ID: 985632061

View in Genome Browser
Species Human (GRCh38)
Location 5:1018897-1018919
Sequence CTCTGCCCTTTCGGAGGCCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985632061_985632073 17 Left 985632061 5:1018897-1018919 CCTTGGCCTCCGAAAGGGCAGAG No data
Right 985632073 5:1018937-1018959 GGGGCATCTAGGGGAGCAGCAGG No data
985632061_985632065 -3 Left 985632061 5:1018897-1018919 CCTTGGCCTCCGAAAGGGCAGAG No data
Right 985632065 5:1018917-1018939 GAGAGCACCATCCCTGCTTTGGG No data
985632061_985632074 20 Left 985632061 5:1018897-1018919 CCTTGGCCTCCGAAAGGGCAGAG No data
Right 985632074 5:1018940-1018962 GCATCTAGGGGAGCAGCAGGTGG No data
985632061_985632068 6 Left 985632061 5:1018897-1018919 CCTTGGCCTCCGAAAGGGCAGAG No data
Right 985632068 5:1018926-1018948 ATCCCTGCTTTGGGGCATCTAGG 0: 1
1: 0
2: 1
3: 6
4: 169
985632061_985632066 -2 Left 985632061 5:1018897-1018919 CCTTGGCCTCCGAAAGGGCAGAG No data
Right 985632066 5:1018918-1018940 AGAGCACCATCCCTGCTTTGGGG 0: 1
1: 0
2: 1
3: 14
4: 142
985632061_985632069 7 Left 985632061 5:1018897-1018919 CCTTGGCCTCCGAAAGGGCAGAG No data
Right 985632069 5:1018927-1018949 TCCCTGCTTTGGGGCATCTAGGG No data
985632061_985632064 -4 Left 985632061 5:1018897-1018919 CCTTGGCCTCCGAAAGGGCAGAG No data
Right 985632064 5:1018916-1018938 AGAGAGCACCATCCCTGCTTTGG No data
985632061_985632071 8 Left 985632061 5:1018897-1018919 CCTTGGCCTCCGAAAGGGCAGAG No data
Right 985632071 5:1018928-1018950 CCCTGCTTTGGGGCATCTAGGGG 0: 1
1: 0
2: 1
3: 12
4: 120
985632061_985632076 22 Left 985632061 5:1018897-1018919 CCTTGGCCTCCGAAAGGGCAGAG No data
Right 985632076 5:1018942-1018964 ATCTAGGGGAGCAGCAGGTGGGG 0: 1
1: 0
2: 2
3: 33
4: 270
985632061_985632075 21 Left 985632061 5:1018897-1018919 CCTTGGCCTCCGAAAGGGCAGAG No data
Right 985632075 5:1018941-1018963 CATCTAGGGGAGCAGCAGGTGGG 0: 1
1: 0
2: 0
3: 20
4: 222

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985632061 Original CRISPR CTCTGCCCTTTCGGAGGCCA AGG (reversed) Intronic