ID: 985632066

View in Genome Browser
Species Human (GRCh38)
Location 5:1018918-1018940
Sequence AGAGCACCATCCCTGCTTTG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 158
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 142}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985632056_985632066 15 Left 985632056 5:1018880-1018902 CCCACAGGGAGGAACATCCTTGG No data
Right 985632066 5:1018918-1018940 AGAGCACCATCCCTGCTTTGGGG 0: 1
1: 0
2: 1
3: 14
4: 142
985632058_985632066 14 Left 985632058 5:1018881-1018903 CCACAGGGAGGAACATCCTTGGC 0: 1
1: 0
2: 1
3: 21
4: 202
Right 985632066 5:1018918-1018940 AGAGCACCATCCCTGCTTTGGGG 0: 1
1: 0
2: 1
3: 14
4: 142
985632062_985632066 -8 Left 985632062 5:1018903-1018925 CCTCCGAAAGGGCAGAGAGCACC 0: 1
1: 0
2: 1
3: 8
4: 130
Right 985632066 5:1018918-1018940 AGAGCACCATCCCTGCTTTGGGG 0: 1
1: 0
2: 1
3: 14
4: 142
985632061_985632066 -2 Left 985632061 5:1018897-1018919 CCTTGGCCTCCGAAAGGGCAGAG No data
Right 985632066 5:1018918-1018940 AGAGCACCATCCCTGCTTTGGGG 0: 1
1: 0
2: 1
3: 14
4: 142

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985632066 Original CRISPR AGAGCACCATCCCTGCTTTG GGG Intronic