ID: 985632065

View in Genome Browser
Species Human (GRCh38)
Location 5:1018917-1018939
Sequence GAGAGCACCATCCCTGCTTT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985632061_985632065 -3 Left 985632061 5:1018897-1018919 CCTTGGCCTCCGAAAGGGCAGAG No data
Right 985632065 5:1018917-1018939 GAGAGCACCATCCCTGCTTTGGG No data
985632056_985632065 14 Left 985632056 5:1018880-1018902 CCCACAGGGAGGAACATCCTTGG No data
Right 985632065 5:1018917-1018939 GAGAGCACCATCCCTGCTTTGGG No data
985632058_985632065 13 Left 985632058 5:1018881-1018903 CCACAGGGAGGAACATCCTTGGC 0: 1
1: 0
2: 1
3: 21
4: 202
Right 985632065 5:1018917-1018939 GAGAGCACCATCCCTGCTTTGGG No data
985632062_985632065 -9 Left 985632062 5:1018903-1018925 CCTCCGAAAGGGCAGAGAGCACC 0: 1
1: 0
2: 1
3: 8
4: 130
Right 985632065 5:1018917-1018939 GAGAGCACCATCCCTGCTTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985632065 Original CRISPR GAGAGCACCATCCCTGCTTT GGG Intronic