ID: 985632056

View in Genome Browser
Species Human (GRCh38)
Location 5:1018880-1018902
Sequence CCAAGGATGTTCCTCCCTGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 165
Summary {0: 1, 1: 0, 2: 2, 3: 12, 4: 150}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985632056_985632069 24 Left 985632056 5:1018880-1018902 CCCACAGGGAGGAACATCCTTGG 0: 1
1: 0
2: 2
3: 12
4: 150
Right 985632069 5:1018927-1018949 TCCCTGCTTTGGGGCATCTAGGG No data
985632056_985632065 14 Left 985632056 5:1018880-1018902 CCCACAGGGAGGAACATCCTTGG 0: 1
1: 0
2: 2
3: 12
4: 150
Right 985632065 5:1018917-1018939 GAGAGCACCATCCCTGCTTTGGG No data
985632056_985632071 25 Left 985632056 5:1018880-1018902 CCCACAGGGAGGAACATCCTTGG 0: 1
1: 0
2: 2
3: 12
4: 150
Right 985632071 5:1018928-1018950 CCCTGCTTTGGGGCATCTAGGGG 0: 1
1: 0
2: 1
3: 12
4: 120
985632056_985632064 13 Left 985632056 5:1018880-1018902 CCCACAGGGAGGAACATCCTTGG 0: 1
1: 0
2: 2
3: 12
4: 150
Right 985632064 5:1018916-1018938 AGAGAGCACCATCCCTGCTTTGG No data
985632056_985632068 23 Left 985632056 5:1018880-1018902 CCCACAGGGAGGAACATCCTTGG 0: 1
1: 0
2: 2
3: 12
4: 150
Right 985632068 5:1018926-1018948 ATCCCTGCTTTGGGGCATCTAGG 0: 1
1: 0
2: 1
3: 6
4: 169
985632056_985632066 15 Left 985632056 5:1018880-1018902 CCCACAGGGAGGAACATCCTTGG 0: 1
1: 0
2: 2
3: 12
4: 150
Right 985632066 5:1018918-1018940 AGAGCACCATCCCTGCTTTGGGG 0: 1
1: 0
2: 1
3: 14
4: 142

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985632056 Original CRISPR CCAAGGATGTTCCTCCCTGT GGG (reversed) Intronic
902572550 1:17356117-17356139 CCAAGACTGTACCTTCCTGTCGG - Exonic
902655820 1:17867392-17867414 ACATGCATGTTCCTACCTGTGGG - Intergenic
904300374 1:29550038-29550060 CCAAGGAGGCTAGTCCCTGTGGG - Intergenic
905401625 1:37707871-37707893 CCAAGGAGGTTCATCCCTGGCGG - Intronic
906387510 1:45383631-45383653 TAAAGGATGTTCTTCTCTGTCGG + Intronic
906955344 1:50369539-50369561 CCAAGGGTCCTCCTCCATGTAGG - Intergenic
907782822 1:57582814-57582836 CCAATCATGATCCACCCTGTGGG - Intronic
911861570 1:102956611-102956633 CCAAGGATTTTTCTAACTGTAGG + Intronic
912496887 1:110097606-110097628 CCAAGGCCGTTCCACCCTGGGGG + Intergenic
912633401 1:111268522-111268544 CCACTGATTTTCCTCCCTGCAGG - Intergenic
913264735 1:117033314-117033336 CCAAGCCTGGCCCTCCCTGTGGG - Intronic
915415471 1:155739048-155739070 CTAAGGATGTTGCTACCTGGAGG + Intergenic
918476353 1:184928859-184928881 CCAGCGATTTTCCTCCCTGCAGG - Intronic
1064473359 10:15660178-15660200 ACAAGGCTGGTCCTACCTGTGGG - Intronic
1065202219 10:23324132-23324154 GCAAGGATGTTCCTATCTGGTGG + Intronic
1066649394 10:37640406-37640428 CCAAGGCTCTTTCTCCCTGCTGG - Intergenic
1067170063 10:43898858-43898880 TGAAGGAAATTCCTCCCTGTTGG - Intergenic
1067231879 10:44417868-44417890 CCAAGCATGTTCCTACCTCAGGG - Intergenic
1067479415 10:46585297-46585319 GCAAGCCTGTCCCTCCCTGTTGG - Intronic
1067615323 10:47756501-47756523 GCAAGCCTGTCCCTCCCTGTTGG + Intergenic
1069807342 10:71134186-71134208 CCAAGGAGGCTTCTCGCTGTGGG - Intergenic
1071630725 10:87216452-87216474 ACAAGCCTGTCCCTCCCTGTTGG + Intergenic
1074516031 10:114170719-114170741 CCAAGGTTATTTATCCCTGTGGG + Intronic
1075864586 10:125706705-125706727 ACATGGTTCTTCCTCCCTGTGGG + Intergenic
1076801941 10:132834995-132835017 CCACGGAGGGTCCTGCCTGTGGG + Intronic
1081592257 11:44432435-44432457 CAAAGGCTGTTACTCTCTGTAGG + Intergenic
1081737845 11:45416751-45416773 CCAGGCATGCTCCTTCCTGTAGG + Intergenic
1082178813 11:49093924-49093946 CCAAGGATTTTGATACCTGTGGG - Intergenic
1086094653 11:83038203-83038225 CCAAGGGAGTTCTGCCCTGTTGG - Intronic
1086554786 11:88096266-88096288 CCAAGCATGTTCCTCCCTCAGGG + Intergenic
1088267330 11:108000427-108000449 CCAAGGCTTTTCCTGCCTGAAGG - Intergenic
1089582954 11:119492821-119492843 CCCAGGGTGGTCCTCCCTCTAGG - Intergenic
1091815111 12:3431884-3431906 CCAGCGAGGTTCCTCCCAGTAGG - Intronic
1093425164 12:19020385-19020407 ACAAGGATGTTTCTCTCTTTGGG - Intergenic
1093829454 12:23737757-23737779 CCAAGGATATTCCTGCTTCTGGG + Intronic
1096112461 12:49037725-49037747 CCCAGGAGGATCCTCCCTGCTGG - Exonic
1097106491 12:56629400-56629422 CCAAGGAGATTCCTCACTGAGGG - Intronic
1100609621 12:96180519-96180541 CCCAGGTTGAACCTCCCTGTAGG - Intergenic
1101104580 12:101427413-101427435 CCAAGGATGTTCGTAATTGTTGG + Intergenic
1102078978 12:110082735-110082757 CCAAGGCTTTTCTTCTCTGTCGG + Intergenic
1103211500 12:119170420-119170442 TCAAGCATGTTCCTGCCTGAAGG - Intergenic
1103725422 12:122995316-122995338 CAGGGGATGTTCCTCCCTCTTGG + Intronic
1104856999 12:131906981-131907003 CCAGCCATGTCCCTCCCTGTGGG - Intronic
1104964699 12:132503594-132503616 CCATGGGTGGGCCTCCCTGTAGG + Intronic
1106712060 13:32348374-32348396 ACAAGGATGTGCCTTACTGTGGG - Intronic
1108737633 13:53301246-53301268 CCAAGGAAATGCCACCCTGTGGG - Intergenic
1109554582 13:63955442-63955464 TCAAGGAGATTCCTTCCTGTTGG - Intergenic
1109803620 13:67407345-67407367 CCAGTGATATTCCTCCCTGTAGG - Intergenic
1111612736 13:90624503-90624525 CCAAGTATCTTCCTTTCTGTAGG + Intergenic
1111842905 13:93472884-93472906 CTAAGGAGCTTTCTCCCTGTGGG - Intronic
1115961007 14:38836216-38836238 ACCAGGATGTTCTGCCCTGTGGG - Intergenic
1116359470 14:43975140-43975162 AAAAGGATGATCCTCTCTGTGGG - Intergenic
1118833858 14:69461802-69461824 CAAAGGATGTTCCTGCCTTGTGG + Intronic
1119428440 14:74550807-74550829 CCAAGGAAGTTCCCCTCTGGAGG - Intronic
1119741726 14:77018035-77018057 CCAAGATAGTTGCTCCCTGTTGG + Intergenic
1122133009 14:99616844-99616866 ACAAGGCTGATCCTTCCTGTGGG - Intergenic
1124136457 15:27039940-27039962 CCCAGGAAGTTCCTCCTTGCTGG + Intronic
1125302223 15:38268313-38268335 CTAAGGATGTACCTCCGTGTTGG - Intronic
1126499967 15:49334764-49334786 GAAAGGATGATCCTCCCTTTTGG - Intronic
1127561492 15:60141528-60141550 CCAAGGAGGTTCCTTCATGTTGG + Intergenic
1129512992 15:76138621-76138643 CTAAGCATGTTCCTGCATGTAGG - Intronic
1130456763 15:84118461-84118483 CCATGGATGTTACTTCCTGAAGG - Intergenic
1135800466 16:25489329-25489351 CCAGGGATGTCCCTCCCTCAAGG - Intergenic
1137797708 16:51236197-51236219 CCAAGCATGTTCCTGCCTCCAGG + Intergenic
1138516462 16:57537971-57537993 CCAAGGCTGTTACTGGCTGTAGG - Intergenic
1138806957 16:60101118-60101140 CCACTGATCATCCTCCCTGTAGG - Intergenic
1140011284 16:71133941-71133963 GCAATGACGTTCCTCCCCGTGGG - Intronic
1140467284 16:75192646-75192668 ACCAGGATGTCCTTCCCTGTTGG + Intergenic
1141663164 16:85452628-85452650 CCCAGGCTGTTCCCACCTGTGGG + Intergenic
1144052606 17:11509860-11509882 CCATAGATGTTCCTCCTTGCAGG - Intronic
1145101143 17:20078966-20078988 CCAAGAATCTTCTTGCCTGTGGG - Intronic
1147392834 17:40121312-40121334 TCATGGATTTTCCTCCCTCTGGG + Intergenic
1147664695 17:42139123-42139145 CCAATAGTCTTCCTCCCTGTGGG - Intronic
1150334892 17:64323567-64323589 CCAAGGATGTTCCAACTTGGTGG + Exonic
1154296736 18:13157857-13157879 CCAAGGATATTTCTCCCTTCTGG + Intergenic
1156602896 18:38631057-38631079 CCTAGGATGCTCCTCACTGAAGG - Intergenic
1159972843 18:74675142-74675164 CCAAGCATGTTTCTGCCTGAGGG + Intronic
1160343504 18:78110326-78110348 CCAAGGAGGTTTCTCCTTCTGGG - Intergenic
1160622030 18:80178476-80178498 CCAGGGATGCTCCTCTCTATGGG - Intronic
1165765666 19:38349449-38349471 CCAAGGAGATTTCTCCCTGATGG + Intronic
925597026 2:5565015-5565037 GCAGGGATGTGCCTCCCAGTAGG + Intergenic
925627275 2:5853804-5853826 CCAAAGTGGTTCCTCCCTGGTGG - Intergenic
927808590 2:26169534-26169556 CCCAGCATCTTCCTCCCTCTTGG + Intergenic
931748558 2:65311549-65311571 CCAAGGAAGTGCCTCCGGGTCGG + Exonic
934158165 2:89222503-89222525 CAAGGGAAGGTCCTCCCTGTGGG + Intergenic
934209098 2:89959921-89959943 CAAGGGAAGGTCCTCCCTGTGGG - Intergenic
935810157 2:106789728-106789750 CCCAGCATTTTCCTTCCTGTAGG + Intergenic
935938726 2:108216072-108216094 ACAAGGATGTGTCTCCCTGGAGG - Intergenic
940337523 2:152544786-152544808 CTAAGCATCTTCCTCCATGTGGG - Intronic
940856254 2:158730712-158730734 CCACGCATGTTCCTCCTTGTTGG - Intergenic
944600466 2:201297970-201297992 GCCAGGATGTTCCTACCTGGGGG - Intronic
947305400 2:228740755-228740777 TCAGGGATGTTTCTCCCTTTGGG + Intergenic
1169199940 20:3704037-3704059 GGAAGGATGTTCCTCCCCGAGGG + Exonic
1170465257 20:16617097-16617119 CCAAGGACATTCCTCTCAGTAGG + Intergenic
1171544516 20:25990123-25990145 CCAAAGATATTTCTCCCTGATGG - Intergenic
1173194552 20:40903573-40903595 CCAGGCATGTTCCTGCCTCTGGG - Intergenic
1177181178 21:17746184-17746206 ATAAGGATGTTCCTTCCTGTGGG + Intergenic
1179212865 21:39340352-39340374 CAAAAGGTGTTCCTTCCTGTGGG + Intergenic
1179444968 21:41424668-41424690 CCATGGGTGGTCCTCCCTTTGGG - Intronic
1179789310 21:43747287-43747309 CCAAAGGTGATCCTGCCTGTGGG + Intronic
1181732827 22:24859893-24859915 ACAAGGAAGTTCCTCCCCGGGGG + Intronic
1181978717 22:26751347-26751369 CCAGGGCTGTCCTTCCCTGTGGG + Intergenic
1183104607 22:35607104-35607126 CCAGCGATGCGCCTCCCTGTGGG - Exonic
1183672703 22:39282607-39282629 CCTAGGCCGTTCCTCACTGTGGG + Intergenic
1184839789 22:47046013-47046035 CCAAGGAGGTTCCCGGCTGTGGG + Intronic
951705873 3:25543761-25543783 CCAATCTTGCTCCTCCCTGTGGG - Intronic
952162755 3:30710824-30710846 ATAAGGATGTTCCTTCCTCTGGG + Intergenic
952843534 3:37668017-37668039 CCAAGGACGTTTTTCTCTGTTGG + Intronic
955012615 3:55033140-55033162 CTAAGGGGCTTCCTCCCTGTAGG - Intronic
956466054 3:69521715-69521737 CCAAGCATGTTCCTACCTCTGGG + Intronic
957252606 3:77793270-77793292 CAAAATATGTTTCTCCCTGTGGG + Intergenic
957568929 3:81920887-81920909 CAAAGCATGTTACTTCCTGTTGG - Intergenic
959750225 3:109826031-109826053 GAAAGGATGTTTCTCCCAGTGGG - Intergenic
962955641 3:140263796-140263818 TCAAGGATGTTTCTCCCTACTGG - Intronic
963826389 3:149959058-149959080 CCAAGGTTGTTACCCCGTGTGGG + Intronic
968519959 4:1030750-1030772 CCAAGGCTGGGGCTCCCTGTGGG + Intergenic
972312713 4:37895869-37895891 CAAGGGTTGTTGCTCCCTGTGGG + Intronic
980305387 4:131054235-131054257 CCAATGATGTTTCTGCCTCTAGG + Intergenic
983982598 4:174017066-174017088 CCAAGGAAGTTTCTCCCCTTCGG - Intergenic
984117936 4:175705604-175705626 CCAAGGCTGTTCCTCTCTGTGGG - Intronic
985632056 5:1018880-1018902 CCAAGGATGTTCCTCCCTGTGGG - Intronic
990388271 5:55290645-55290667 TCAAGGAAGTTTCTCCATGTGGG - Intronic
993169803 5:84404055-84404077 CCTTGGATTTTCCTCCCTGTGGG + Intergenic
993389226 5:87297909-87297931 CCAAGGAAGTTTCTGCTTGTGGG + Intronic
994970418 5:106730437-106730459 CCAAGGATGTCCATCCCTGTAGG + Intergenic
997721287 5:136080038-136080060 CCAAGTTTCTTCCTCCCTGGCGG - Intergenic
998460787 5:142308586-142308608 CAAAGGATGTTCTTCAATGTGGG - Intergenic
1001681622 5:173562048-173562070 TCATGGATTTTCCTGCCTGTTGG + Intergenic
1001820615 5:174707307-174707329 ACAAGAATGTTCCTCCGTCTCGG - Intergenic
1003928096 6:10896161-10896183 CTAAAGATGTTCCTTTCTGTAGG - Intronic
1006979777 6:38137808-38137830 CCAAGTTTGTTCCTCCCTCCAGG - Intronic
1007310053 6:40938184-40938206 CACAGGATGCTCCTTCCTGTTGG + Intergenic
1009215829 6:60918929-60918951 CCAATGATGTTGCTTACTGTTGG + Intergenic
1013593976 6:111644873-111644895 TCAAGGAGGTGCCACCCTGTTGG - Intergenic
1015262381 6:131252940-131252962 CCTAGAATGTTCCTCCTTGAAGG + Intronic
1017993742 6:159512317-159512339 TCAAGGATGTTTCTCTTTGTAGG - Intergenic
1018393606 6:163359794-163359816 CCACGGATCTTCCTACTTGTGGG - Intergenic
1018616488 6:165691724-165691746 CCAAGCCTGTTCCTCCCAGGTGG + Intronic
1022293828 7:29030561-29030583 CCAAGCATCTTCCTACCTGATGG + Exonic
1024997174 7:55280539-55280561 CCAAGGACTTTCCTACCTGTGGG - Intergenic
1025689724 7:63748048-63748070 CCAAAGCTGTTCCTGCCTTTCGG + Intergenic
1037638895 8:20724773-20724795 CCAAGAAGGTTCCTCACTGGAGG + Intergenic
1038860163 8:31379118-31379140 CCAAGGATGTGCCTCTCTGAAGG - Intergenic
1039896588 8:41720784-41720806 CCTAGGATGTTCTTCCCCTTTGG - Intronic
1043476613 8:80611567-80611589 CCAGGGACGTTCCTCCCTGCAGG - Intergenic
1043977244 8:86597468-86597490 CCAATGATGTTCCTTTCTTTTGG - Intronic
1044823621 8:96176412-96176434 CCAAGGATGCTCCACCCTTGGGG + Intergenic
1048517874 8:135126717-135126739 CCCATGGTGTTCTTCCCTGTGGG + Intergenic
1051542061 9:18230921-18230943 CCTAGGATTTTCCTCCTTGGGGG + Intergenic
1056020464 9:82433403-82433425 CCTTGGATGGGCCTCCCTGTGGG + Intergenic
1056150561 9:83783038-83783060 TCAAGGAAGTTTTTCCCTGTAGG - Intronic
1056555098 9:87681620-87681642 GCATGGAGGTTCCTACCTGTGGG - Exonic
1056872090 9:90291240-90291262 CCAAGCATGTTCCTTCTGGTGGG - Intergenic
1057131188 9:92655674-92655696 CCAAGAATGTTCCTTCCTCAAGG + Intronic
1059923838 9:119186623-119186645 CCAAGGCTGTGCTTCCCTGGGGG - Intronic
1060581749 9:124754122-124754144 CCAAGGTTTTTCTCCCCTGTGGG - Intronic
1060908398 9:127328788-127328810 CCAAGAATGTGACTGCCTGTTGG + Intronic
1188572406 X:31603822-31603844 CTAAGGATGATCCTTCCTGGTGG + Intronic
1189221956 X:39380095-39380117 CCAAGGATTTTCCTACTTGAAGG + Intergenic
1190199439 X:48347579-48347601 CCAGGCATGTTCCCCCCTTTTGG + Exonic
1190666210 X:52698063-52698085 CCAGGCATGTTCCCCCCTTTTGG + Exonic
1190673208 X:52760347-52760369 CCAGGCATGTTCCCCCCTTTTGG - Exonic
1192947495 X:75981980-75982002 TCAGGGATATTTCTCCCTGTGGG + Intergenic
1196234631 X:113263558-113263580 CCAGTGATCTTCCTCCCCGTAGG - Intergenic
1198026005 X:132707865-132707887 ACAAGAAAGTTCCTCTCTGTGGG - Intronic