAGGG - Intronic
1161529798 19:4781326-4781348 CACCATGTCTGGCCTGGACAGGG - Intergenic
1161771865 19:6235314-6235336 CACCAGCAGGAGCCTGGCCACGG + Intronic
1162039701 19:7962979-7963001 CAACGGGACCTGCCTGGAAAAGG + Exonic
1163031317 19:14545974-14545996 CCCCAGGACATGGCTGGACTAGG + Intronic
1163522142 19:17797703-17797725 CACCAGGGAGTGCCTGGGTATGG - Intronic
1165068732 19:33243134-33243156 CACCAGGACCTGTGTGGACTGGG + Intergenic
1166133389 19:40760618-40760640 CACCAGGACCTGCATGACCAGGG + Intronic
1166293883 19:41879542-41879564 CCCCAGGCCCTTCCTGGACATGG + Exonic
925131729 2:1498440-1498462 CACAAGGAGCTGCCTGGGCATGG + Intronic
926230915 2:11003211-11003233 CACCTGGACGTCCCTGGTCAAGG - Intergenic
927255920 2:21040925-21040947 CAACATGACTTACCTGGACATGG + Exonic
927904304 2:26846599-26846621 CTCCAGGGCTTGCCCGGACAGGG - Intergenic
927981504 2:27377681-27377703 CACCAGAAGGTGCATGGCCACGG - Exonic
929004223 2:37379919-37379941 CCCCAGGCCATGTCTGGACAAGG - Intergenic
930481045 2:51948363-51948385 CACCAGAACTGACCTGGACATGG - Intergenic
933714387 2:85349538-85349560 CAGCAGGGCGTGCATGGAAAAGG + Exonic
938158101 2:128958616-128958638 AAACAGGCCCTGCCTGGACATGG + Intergenic
938657848 2:133452837-133452859 CACCAGGGCATGACTGTACAGGG - Intronic
1170383692 20:15792149-15792171 CACTAGGTGGTGCCGGGACAAGG + Intronic
1171180613 20:23088055-23088077 CACCAGGAGGTGGGTGTACAAGG + Intergenic
1172034593 20:32002134-32002156 AACCAGGCCAGGCCTGGACAGGG - Exonic
1173284767 20:41660260-41660282 CACCAGGAAGTAACTGGATATGG - Intergenic
1173391783 20:42641802-42641824 CACCAGGTCTTGCCTGGGCATGG - Intronic
1175999482 20:62825556-62825578 CACGAGGAGGGGCCTGGACAGGG + Intronic
1180847488 22:18991894-18991916 CACCAGGACGGGCCTCTCCAGGG - Intergenic
1182421134 22:30249078-30249100 GAGCAGGTGGTGCCTGGACATGG - Intergenic
1184601321 22:45545171-45545193 CACAAGAACGTGTATGGACAAGG + Intronic
1184732931 22:46380856-46380878 CACCAGGACGGGCCTCTCCAGGG + Exonic
1185286262 22:50001170-50001192 CTCCAGGACTGACCTGGACATGG + Exonic
949566167 3:5246742-5246764 CACCAGGAGGTCCCTGGGCGTGG - Intergenic
956505535 3:69934716-69934738 CACCAGGAAATGCCTGGATTTGG + Intronic
956881910 3:73519622-73519644 TTCCAGGACATGCCTGGACATGG - Intronic
961195631 3:124999044-124999066 CACCAAAACCTGCCTGGGCAGGG - Intronic
963576741 3:147069863-147069885 CACCAGGGCCTGTCTGGGCATGG - Intergenic
966771728 3:183510321-183510343 CACCAGGACCTGCCTTCAGAAGG - Intronic
968266289 3:197366025-197366047 CACCAGGTCATTCCTGCACAAGG - Intergenic
969432575 4:7164435-7164457 CACCAGAACTTGGCCGGACATGG - Intergenic
970273379 4:14370223-14370245 CACCAGGAAGGACCAGGACATGG + Intergenic
972673342 4:41235144-41235166 CACCATGCCCGGCCTGGACAAGG + Intergenic
974057865 4:57002317-57002339 CTCCAGGTCGGGCCTGGACACGG - Intronic
978390673 4:108222291-108222313 CACCAGGCTGTGCCTAGGCATGG + Intergenic
982215619 4:153080417-153080439 CACCAGGAAGTGTCTGGATAAGG + Intergenic
984323269 4:178221649-178221671 AAGCAGGACATGCATGGACATGG - Intergenic
985631629 5:1017120-1017142 CACCAGGACGTGCCTGGACATGG + Intronic
985778762 5:1858706-1858728 CACCAGGACGTGCCGGAAAGAGG + Intergenic
987118936 5:14748395-14748417 CTCAAGGCAGTGCCTGGACAGGG + Intronic
988490086 5:31698787-31698809 CACGAGGAAGTACCTGCACAAGG + Intronic
997655777 5:135553220-135553242 CACTAGGAGGTGGGTGGACAGGG + Intergenic
999332851 5:150688926-150688948 CACCATTACTTGCCTGGACACGG + Intergenic
999394308 5:151217297-151217319 AACAAGGAGGTGCCTGGACAGGG - Intronic
1001534366 5:172488435-172488457 CACGAGGCCATGCCTGGAGATGG - Intergenic
1002329225 5:178429978-178430000 CTCCAGAGCCTGCCTGGACAAGG - Intronic
1002573587 5:180158715-180158737 CACAAGGACGCACCTTGACACGG + Intronic
1005037492 6:21570115-21570137 CACCAGCACTTGCCTGGGAATGG + Intergenic
1007637185 6:43306563-43306585 CACCAGCACCTGCCTGCATATGG + Intronic
1009024397 6:57981382-57981404 CACTACCACCTGCCTGGACAAGG + Intergenic
1009199979 6:60732868-60732890 CACTACCACCTGCCTGGACAAGG + Intergenic
1010687236 6:78867492-78867514 CACCAGGGCTTGCCTGTGCACGG - Exonic
1012321662 6:97855113-97855135 CAACAGGATGTGCCTGGGGATGG + Intergenic
1019158277 6:170052956-170052978 CACCATGAAGAGCCAGGACAGGG - Intergenic
1019188445 6:170235591-170235613 CAGCTGGACCTGCCTGCACAGGG + Intergenic
1019469422 7:1210870-1210892 AGCCAGGACGTGCCTGGAGGGGG - Intergenic
1020451342 7:8323552-8323574 CCCCAGGCCTTGCCGGGACATGG - Intergenic
1022977742 7:35574632-35574654 GAGCAGGACTGGCCTGGACAGGG + Intergenic
1023964829 7:44957933-44957955 CACCAAAACTTGGCTGGACACGG + Intergenic
1024176775 7:46848315-46848337 ATCCAGGCAGTGCCTGGACAAGG + Intergenic
1024768052 7:52684656-52684678 CACCAGGAGGTGGTTGTACAAGG + Intergenic
1025611049 7:63075901-63075923 CACCATGACATTCCTGGGCATGG - Intergenic
1029501306 7:100932305-100932327 CACCAGGATGTTTCTGGGCATGG - Intergenic
1029538533 7:101169934-101169956 CGCCAGGACGTGCGCGGACGCGG - Intergenic
1030305837 7:108018329-108018351 CACCAGTAAGAGACTGGACATGG + Intergenic
1034329256 7:150268931-150268953 CCCCAGGACGTGCCCACACAGGG - Intronic
1034668798 7:152840929-152840951 CCCCAGGACGTGCCCACACAGGG + Intronic
1035086399 7:156262754-156262776 CACCAGGGCCTGTCGGGACATGG - Intergenic
1035249645 7:157588508-157588530 CACCAGGACATGACTGGGCTGGG + Intronic
1035430695 7:158818553-158818575 CACCAGGACTTGCCTGCAAGCGG + Intronic
1039825169 8:41167146-41167168 CTCCAGGATGTGGCTGTACATGG + Intergenic
1040386920 8:46920297-46920319 CACCAGGACAAGCTGGGACAGGG + Intergenic
1041196821 8:55409036-55409058 CACCAGGAGGGGAGTGGACAGGG + Intronic
1045217011 8:100158435-100158457 CGCCAGGACCTGCCGGGACTGGG - Exonic
1047017362 8:120737665-120737687 CACCAAGACATACCTTGACATGG - Intronic
1048878931 8:138857555-138857577 GAGCAGGAGGGGCCTGGACATGG - Intronic
1049776101 8:144405939-144405961 CACCAGGGCAAGCCTTGACAGGG - Intronic
1051105771 9:13578419-13578441 CACCAGGAGGTCCCTAGCCAAGG + Intergenic
1052162823 9:25288332-25288354 CACCAGGATGAGCCAGGAGAAGG - Intergenic
1052990068 9:34513936-34513958 CACCTGCTCTTGCCTGGACAAGG + Intronic
1056177771 9:84052095-84052117 CACCTGCAGGTGCCTTGACAGGG + Intergenic
1056271982 9:84955427-84955449 CACCAGGAACTGCCTGGTCGGGG + Exonic
1057805357 9:98216018-98216040 CACCAGGCGGTGCCGGTACATGG - Intronic
1060158629 9:121338888-121338910 CACCAGAGGGTGCCTGGACCTGG + Intergenic
1060547634 9:124470397-124470419 CACCTGTACGTGCCTGGAGCGGG - Intronic
1061047763 9:128176362-128176384 CTCCAGGACGTCCCGGGGCACGG + Exonic
1062521891 9:136961399-136961421 CACCAGGGCCTGCAGGGACAGGG + Intergenic
1203791009 EBV:151530-151552 CACCAGCCCGTACCTGGCCACGG + Intergenic
1203485594 Un_GL000224v1:51109-51131 CACCATCACGTCCCTGTACAGGG - Intergenic
1192195913 X:69028074-69028096 CACCTGGACTGGCCTGGACTTGG + Intergenic
1194182687 X:90733653-90733675 CACCAGGAGGTGGTTGTACAAGG + Intergenic
1196406535 X:115368278-115368300 CTCCAGGCAGTGCCTAGACATGG + Intergenic
1199532604 X:148867321-148867343 CACCTGGAGGTCCCTGGAGAAGG + Intronic
1199679763 X:150216448-150216470 CATCAGGACAGACCTGGACAGGG - Intergenic
1199681699 X:150229180-150229202 CATCAAGACATGCCTGGAAAAGG - Intergenic
1200154017 X:153965707-153965729 CCCCAGGACGTGACAGGGCATGG + Intronic
1200529308 Y:4315608-4315630 CACCAGGAGGTGGTTGTACAAGG + Intergenic