ID: 985632056

View in Genome Browser
Species Human (GRCh38)
Location 5:1018880-1018902
Sequence CCAAGGATGTTCCTCCCTGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985632056_985632065 14 Left 985632056 5:1018880-1018902 CCCACAGGGAGGAACATCCTTGG No data
Right 985632065 5:1018917-1018939 GAGAGCACCATCCCTGCTTTGGG No data
985632056_985632066 15 Left 985632056 5:1018880-1018902 CCCACAGGGAGGAACATCCTTGG No data
Right 985632066 5:1018918-1018940 AGAGCACCATCCCTGCTTTGGGG 0: 1
1: 0
2: 1
3: 14
4: 142
985632056_985632068 23 Left 985632056 5:1018880-1018902 CCCACAGGGAGGAACATCCTTGG No data
Right 985632068 5:1018926-1018948 ATCCCTGCTTTGGGGCATCTAGG 0: 1
1: 0
2: 1
3: 6
4: 169
985632056_985632069 24 Left 985632056 5:1018880-1018902 CCCACAGGGAGGAACATCCTTGG No data
Right 985632069 5:1018927-1018949 TCCCTGCTTTGGGGCATCTAGGG No data
985632056_985632064 13 Left 985632056 5:1018880-1018902 CCCACAGGGAGGAACATCCTTGG No data
Right 985632064 5:1018916-1018938 AGAGAGCACCATCCCTGCTTTGG No data
985632056_985632071 25 Left 985632056 5:1018880-1018902 CCCACAGGGAGGAACATCCTTGG No data
Right 985632071 5:1018928-1018950 CCCTGCTTTGGGGCATCTAGGGG 0: 1
1: 0
2: 1
3: 12
4: 120

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985632056 Original CRISPR CCAAGGATGTTCCTCCCTGT GGG (reversed) Intronic